Update README.md

README.md

@@ -23,7 +23,7 @@ size_categories:
 
 ### Dataset Summary
 This dataset contains datas being collected from Genbank. The dataset is organized in a way that it separate all the genes from an DNA , and was classified according to the region and coding type. In that way, people could get more detailed information regarding each DNA sequences.
-
+The dataset also contain source, which is the whole DNA sequence, where the user can use it to compare to each segment to see the exact location.
 
 
 ### Supported Tasks and Leaderboards
@@ -46,7 +46,9 @@ specific_class: Protein
 Product:thr operon leader peptide
 sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA  
 gc_content:0.52173913  
-translation code: MRNISLKTTIITTTDTTGNGAG}  
+translation code: MRNISLKTTIITTTDTTGNGAG
+start_position: 207
+end_position: 276}  
 ```
 
 ### Data Fields
@@ -59,6 +61,8 @@ __Product__ : if the sequence produce protein, the product name would be listed
 __sequence__: the actual sequence   
 __gc_content__: the gc_content of the sequence  
 __translation code__: if the sequence produce protein, then the translation code would be provided as a reference  
+__start_position__: the start position of the segment
+__end_position__: the end position of the segment
 
 ### Data Splits