File size: 3,158 Bytes
7f81474 4b319ae 2139427 71a7e50 4b319ae 46304c5 4c21b5e ffaad4d 4c21b5e ffaad4d 4c21b5e 71a7e50 46304c5 4b319ae 4c21b5e ffaad4d 4c21b5e 71a7e50 4b319ae 2139427 4b319ae |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 |
---
task_categories:
- conversational
- fill-mask
language:
- en
tags:
- biology
- medical
pretty_name: genome database
size_categories:
- 10M<n<100M
---
# Dataset Card for Dataset Name
## Dataset Description
- **Homepage:**
- **Repository:**
- **Paper:**
- **Leaderboard:**
- **Point of Contact:**
### Dataset Summary
This dataset contains datas being collected from Genbank. The dataset is organized in a way that it separate all the genes from an DNA , and was classified according to the region and coding type. In that way, people could get more detailed information regarding each DNA sequences.
The dataset also contain source, which is the whole DNA sequence, where the user can use it to compare to each segment to see the exact location.
### Supported Tasks and Leaderboards
[More Information Needed]
### Languages
[More Information Needed]
## Dataset Structure
### Data Instances
```python
{DNA id: AP013063.1
Organism: Serratia marcescens SM39
year: 2017
region type:coding
specific_class: Protein
Product:thr operon leader peptide
sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA
gc_content:0.52173913
translation code: MRNISLKTTIITTTDTTGNGAG
start_position: 207
end_position: 276}
```
### Data Fields
__DNA id__: id number for the whole DNA sequence, sequences with same DNA id are from same DNA
__Organism__: Organism of the DNA
__year__: the year of the DNA sequence
__region type__: determine the general type of the sequence, such as coding, regulator, repeat region, etc.
__specific class__: if the sequence is coding sequence, it would be classified according to their production type such as RNA, Protein. The regulators would also be classified by their own class such as terminator, ribosome
__Product__ : if the sequence produce protein, the product name would be listed
__sequence__: the actual sequence
__gc_content__: the gc_content of the sequence
__translation code__: if the sequence produce protein, then the translation code would be provided as a reference
__start_position__: the start position of the segment
__end_position__: the end position of the segment
### Data Splits
[More Information Needed]
## Dataset Creation
### Curation Rationale
[More Information Needed]
### Source Data
The data collected are all from the most recent release of genbank, genbank 255.
#### Initial Data Collection and Normalization
[More Information Needed]
#### Who are the source language producers?
[More Information Needed]
### Annotations
#### Annotation process
[More Information Needed]
#### Who are the annotators?
[More Information Needed]
### Personal and Sensitive Information
[More Information Needed]
## Considerations for Using the Data
### Social Impact of Dataset
[More Information Needed]
### Discussion of Biases
[More Information Needed]
### Other Known Limitations
[More Information Needed]
## Additional Information
### Dataset Curators
[More Information Needed]
### Licensing Information
[More Information Needed]
### Citation Information
[More Information Needed]
### Contributions
[More Information Needed] |