Add files using upload-large-folder tool

.gitattributes

@@ -238,3 +238,4 @@ data_all_eng_slimpj/shuffled/split/split_finalaa/part-03.finalaa filter=lfs diff
 data_all_eng_slimpj/shuffled/split/split_finalaa/part-00.finalaa filter=lfs diff=lfs merge=lfs -text
 data_all_eng_slimpj/shuffled/split/split_finalaa/part-18.finalaa filter=lfs diff=lfs merge=lfs -text
 data_all_eng_slimpj/shuffled/split/split_finalaa/part-17.finalaa filter=lfs diff=lfs merge=lfs -text
+data_all_eng_slimpj/shuffled/split/split_finalaa/part-02.finalaa filter=lfs diff=lfs merge=lfs -text

data_all_eng_slimpj/shuffled/split/split_finalaa/part-02.finalaa

@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:3fc9eaa6eaa096bb6d2add3423080b5fe5e2240043b9c3d315bd7d4e9c575753
+size 12576672160

data_all_eng_slimpj/shuffled/split2/finalzztdlw

@@ -0,0 +1,5 @@
+{"text":"Wii should not even consider developing \" a cool new protocol for the Wii\"\nhelp with the decode plugin.\n> > laptops, a Wii, 3 tivos, a router, and an access point?\n> helped stave off the problems we're seeing now.\n> until you teach your proxy\/NAT box about the new protocol.\nfirewall\/router and catch\/create even more problems?","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Spotted learning about equine ancestors.\nSpotted on the street of a temporary childhood home. We lived there while my father did a photography project at Harvard. Apple meet tree.\nCreated in the spirit of Wee Traveling Horse (also here on Facebook) and Flat Stanley, as seen on Third Watch.\nReason for the trip. Mother-in-law needed a ride to pick up her new dog.\nSince I was at the breeder anyway, I picked up one for us.\nYou are beginning to make me wonder how someone who can acquire other critters so casually and easily has managed NOT to find a new horse yet!\naww! when do we get to see a better pic of your new dog? what's his\/her name?\nHmmm, Methinks MIL needs to ask for help with her newly acquired equine. Then your horse problem would be solved.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"I was thrilled when Deborah Prentice agreed to become dean of the faculty two years ago \u2014 her job is a challenging one, and she does it superbly. I have invited Dean Prentice to share her philosophy and perspective on the development of the University faculty. \u2014 C.L.E.\nAssistant professors are critical to the University's teaching and research mission. Shown here, from top to bottom, assistant professors Katja Guenther, Donnacha Dennehy, and Sarah Chihaya share expertise and scholarly interests with their students.\nApril has two distinct characters in Princeton's academic culture. For faculty and students, April is the sprint to the finish line, a period of accelerated activity as everybody tries to finish what they started, be it a course, a research project, a senior thesis, a dissertation, a performance, a lecture, or an extracurricular event. This sprint is given particular urgency by the warming temperatures, lengthening days, and blooming trees that signal the end of the academic year. For academic deans, by contrast, April is the crest in the road, the upward climb to a place where we can see ahead to the next academic year and beyond. For the dean of the college and the dean of the Graduate School, next year's entering classes are now coming into view. For me, as dean of the faculty, it is the cohort of new faculty members I see on the horizon.\nMost new faculty members recruited to Princeton each year are assistant professors beginning their first tenure-track appointments. They are highly educated and highly trained, with on average almost a decade of graduate school and postdoctoral work under their belts. Most have been trained in multiple fields; interdisciplinarity is now the norm. Assistant professors bring to campus new fields of study, new research and teaching methodologies, new ideas, and best of all, new energy. They are the future of their academic fields and of progress in knowledge creation more generally. We recognize them as our next generation of faculty leaders, the future of the University's teaching and research mission.\nNow, assistant professors are recruited \u2014 and treated \u2014 with the expectation they will succeed. They teach a regular load of courses appropriate to their areas of interest and expertise and advise a manageable number of undergraduate and graduate students who share their scholarly proclivities. They receive start-up resources that help them launch their research programs and sabbatical leave time to bring research projects to fruition. Although expectations for committee work and other forms of University service are low, many assistant professors contribute to the University in important ways and receive recognition for their efforts. The tenure bar at Princeton is as high as ever \u2014 perhaps even higher, given the increasing level of competition in the academic marketplace \u2014 but now more assistant professors clear the bar: Approximately 50 percent of the assistant professors who join the faculty this fall will eventually be promoted to the tenured ranks, compared with 30 percent in the 1980s and 1990s and 20 percent in the 1960s and 1970s.\nAn analysis of the causes of this change in the University's view of assistant professors would require another President's Page at least: The intensification of graduate training and growing prominence of postdoctoral fellowships, the segmentation of the academic job market, the escalating costs of research, and the immobility produced by dual-career family structures have all played a role. These trends and many others have shifted the process of building a faculty away from the pursuit of senior faculty stars and toward the careful selection, recruitment, and development of assistant professors. Importantly, this change is not a Princeton phenomenon; all of our peer institutions have undergone a similar shift over the same period of time. Indeed, in the last decade, both Harvard and Yale created a tenure track in response to their need to promote faculty members to tenured positions from within the university.\nPrinceton is now among the very best places for new assistant professors to begin their academic careers. I am proud of this distinction and am confident that it serves the University well. So as we come over the crest this April and see the remarkable group of assistant professors who will join us in September, I know the University is in good hands.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Science festivals will receive \u00a3250,000 of Scottish Government funding to support them in bringing science alive in a fun and accessible way, Science Minister Shirley-Anne Somerville has announced.\nUp to 15 festivals, which reach more than 200,000 people across Scotland annually, will benefit from the funding. These range from community-led events in rural areas to larger city-based events.\n\"Science festivals allow people of all ages, irrespective of gender or background, to interact with researchers, support science learning and promote careers in Science, Technology, Engineering and Maths. They help inspire not only our next generation of scientists, but also their families, adult learners and the general public.\nThe Minister also announced new funding of \u00a3248,000 towards an interactive exhibition at the Dundee Science Centre which will showcase Dundee's pioneering work in medical technology.\n\"We are delighted to have received this significant contribution from the Scottish Government towards our \u00a32 million upgrade and expansion programme, which includes the introduction of a major new exhibition.\nScotland is the only country in the UK to provide annual funding to science festivals.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"SvitekT, .; King, J.; Fulton, R.; McOmber, R.; Hastrup, R.; Miller, A.\nThe next phase of Mars exploration will utilize numerous globally distributed small low-cost devices including landers penetrators microrovers and balloons. Direct-to-Earth communications links if required for these landers will drive the lander design for two reasons: a) mass and complexity needed for a steerable high-gain antenna and b) power requirements for a high-power amplifier (i.e. solar panel and battery mass). Total mass of the direct link hardware for several recent small-lander designs exceeded the mass of the scientific payload. Alternatively if communications are via a Mars-orbiting relay spacecraft resource requirements for the local UHF communication link are comparatively trivial: a simple whip antenna and less than 1 watt power. Clearly using a Mars relay spacecraft (MRS) is the preferred option if the MRS mission can be accomplished in an affordable and robust way. Our paper describes a point design for such a mission launched in the s001 or 2003 opportunity.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzztmek

@@ -0,0 +1,5 @@
+{"text":"Hoisting Machine, Hoisting Machine Suppliers and Manufacturers at . Mining skip or cage lifting, mining hoisting and lifting equipment .. such as . TD Twin Cages Construction Machinery Passenger and Materials Building Hoist\/Lift\/. Quotation More. Vertical Electric Lift Mechanism.\nmining fabrication of skip and cages Description Rio tintos clermont mining infrastructure advanced skip to main content. home case studies rio tint. \u00bb Learn More cage skip mining. cage skip OneMine Mining and Minerals Library search results .\nmining machines potash for sale techasia. New Processing Equipment For Potash Mining. potash processing equipment mobile crusher sale price Potash mining . Get Price And Support Online; potash production process flow potash Rock Crusher . Get A Free Quote. potash ore mining machine Underground mining soft rock ore crusher price.\nexcel screw conveyor calculations power Crusher Machine B series vertical shaft impact crusher. High precision roller bearing, smooth main unit running, and long service time. excel screw conveyor calculations power.\nJul 26, 2016\u00b7Our range of equipment encompasses the entire requirement that a small scale mine will require gold mining machines for sale, BINQ Mining Gold Mining Equipment for Sale.\nmanufacturing companies in pune for quartz products. Gravel crushing machine mumbai Page 10 of crushed sand suppliers near mumbai, machine pour fabrication d agglomr en bton; Jaw Crusher.\nThere are 458,124 mining machine suppliers, mainly located in Asia. The top supplying countries are China (Mainland), Taiwan, and United States, which supply 99%, 1%, and 1% of mining machine respectively. Mining machine products are most popular in Domestic Market, Africa, and Southeast Asia.\n40+ items\u00b742 Mining Machines Companies in California. Search or browse our list of Mining Machines companies in California by category or location.\nCoal Mine British Path\u00e9 Miners arriving to work at coal mine.Lift cage loaded with miners descending. Miners and New coal mining machine being tested at mining institute in Russia .\nWabi Iron & Steel designs and manufactures mining cars, skips, mine cages, and a lot of other industrial equipment using high grade metals and manufacturing machines.\nSUBSTANCE mine skip hoist comprises drum type hoisting machine with steel rope secured to said drum, rope deflecting pulley, and skip Read More Chat Now. Skip Hoists Mixer Systems. mining fabrication of skip and cages BINQ Mining.\nFAMUR PEMUG offers a wide range of underground and surface works related to the construction and upgrading of mining hoists including the installation of machines, equipment and the steel structure.\nMining Equipment Manufacturers FAB 3R. \"Mining equipment used in drilling, crushing or grinding of various minerals are put to the test and may require more than one rehabilitation before being turned off. Get Price And Support Online; supplier mining equipment in germany. mining equipment manufacturers germany gibma. mining jaw crushers sale .\nHoistConstruction Passenger Hoist With Single Double Cages Material Or Forcing Type Concrete Mixer with Skip Hoist Hopper JS1500 Machine Price in Widely Used Standard sinotruk howo mining dump truck hydraulic hoist for sale.\nWith roots in the industry dating back to 1907, at Wabi Iron & Steel, manufacturing custom mining equipment is one of our fundamental strengths. We build the industry's finest quality material handling systems including mine skips, rail cars, mine personnel cages, and other underground haulage equipment that performs reliably in punishing working conditions.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Now that you have received your Illinois Concealed Carry permit, you must continue to train and practice with your firearm. It cannot be over-emphasized that the difference between marksmanship and combat marksmanship is truly the difference between practicing against paper and fighting for your life. This course details the use of the pistol in the development of your skills to improve combat marksmanship, not bulls-eye shooting. Students will need their firearm, a good holster, a minimum of 4 magazines and a magazine carrier and minimum of 300 rounds of quality ammunition. Be prepared to spend the entire day on the range. Everything you will be taught at this class will be utilized in the shooting drills at the end of the course.\nStudents should bring a lunch. Water and soft drinks will be provided.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"View all articles in category A residence in the middle of a dream!\nHow to make your Bedroom a place of serenity?\nSofa Beds = Space savers!\nDetails that make your Dining \u2013 Kitchen area a pleasure to be in!\nWhat is the importance of Accessories in a household?\nHow do I choose my sofa?\nWhat is different about the Exclusive Furniture?\nStyling your living area with Armchairs - Recliners \u2013 Stools.\nMaking your Living Room livable!\nWhy buy a corner \/ L-shaped sofa?\nCheck out the advantages of our Outdoor Furniture!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Check out our honest The Four Pillars Of Singing Review. If you desire to learn if The Four Pillars Of Singing is scam or just authentic you will discover about it inside our review. We've tested the product carefully and therefore made a legitimate review concerning it. You may want to read on if you are thinking of paying for this product.\nReview-Forum.Net is acknowledged as the world's top e-product expert. Review-Forum.Net editors evaluate articles using the following criteria to assign each review a one to five star credibility rating.\nHow up-to-date is the review compared to others?\nHow credible are the reviewer's top picks in relation to the top picks of other reviewers?\nHow exper is the reviewer?\nHow extensive and convincing is the reviewer's methodological approach compared to other reviews?\nAs part of this evaluation, Review-Forum.Net consider questions like these: Did the reviewers test the products? Which ones? How many? How did they pick the ones they tested? Does it appear that they tested things that most experts would consider important? Did they test products multiple times? Do they explain their test process? Do they clearly document results? Provide detail? Point out pluses and minuses? Compare products against each other?\nAt this point our testimonials has shown that The Four Pillars Of Singing isn't a scam. One important thing which may be said with regards to the merchandise is that it carries out what it is meant to do successfully. There's really no functioning left out of the merchandise. It's uncomplicated to educate yourself and not a great deal of undertaking is required to put it to use efficiently. We could not state that it is flawless and possesses no problems nevertheless the drawbacks are not that a lot additionally they don't severely have an impact on its entire appeal. It isn't that there is not any other decent merchandise but yet this one is likewise decent and also has to be tried.\nVisit HERE to OPEN The Four Pillars Of Singing official website in full page!\nSo far as we could say it's a sound merchandise from the product owner. Assuming you would like to get it we can easily suggest buying and analyzing it yourself. In the event you may have concerns concerning The Four Pillars Of Singing there exists this two months refund guarantee by means of which you'll be able to take your money back if you are not content with the product after you have put it to use.\nThe Four Pillars Of Singing owner is so confident that The Four Pillars Of Singing will drastically do what it promises. That's why the author is offering a 100% money back guarantee for 60 days. All you have to do is try it out, and if you didn't like it within those 60 days, just send the owner an email and they'll get you a full refund. It's that easy! There's absolutely nothing to lose!\nVicki\tReese says: The product performs fine looking at its product sales.\nJacquelyn Rosas says: Working with it will not be very much trouble as well as not too hard to grasp.\nEunice\tHines says: I myself would recommend this awesome product to my friends and others, especially to those who like to start working right away. It's easy to use. We can share or hold to ourselves as well.\nKerry\tPeters says: There are plenty of copies of the merchandise that appears to have been distributed till today.\nJanie Muller says: The Four Pillars Of Singing executes what it's required to perform plus takes on virtually all the functions wanted.\nMarvin says: The product performs fine looking at its product sales.\nLeona\tHubbard says: The Four Pillars Of Singing is not a scam. I had similar thoughts about all products but after checking out The Four Pillars Of Singing, I am very confident about its reliability. My past experiences have thought me not to believe in products very easily. They do not give what they promise. But when I heard about the money back guarantee offer from The Four Pillars Of Singing, I was tempted to give it a try. The first time I used it, I was really satisfied with what I got.\nEugene says: I just realized something. I have been using The Four Pillars Of Singing for 2 weeks and I have never had a single problem. Not even a gee. Whoever designed it really understands the user interface. it's so easy and logical that you hardly need to follow the tutorial. help file which in itself is a model of clarity. Plus, I haven't found a single bug. As I have written to you, I have been extremely satisfied with The Four Pillars Of Singing.\nAlbert Voelker says: Everyone in the world wants to be able to get more done in their life, but there just never seems to be enough time. In fact, when I ran a survey on my personel site, 82% of respondents replied with -not having enough time- as the reason why they are not currently able to accomplish their life goals.The Four Pillars Of Singing helps you achieve your goals in a short time.\nBennie\tLynch says: If you value your personal life, and where you will be going in your professional life, you will want to listen to what the owner of The Four Pillars Of Singing has to say. There simply isn't enough passion to enjoy life like their used to be and this owner will make you care about achieving greatness again. Do yourself a favor, and don't pass up the Output of The Four Pillars Of Singing. Pick it up, and do great things!\nLowell\tCurtis says: I like the product and was glad to have found it.\nGeorge\tPatton says: Utilizing it will not be too much trouble and not too hard to understand.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Our Ecological Footprint presents an internationally-acclaimed tool for measuring and visualizing the resources required to sustain our households, communities, regions and nations, converting the seemingly complex concepts of carrying capacity, resource-use, waste-disposal and the like into a graphic form that everyone can grasp and use. An excellent handbook for community activists, planners, teachers, students and policy makers.\nHuman footprints provide some of the most emotive and tangible evidence of our ancestors. They provide evidence of stature, presence, behaviour and in the case of early hominin footprints, evidence with respect to the evolution of human gait and foot anatomy. While human footprint sites are rare in the geological record the number of sites around the World has increased in recent years, along with the analytical tools available for their study. The aim of this book is to provide a definitive review of these recent developments with specific reference to the increased availability of three-dimensional digital elevation models of human tracks at many key sites. The book is divided into eight chapters. Following an introduction the second chapter reviews modern field methods in human ichnology focusing on the development of new analytical tools. The third chapter then reviews the major footprint sites around the World including details on several unpublished examples. Chapters then follow on the role of geology in the formation and preservation of tracks, on the inferences that can be made from human tracks and the final chapter explores the application of this work to forensic science. Audience: This volume will be of interest to researchers and students across a wide range of disciplines \u2013 sedimentology, archaeology, forensics and palaeoanthropology.\nShows kids the dimensions of consumption, including diapers worn as a baby, bread eaten in a lifetime, and recycled cans, and explains how to create a sustainable way of living.\nAccording to many authorities the impact of humanity on the earth is already overshooting the earth's capacity to supply humanity's needs. This is an unsustainable position. This book does not focus on the problem but on the solution, by showing what it is like to live within a fair earth share ecological footprint. The authors describe numerical methods used to calculate this, concentrating on low or no cost behaviour change, rather than on potentially expensive technological innovation. They show what people need to do now in regions where their current lifestyle means they are living beyond their ecological means, such as in Europe, North America and Australasia. The calculations focus on outcomes rather than on detailed discussion of the methods used. The main objective is to show that living with a reduced ecological footprint is both possible and not so very different from the way most people currently live in the west. The book clearly demonstrates that change in behaviour now will avoid some very challenging problems in the future. The emphasis is on workable, practical and sustainable solutions based on quantified research, rather than on generalities about overall problems facing humanity.\nResource depletion, global warming, escalating energy costs, poverty, conflict. As human life becomes increasingly complicated, cultural anthropologist John H. Bodley conceives a work that closes in on the social and environmental problems of our time and explores the deleterious global reaches of unsustainable growth in production and consumption. Anthropology and Contemporary Human Problems addresses the contemporary reader interested in social science and history, environmental studies, globalization, and the political economy and reveals the development of humanity and our global prospectus for the future.\nOur Ecological Footprint presents a powerful model for measuring humanity's impact on the Earth to reduce the harm we are causing the planet before it's too late. While some people believe we can find a middle ground between environmental conservation and economic development, or that future technological discoveries will solve the problem, the authors warn that our planet's limited resources simply can't support an economic system based on unlimited growth. Our Ecological Footprint offers a valuable tool to help us live more sustainably and safeguard our natural resources for generations to come.\nThe use of remote sensors for human settlement mapping and monitoring holds great promise for numerous fields of study, including urban planning and global environmental change and sustainability. While the potential for this technology is difficult to measure, achieving useful results at a regional or global level is but a recent accomplishment. Global Mapping of Human Settlement is the first book to provide a comprehensive overview of the methodologies, datasets, and approaches related to the use of remotely sensed data to map human settlements at the global scale, as well as the experiences encountered with their application. Valuable to a broad range of researchers, the book begins by analyzing the requirements for global and regional urban remote sensing. It provides a general background of global urban issues, outlines observation and assessment requirements, and looks at how these relate to current initiatives on international policy and strategic levels. The contributors, an international group of pioneering experts, describe the characteristics of human settlements as seen and mapped from remote sensors, either at the regional or global scale. They also discuss the spectral variety, special scales, and nighttime appearance as key remote sensing indicators of these environments. The text explores some of the most acclaimed and important projects and programs previously carried out or in current use for urban mapping and monitoring. These chapters highlight the impressive amount of information available and the processing and analysis techniques used to extract such data from several data sources, including satellite imagery. The book also explores some of the future challenges and makes recommendations regarding areas of research that should be actively pursued. DVD Included to Complement the Text To provide readers with the opportunity to experience the latest tools, the editors supplement the text with a DVD that provides samples of the latest products. These will assist readers in testing approaches proposed in the book.\nSingle copy of Our Human Footprint. Find out about your human footprint. That's the trash you throw out, the resources you use, and the carbon dioxide you send up in the air.\nThe inspiration for this volume of contributed papers stemmed from conversations between the editors in front of Chuck Hilton's poster on the determinants of hominid walking speed, presented at thel998 meetings of the American Association of Physical Anthropologists (AAPA). Earlier at those meetings, Jeff Meldrum (with Roshna Wunderlich) had presented an alternate interpretation of the Laetoli footprints based on evidence of midfoot flexibility. As the discussion ensued we found convergence on a number of ideas about the nature of the evolution of modem human walking. From the continuation of that dialogue grew the proposal for a symposium which we called From Biped to Strider: the Emergence of Modem Human Walking. The symposium was held as a session of the 69th annual meeting of the AAPA, held in San Antonio, Texas in 2000. It seemed to us that the study of human bipedalism had become overshadowed by theoften polarized debates over whether australo pithecines were wholly terrestrial in habit, or retained a significant degree of arboreality.\nHugh P. Possingham Landscape-scale conservation planning is coming of age. In the last couple of decades, conservation practitioners, working at all levels of governance and all spatial scales, have embraced the CARE principles of conservation planning \u2013 Comprehensiveness, Adequacy, Representativeness, and Efficiency. Hundreds of papers have been written on this theme, and several different kinds of software program have been developed and used around the world, making conservation planning based on these principles global in its reach and influence. Does this mean that all the science of conservation planning is over \u2013 that the discovery phase has been replaced by an engineering phase as we move from defining the rules to implementing them in the landscape? This book and the continuing growth in the literature suggest that the answer to this question is most definitely 'no. ' All of applied conservation can be wrapped up into a single sentence: what should be done (the action), in what place, at what time, using what mechanism, and for what outcome (the objective). It all seems pretty simple \u2013 what, where, when, how and why. However stating a problem does not mean it is easy to solve.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzvzun

@@ -0,0 +1,5 @@
+{"text":"posts of Engineering Manager - Maps Data Team, Software Engineering Manager, Government Affairs Manager, Site Reliability Engineer, Business Development Manager - Affordability and others. All the aspirants who possess minimum required job grabbers may apply online on or before dead line. Those applicant's who have superb command on speaking and writing skills on English language they are advised, go on the official website of the company and Apply for Latest Career Job Openings. Recruited appliers will receive good scale of pay per month. Applicants will be recruited on the basis of interview only that will be conducted on fix location.\nRemaining supporting information totally attached with applying method for Apple Recruitment is disclosed for all the visitors of this web page. Now eligible person must submit filled application As Soon As Possible, so guys apply soon to grab this opportunity.\nTo be a part of organization with a option of career, do just one thing that is have patience and visit the official website that is www.apple.com to read new notices of jobs. Desirable and sensible candidates will also be recruiting for other jobs if stay tuned with this portal. All the best to aspirants for this recruitment news!!\nFor other connected info of Apple Recruitment please read complete page.\nPay Scale: Selected candidate will get good amount as monthly income from the concerned department of this reputed organization along with perks, allowances and other benefits.\nEducational Qualification: Applicants must have Bachelor's degree\/ master degree from any approved university with great academic record.\nCandidates applying for Apple Recruitment must have required working experience in relevant field.\nAge Limit: All the excited candidates age should be as per the rules of the Apple. Upper age will be relaxable for reserved categories candidates shall be as per organization norms.\nOn the home page, press on \"Job Opportunities\" link given at the end of the page.\nNow go to the \"Search Jobs\" link given at the top of page.\nEligible candidates must read details and go back to previous page and enter on \"Apply Online\" tab.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Hello guys, i am here with another post. Today i am here to introduce you to a company i.e. Archive Rentals. Archive Rentals is a rental company and an event design house. They are known for their fine specialty rentals including tables, dining chairs, tabletop, lounge, ceremony seating, backdrops and much more.\nArchive rentals can make any event worth attending with their aesthetically pleasing designs. Though Archive rentals serve in California and have recently opened their new branch in Mexico, they can travel wherever you want them to, to make your event an event to remember.\nNot every design team wins award for their designs and creativity so Archive rentals surely knows how to be someone's favorite rental company. They have worked with plenty of well known companies and have gotten all great reviews. After looking at their stunning inventory of items i sure was more than just impressed.\nTheir sofas and chairs are beautiful. Have a look at this chair below. This chair is called Montauk Chair. It is super fabulous and have linen slip covers. Their montauk chair rentals are very popular because they can give any event a comfortable and an elegant look.\nOther than the gorgeous chairs and sofas their farmhouse table rentals are also top notch. This antique ice cream table parlor set caught my eyes while going through their website and i think it is absolutely beautiful.\nNow let me show you their mesmerizing arbors and backdrops. Arbors and backdrops can make any outdoor event charming. If you are planning any outdoor event, you should really check their arbors and backdrops, i am sure they will appeal to you as well.\nTheir eye-catching arbors and backdrops are literally making me swoon. I need to get a groom on rent so that i can get Archive rentals to design my wedding !! (kidding). Guys if you are interested in making your event an event to cherish forever, you need to get Archive rentals to work for you. They have a very creative and thoughtful team who will cater to all your needs and help you give your event a personalized touch.\nThis company can make any event stunning and breathtaking. You can have a look at their website and decide it yourself. Their website is also very interactive, descriptive and user friendly. You can easily explore all the categories and add everything you are interested in , in your wishlist. For more information , please contact ArchiveRental.com.\nThis is all for today, i hope you enjoyed reading this post as much as i enjoyed writing it. Have a nice day and keep visiting for more.\nGreat post about home decor. Love it!\nI enjoyed reading your blog post. I have never heard about this company, I think it's a great idea for when we make an event, to have a stunning and breathtaking decor. Thank you for your previous message.\nGreat post! Follow you dear!\nlooks lovely! very nice idea! the looks of the events are soo important!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"This island is full of mysterious creatures that lurk on various platforms. Reach the top of the level, killing creatures with the rainbow and collect bonuses they leave after defeat! Are you ready for this challenge?\nThis guy is fearless and he is not scared of these fabulous creatures. However, they are dangerous and can attack you any time. Don't get surrounded and keep your eyes open. Use rainbow to deal with dragons and other creatures that walk, fall or fly around you. Can you reach the top of the island before you get into the flood.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Hi, I'm Susi, a writer for Arcadian Lighting, a blog all about lighting fixtures and decor ideas. I am so happy to be guest blogging here at Bisous Chic today. I was inspired by your post on the amazing conch shell bags in the Chanel Spring 2012 collection. I've turned four of the gorgeous outfits from the runways into rooms inspired by the colors, textures and accessories from the collection. Hope you enjoy!\nPink tweed with the signature contrasting piping in black is so timeless Chanel. I love the deconstructed tailored jacket over the ruffled skirt.\nThis ruffled duvet cover has the same gorgeous layers of fabric as the skirt above. The look would be completed with a pair of shams in pink linen or tweed with black piping..\nThe shell clutch and sea anemone ring look incredible. Against a gorgeous silk stain with tons of beautiful details, these accessories are more chic than coastal.\nLove all the gorgeous details and pale pastels in the 2012 Spring collection. Tweeds, piping, rope details, and classic Chanel chains are great inspiration for decorating.\nThis room is all about textures and details. Grasscloth on the walls offers a similar texture to tweed. Sparkling gold accents with simple table lamp; rope woven jute area rug and pale pastels give this room a beautiful layer of colors and textures.\nBeautiful soft aqua, cream and gold colors with loads of texture make this dress incredible. Feathers, lace and beading offer intricate detail.\nLayers of aqua and gold mixed with cream make this bedroom gorgeous. I love the feathery gold spray of the sunburst mirror, the sparkle of the pendant lights and the rich, swirling damask of the canopy fabric.\nWhat do you think of the post? Comments are welcome! Don't forget to check out Arcadian Lighting for some fashion inspired lighting fixtures for your home.\nThe pink bed cover is so gorgeous!\nThis all chandelier inspired looks and designs is gorgeous!\nI love the bed, it looks very comfortable to sleep on. A good bed really improve sleep especially to those who are suffering from insomnia.\n\u0440opular b\u0435c\u0430us\u0435 you \u0441e\u0433tainly pos\u0455\u0435ss the gift.\n\u03c9ebsit\u0435 and \u0456n accession capital to a\u0455sert that \u0399 acquire actually enj\u043ey\u0435d \u0430ccount y\u03bfur blog posts.\nAn\u0443wa\u0443 I'll be subscribing for your feeds or even I success you get right of entry to consistently fast.\nproper choice is done, they may be of great benefit and utility on the borrowers.\ncell phone .. I'm nott even using WIFI, just 3G ..\n. They went out to a coffee shop to discuss the book, and Lisa told her that Louis Vuitton Outlet she hadn\ufffd\ufffdt been able to finish it. Simpson told her she would like the ending. Over the years Lisa had an on-and-off relationship with Simpson, but it would be closer in some ways than prada outlet the one she had with her father.\nWebsite Design Company in Bangladesh - Creative Tech Park Dhaka BD is the Ultimate Web Design and Development Company Bangladesh to Ensure Creative Technology all over the world with full customer satisfaction than ever. Best web site design company to develop your web page design and custom website package with top graded SSD web hosting and website domain name registration with an affordable price.\nAutosbd, is about motorcycles and cars. Our mission is to make you feel comfortable in choosing cars or motorcycle and gives you all those information that you can get by searching for hours from different websites.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Naturally, some people don't choose bankruptcy, it may be forced upon them by a creditor seeking to collect their unpaid debt. Regardless of whether a bankruptcy starts by a debtor's petition or a creditor's petition, the outcome is always the same: debts are extinguished\u2026just not all debts.\nThis article looks at which common debts are extinguished in a bankruptcy and which are not. Some of the answers might surprise you. Obviously, this article is general in nature and shouldn't be taken as authoritative advice. If you or your client need specific advice on what debts are extinguished in bankruptcy \u2013 please contact us directly.\nBut many people may not know the extent of which debts are covered in bankruptcy. The following table provides examples of the most common debt extinguished in bankruptcy \u2013 including some practical issues that may arise despite the bankruptcy covering the debt.\nAs you can see from the list of extinguished debts the effect of bankruptcy can extend to a whole range of debts, which can give people struggling with those debts a very real and fresh start. For clients considering bankruptcy, Worrells has 17 registered bankruptcy trustees ready to talk through individual circumstances and their options to get a solution that fits.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzaaacw

@@ -0,0 +1,5 @@
+{"text":"Lithonia FHE LED vapor tight is constructed from a 5VA rated fiberglass housing and an acrylic impact-resistant diffuser. The FHE LED vapor proof fixture is able to be high-pressure hosed down and mounted in wet locations where dust is present. FHE LED wet proof fixture is able to be mounted to the ceiling or suspended mounted. With an LED life rate of 100,000 hours, the FHE LED vaportight fixture is great to be mounted in cold storage, warehouses, car wash, food processing and more indoor moisture prone commpercial applications.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"In this post, I am going to share one error that I faced couple of times earlier and its resolution.\nYou have created a installer using Web Setup project with VS 2010. Using this you used to install the application on IIS7.5. Now you got a new machine with IIS7.5 installed (or you installed manually). Now after making the required changes, when you are installing with the MSI, you are getting the following error.\nNow as per the message, you restart the installer but you get the same message again.\n2- Windows Installer installed the product. Product Name <Application name and details>. Manufacturer Name \u2013 <manufacturer name>. Installation success or error status 1603.\nFrom all the above information, there is no indication about the actual cause of the error. From the above error code if you search on Internet, you will find different resolutions but not the one discussed here. At least I didn't the below resolution for the above problem.\nNote \u2013 The above message or code that we found looks like common for many other errors so there could be different resolutions based on scenario.\nOne of the possible reasons that it is not getting installed because IIS6 management compatibility is not configured on IIS. So let's see the steps to configure it.\nOnce the above steps completes. You should be able to install the installer on your machine.\nNow let me briefly discuss that What is IIS6 management compatibility and why the issue surfaced in the above case?\nIIS7+ is completely overhauled and there are many breaking changes in it. IIS7 introduced two modes Classic and Integrated mode. Integrated mode combines the modules of IIS and ASP.NET when application runs in Integrated Mode. All the metadata moved to different file in IIS7. So If an application uses the features of IIS6 then it should configure the IIS6 management compatibility in IIS7.\nNow the question arises that why do we need this?\nVisual studio 2010 installer still targets the older version of IIS (means IIS6) although IIS7 was publicly available in 2008. That's why IIS6 compatibility is required.\nHope this post will help you.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Spotted this lady seeking the sun outside her place of business \u2026there was no need for salon spray tans or sunbeds in Blackpool yesterday, the sun shone and as the tide went out the beach filled with children enjoying the last weekend of the summer holidays.\nHad forgotten all about this box of old letters\u2026about 45 years worth of letters, cards and telegrams\u2026some from family when I first left home to study and work in theater, others from friends from all over the world..many of whom I still keep in touch with though others have since died so the letters and cards are all the more precious. At the bottom of the box was happy to find a bundle of love letters tied together with string. There are little notes on the back of envelopes, scribbled love poems on cards and train tickets, others long 3 or 4 page missives, some written in pencil others in Biro or colored crayon and some in fountain pen\u2026and hundreds of Baci Perugina wrappers, little Italian love notes written on silky transparent paper.. As I sat in the garden reading these lovely letters I wondered to myself what will the kids and grand kids say when I die and they get to read all the saucy secrets of Mamma and Papa'\u2026maybe I should burn the letters now? No\u2026 will leave them in the box, put the 'Letter Box' back on top of the wardrobe and leave all our scandalous secrets for the kids to discover!\nI have been helping a friend to decorate, not my favorite pastime as would much rather been on the streets shooting the unsuspecting and unusual, but am a firm believer in pay it forward and so I thought would lend a hand. Was there early morning to empty bookcases and shelves and move furniture, we tackled all the heavy jobs covering the lovely table and vintage furniture with dust covers. The last thing to do was take the framed photographs of family and friends down from the walls\u2026\u2026\u2026.. ..what a strange feeling to see the empty place where the memories had once hung, I was reminded of John Irving's novel 'A Widow for One Year' and had to stop all thoughts of paint and masking tape to root in my bag to find my camera. The painting will be finished tomorrow and we'll print and frame new images for the wall but the shadows of the space where the picture was will stay in my mind now even though I know next year there will be new shadows and marks made from new memories.\nA recent trip to London saw me taking hundreds of photographs of tourist spots, works of art and all the usual stuff one shoots when in our beautiful capital but these two images are among my favorites mainly because they're taken at The Tate Modern.. this first one because it shows that book shops will always have customers even though we can now read anything and everything on kindle and iPad.. ..and this second one cause it shows that reading is still one of the nations favorite pastimes\u2026and 'cause I love the brickwork behind her.\nMaking the most of these last warm days before we are plunged into dark damp autumn I sat in my garden this afternoon reading and noticed the shadows of plants and shrubs on the sheet drying in the sunshine. I spent the next 30 minutes lying on the grass muttering to myself, to the wind and the sheet, cajoling the wind to blow in the right direction and the sheet to billow towards the bushes so I could capture the shadows. I could see all this in my mind's eye\u2026imagining gusts of wind lifting snowy white sheets and me capturing romantic oriental type shadows on the crisp linen. The truth however is completely different and much more difficult than I initially thought\u2026after half an hour messing about and getting blur and washed out images I cranked up the shutter speed to 1\/4000 sec to capture the sheet in the wind and stopped down to f18 to keep the bushes dark while shooting into the sunlight\u2026. getting so close to the sheet as it whipped around the bushes that I could see the green color of the plants through the damp cloth Not quite the elegant stark minimal images I imagined but a fun way to practice and enjoy the afternoon.\nDriving down a country lane near home recently I noticed the verge was in full bloom and asked my long suffering very supportive husband to stop the car while I rummaged through bags trying to find the right lens. Risking life and limb on the roadside while cars flew past at what am sure are illegal speeds I crouched amid the wild flowers, nettles, wasps and beautiful fat bees and quickly filled my viewfinder with sunshine and flowers.\nSometimes things just happen in photography and I know the moment I press the shutter button I have caught my 'image of the day' . I couldn't believe my luck when on a recent trip to London to photograph urban art I spotted this guy and everything fell in to place\u2026the door artwork by 'skeletoncardboard' \u2013instagram.com\/skeletoncardboard\u2013 seemed shocked that someone would even consider leaving the house dressed in such a manner and the art on the wall next to door seems to have nothing but contempt for the color of this guys trousers, which do in fact match it's background, and his Pringle sweater. Everything came together, everything worked and even his socks if you look carefully match the blue on the wall. Oh! the joys of people watching and photography, there is treasure everywhere!\n..and someone walks in to the frame..\nThe Annual Airshow in Blackpool this year saw the Avro Vulcan Bomber XH558 making one of its last flights before retiring..I of course was waiting eagerly with hundreds of others on Blackpool's North Pier, long lens on my Lumix, camera raised to eye as the aircraft turned to fly past the end of the pier, aimed, focused\u2026.and in walks a guy with a panama placed jauntily on his head to keep the sunshine out of his eyes and almost block my view!\nHave to admit though that i do like the finished 'spy story ' book cover sort of image have ended up with..oh the joys of saving a duff image from deletion by converting it to black & white!\nJust turned a corner in London and there it was..how could I resist? I did have to back up a wee bit to fit it all in and was still struggling but wasn't going to leave without capturing it. The best thing about street photography for me is that it always surprises me\u2026there isn't a city street, small town, coastal town or village anywhere in the world that doesn't hold some sort of 'treasure' waiting to be captured by some crackpot like me with a camera.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"A highly flexible and robust ducting. For use in many industries such as metallurgy, wood working, food, pharmaceutical industries. Ideal for the conveyance of grains, granules, sawdust and wood chips, metal filings in humid and\/or warm conditions. Specially suitable for street vacuum cleaners and lawn mowers. Flame retardant according to DIN4102B1 or antistatic material in option.\nLight and easy to handle. Non toxic food grade polyurethane resisting to hydrolysis and microbiological attack. Outstanding resistance to abrasion and piercing. Excellent mechanical flexibility due to perfect cohesion of components (PVC-coated spring steel helix welded to polyurethane wall). Smooth inner tube ensures optimum flow. Good resistance to ozone and ultraviolet light. Good resistance to most of oils, solvents, and industrial chemicals in the vapour phase at moderate concentration.\nStandard: non conductive. Option antistatic, R<10^8\u03a9\/m: consult us.\nAbrasion ISO 4649: 40mm3. Option flame retardant, DIN 4102B1: consult us. Halogen and plastiziser free.\nFood contact: EU regulation 10\/2011\/CE.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"As it frequently happens, the simplest solutions are the best, but simple does not mean banal. Therefore, you cannot remain indifferent to the Oxxo design. The original combination of materials emphasizes the simple but interesting organic bucket shape. The non-conformist and captivating design makes Oxxo far from boring. Oxxo is available in variety of styles including wire frame, with castors wheels, cross base and wooden legs. This armchair adds character to any room and its users will experience the utmost comfort, whether it is used at home, in an office, waiting room or other places.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzaaxrb

@@ -0,0 +1,5 @@
+{"text":"\"I want to be an astronaut.\"\nEvery child has a dream. But millions of children have no hope of achieving their dreams because they cannot get a quality education.\nYour gift will help spread the Teach for Life movement to more countries and languages, empowering teachers with knowledge and skills so they can better educate their students.\nTogether, we can help children reach their dreams.\nYour donation to Trees for Life, our parent organization, will be designated for Teach for Life.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Tech 2U offers Fair Oaks computer network services, for homes and businesses. If you're having trouble setting up a computer network, or an exiting network isn't working properly, you can rely on us! We've been working on computer network systems for years. We're your number one option for Fair Oaks computer network services, and we're ready to help.\nOur technicians have seen just about every type of computer network problem. They've dealt with VPNs (Virtual Private Networks), faulty cable rounters and networking cards, and even sniffed out wi-fi interference causes. Not only have we seen these issues, we've found a way to resolve them for our customers. Tech 2U has earned an A+ with the Better Business Bureau, thanks to our team of motivated professional technicians. We fully guarantee satisfaction with our Fair Oaks computer network services!\nOur team specializes in servicing all major current network equipment brands. We're able order the replacement parts you may need to get your network back up to speed, and are also capable of installing it for you.\nCall Tech 2U at 916-481-8324 to schedule a mobile technician to come out to your home or business. Whether it's repair an existing network, or start a new one, we're prepared to help! If you prefer speaking with Tech 2U staff in person, you can visit the local shop at 12417 Fair Oaks Blvd, #350. We're next to the In & Go market.\nTech 2U serves the entire Sacramento Metropolitan Area! You can find shops in Rocklin, Roseville, Sacramento and Gold River.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Today, an attorney takes to the pages of a national publication to declare loudly and for all to hear that she is dumb, easily persuadable, and lacking in any genuine moral foundation whatsoever.\nIf you just saw Barbara Smith, a well-dressed attorney, walking down the street, you might assume that she is a rational person who makes important decisions about political philosophy by thoughtfully considering policy positions. This is not so. And Barbara Smith feels strongly that everyone in the world must know how shallow and self-serving her personal decisionmaking process is. So she quite naturally wrote an op-ed for the Wall Street Journal to explain in detail.\nAfter the inauguration of Donald Trump, Barbara Smith got all dressed up and set out to attend an inaugural ball. As she was walking down the street, someone threw an egg at her. An unpleasant but ultimately minor occurrence attributable to a lone bad actor? Not at all. For Barbara Smith, this egging incident was a reason to boldly valorize herself and reform her world view to embrace an entire chaotic political philosophy. And she wants you to know it.\nAt best, I had been a lukewarm and silent Trump supporter, a Goldwater-Reagan-George W. Bush girl who had decided to attend the ball mostly for the opportunity to wear a fancy dress. But when my heels hit the sidewalk that second time, I committed: I would now back President Trump.\nI don't expect to agree with all of his administration's policies or even the rhetoric that Mr. Trump employs to make his case. But being assaulted based on an assumption that I supported him had a way of breaking through my reservations.\nI choose to stand with the ridiculed, the insulted, the belittled. I stand with those who voted for something new and different and a little scary. I stand with people who are tarred as bigots and misogynists\u2014or even egged\u2014simply because of their views on taxes, health-care reform or government entitlements.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Non-emergency medical transportation involves getting a patient to and from the source of medical care when the medical condition is not life threatening. Heaven On Wheels Limousines provides its non-emergency medical clients with over 15 years of experience servicing passengers who do not need wheelchair accessible vehicles but who can not drive and who just need a ride.\nHeaven On Wheels Limousine Service has excellent computerized tracking and reservation systems as well as cameras in many of its vehicles for the documentation of events if an incident should occur.\n\u200bThe benefit of Heaven On Wheels Chauffeured transportation providing these types of non-emergency medical transportation in our fleet of sedans, suburban and van is the time and cost saving this service encourages. A great example of cost savings would be asking a friend or loved one to take you to and return you home from one of these procedures. They leave their job, drive to your home, pick you up, deliver you to the doctor's office or outpatient location, then return to work. Later, they leave their job, drive to your appointment, drive you home then drive back to work.\nPlease consider the convenience and reasonable cost that Heaven On Wheels and its family of chauffeurs can provide you with. Our Chauffeurs are required to obtain commercial drivers licenses, placed through rigorous background checks, randomly drug tested and are put through a company specific training program and have the full support of a staff of reservationists, management and dispatchers to assist them in our company's overall effort to provide phenomenal customer service while being sensitive to the needs of our clientele.\nHeaven On Wheels Limousine service can provide transportation for medical appointments in different cities, eliminating the need for overnight stays and is an extremely worry free method of travel.\nThe non-emergency medical transportation services are provided 24 hour per day, and our services are available every day of the year.\nAt Heaven On Wheels Limousine Service, ground transportation for surgeons, physicians and transplant coordinators is an ever growing portion of our business. We will meet your team on the tarmac, deliver them to the requested hospital or specified location, wait, then return your team to their jet or desired location.\n24 hours per day, every day of the year, Heaven On Wheels Limousine Service relies on its amazing team of office staff, dispatchers and chauffeurs to cater to the needs of clients who need immediate ground transportation services at any time and ASAP if needed. With years of hard work and dedication, Heaven On Wheels has established itself as the premier choice for many who use ground transportation services for medical coordinators nationwide.\nManagers are available 24 hours per day to assist medical professionals with any concerns they may have. Heaven On Wheels is An Amazing Company Doing Amazing Things For Amazing People.\nHeaven On Wheels Limousine Service and its employees have a multitude of years of experience providing ground transportation services to worker's compensation clients nationwide. Our chauffeurs are trained to function as directed by the Client, not the passenger. If you represent a medical facility that utilizes Heaven On Wheels Limousine Service to provide service to your client, we are trained to provide both our client, your firm, and your client with our chauffeur's telephone number. We are also trained to abide by the directions given to us by the medical facility or worker's compensation company and to contact our client if our passenger requests any changes to the itinerary.\nOur vehicles are equipped with safety equipment such as Global Positioning Systems, Onstar and many of our vehicles are equipped with cameras that activate in the case of an incident.\nWhether your client needs to be picked up and delivered within the same city or driven to another state, Heaven On Wheels Limousine Service is here to assist you with your Worker's Compensations ground transportation needs.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Gold ore preparation work before the election mainly screening, grading and washing. Preparations gold sand gravel production line not to be carried out before the election, sand production line in the sand gold usually do not require crushing grinding, compared with the gold veins, you can save a lot of investment in equipment and operating costs. For single particles into the rock to make a valuable mineral particles are completely separated from the sand crushing gold also need to have a job, but generally do not need a separate process.\nAlluvial gold concentrator multi-use jaw crusher for primary crushing, the use of cone crusher or impact crusher in the crushing, crushing and the short head type is used cone crusher and roller crusher, there is also counter-crushing machine. Most small-scale alluvial gold plant which uses a closed-circuit crushing two large alluvial gold plant using three segments a closed-circuit crushing process. In order to increase the production capacity of beneficiation, gold mining equipment selection potential to improve the utilization factor makes grinding machines, the main measures taken to implement more crushing less grinding to reduce the particle size of ore into the mill.\nWe are alluvial gold beneficiation process, gold processing equipment, drum dryer, sand production line, mineral processing equipment production line, aerated block equipment, ball mill, magnetic separator and other professional production and processing of a limited liability company, we have a complete and scientific quality Management System. Our integrity, strength and quality of products recognized by the industry. Welcome friends we visit, guidance and business negotiation.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzacnxg

@@ -0,0 +1,5 @@
+{"text":"Beautiful Panda and Suki, who are 6\/7 months old, were born outside and are currently in a foster home. They love to play and enjoy being stroked. They aren't yet at the stage where they like being picked up very much, but we think this will change over time.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"More migrants in jobs, better performance in school: The OECD is making progress in integrating foreigners in Germany. Challenges persist especially for the low skilled.\nThe Organization for Economic Cooperation and Development (OECD) sees \"considerable progress\" in the integration of migrants in Germany. In Berlin, the OECD has presented a study, in particular, that has improved the educational achievements of migrants and their integration into the labor market.\nAccording to the OECD, the proportion of migrants who have a job has increased in the past ten years in Germany by almost eight percent, to 67.3 percent. Twice as strong as non-migrants. The gap between Germans and migrants in the labor market thus closes. This is not the case in all industrialized countries.\nSchool children also exclude children from migrants. In PISA reading literacy tests, they improved by about 50 points between 2006 and 2015, before the migration of more than one million refugees, to 441 points. A significantly stronger increase than their non-immigrant counterparts, which improved by 17 points.\nThe better performances of immigrants and their offspring in the PISA test have not yet been reflected in better deals. Around a quarter of the children of migrants in Germany have neither a high school diploma nor a completed vocational training. This puts Germany in a worse position than the OECD and EU countries as a whole.\nCurrently around 8.5 percent of the migrant children born in Germany are in the civil service. In the comparison group of 15 to 34 year olds without a migration background, it is more than 17 percent.\nLiebig sees exemplary countries like Sweden here as exemplary. \"In the second generation, countries that have been pursuing a very intensive and active integration policy for many years are doing relatively well.\" The employment rate of women with a migrant background is particularly high in Sweden.\nIn addition, migration in Germany would be perceived more positively than it was ten years ago, according to Liebig. However, it is about migration in general and not about asylum seekers. Almost 13 million people living in Germany in 2017 were born abroad, according to the study. That's about 16 percent of the total population. This places Germany in the upper midfield of the industrialized countries.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"People who can't afford to hire a lawyer to handle their divorce or custody dispute can at least get help from one while filling out court forms.\nThe Teton County Access to Justice Center is beginning a series of workshops to help residents representing themselves in family law cases navigate the paperwork smoothly.\nWorkshops began July 30 and will run every Wednesday from 4 p.m. to 5 p.m.\n\"Filling out those forms correctly should hopefully speed up the process for everyone involved in these cases,\" said Lauren Browne, the center's executive director.\nThanks to a grant from the Community Foundation of Jackson Hole, the income guidelines that usually apply for those seeking the center's services are not in effect for this program, Browne said.\nThe center's workshops are free for all comers and are first-come, first-served.\nAn Access to Justice lawyer will be there to provide guidance in filling out forms for everything from divorce actions to custody, visitation and child support cases.\nAssistance also will be available for Spanish-speaking clients, Browne said.\nPeople who hope to attend the workshops should bring with them copies of the forms they need to fill out.\nForms are available at the Teton County Courthouse and online on the Wyoming Supreme Court website, at Courts.state.wy.us.\nAnyone seeking legal advice should be aware that the lawyers at these workshops will provide guidance on the forms alone.\nThe workshops will be held at the Access to Justice Center, located on the lower level of 185 S. Willow St., which is next to the Teton County Jail on the corner of Willow and Simpson Avenue.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"I'm Mark Hill and I'm an Environmental Liability Manager at DIO. My job is all about mitigating the business risk arising from our current infrastructure activities and those that have resulted from our historical ones, to ensure the safety of personnel and the public, regulatory compliance and environmental protection.\nIt's not just about land quality assessment - although contaminated land remains a key business risk for the Ministry of Defence. It's much wider and embraces everything, from pollution prevention and control through to environmental noise, air quality, waste and of course contaminated land.\nIn essence, we quantify environmental liabilities and help ensure organisations like DIO manage or mitigate the potential operational risks arising from them, thereby reducing the potential for regulatory action, claims, project delays, unnecessary expenditure and reputational damage.\nI entered the profession following a secondment to the Ministry of Water Resources in Oman where I'd been part of the groundwater resource assessment division involved in strategic resource development and protection work. This included looking at pollution risks from farming and the petrochemical industry.\nI found that the profession allowed me to combine my interest in finding practical ways to address environmental impacts with that of risk management and problem solving. Like many within this field I do like a challenge.\nHowever, it was not until 1998, when I joined DIO's predecessor Defence Estates on secondment from industry - bit of a theme here - that I was really able to get involved in and drive all aspects of the assessment and management of environmental liabilities and their associated health, environmental and financial risks.\nDuring my time with MOD, I've been part of Government and MOD committees and working groups advising on everything from soil guideline values through to energy, carbon and radioactive waste management. I've also advised Ministers, deployed on operations and on occasion attended Parliament, not to mention a stint at the Joint Services Command and Staff College.\nMy day is generally a little hectic and tends to involve a host of activities with challenging timescales and competing priorities.\nThese include responding to pollution incidents, updating work programmes, tracking spend, authorising invoices, reviewing reports and providing advice and guidance to Projects and Operations. I also work closely with DIO's Parliamentary team at to answer Parliamentary Questions, Ministerial Correspondence and Freedom of Information requests.\nOne of the highlights of Mark Hill's career has been briefing the Secretary of State and other ministers and attending adjournment debates.\nI also spend time providing progress updates, drafting briefing papers, visiting sites, liaising with regulators and both UK Government departments and devolved administrations. I work with the legal department to address legal liabilities and advising and mentoring colleagues. I work to update guidance and policy (or else verify its application) with Strategy and Policy colleagues and the Defence Safety and Environmental Authority.\nThe highlight of my career with DIO so far has to be being called upon to brief both the Secretary of State and Ministers and attending a number of Adjournment Debates in Parliament. This has been a particular privilege.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"What is really going to make 2013 Your Best year Ever?\nWe have a number of event that are coming up \u2013 both in person live events and live online webinar trainings. Check them out now.\nIn this video Andrew Baird reveals what is really important to transforming your business into a highly profitable and extremely successful business. It's not all about the perfect strategies, not about how you do it\u2026but something else.\nFind out what is going to help you the most to make 2013 your best year yet in your business. Go Rock it!\nHi Andrew, I have been in the motor industry for the past 32 years. I contract at Castrol SA as a consultant doing some soft skills training and after sales consulting in the motor industry. I have been with this organization for the past 5 years. I want to go on my own and grow this business within the motor industry. I have the skill and knowledge for this industry. I currently do not have my own training materials or consulting tools to do the work. The training materials and tools i currently use have copy rights and patents to them. Any suggestions from your side to how i can expand my current business.\nObviously option 3 is the most work and will take more time and energy, option 1 may or may not be possible depending on who created the current material (may be inhouse or restricted) which leaves option 2 as [probably] your quickest and fastest way to move forward.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzadtao

@@ -0,0 +1,5 @@
+{"text":"Fantastic opportunity for an experienced Planner with drive and ambition to take their career to the next level.\nMy client is looking for the very best in Planning, people whose ambition and expertise will help them go from strength to strength. In turn, my client will help you build an amazing career.\nYou will work alongside professionals who are recognised experts in their fields and help solve some of the most complex planning issues affecting business and government today.\nHighly Specked Central Manchester office.\nOur client offers a highly competitive salary along with a range of exciting benefits. This is an exceptional opportunity to join an ambitious business with significant growth plans ahead. My client offers a lot of training as well as great scope for rapid progression and reward.\nYou will have significant input in to the growth and development of the business.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Roundup: Newlywed Recipe Stash \u2014 TASTE. SAVOR. SHARE.\nTo finish our Newlywed week, I wanted to share recipes that Saleem and I have made during our first year of marriage. I think our friends will tell you their favorites were the bacon wrapped breadsticks and the car bomb cupcakes. Give one of our favorites a try or all of them, you won't be disappointed. (links below image) Enjoy!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"I'm so excited about this collaboration that it's taken a lot of effort on my part to keep it quiet until now! Peter Rabbit was always one of my favourite books when I was a kid and I've loved seeing how the stories have evolved over time, both with the TV series and now with a new Peter Rabbit film. I was asked by Joules if I could come up with some Peter Rabbit crafts to celebrate their collaboration with Peter Rabbit and my kids were desperate to be involved, in fact we did these first thing on New Years Day as they absolutely couldn't wait any longer!\nLast year at school my son studied The Snail and the Whale by Julia Donaldson and I remember thinking at the time that there weren't that many The Snail and the Whale crafts about so after making our movable paper plate ghost last week I thought it would be fun to try and make a little craft of the two friends off on their adventure around the world!\nI'm so excited today to be working with Ora to celebrate world space week and share some news with you about their partnership with Penguin Random House Children's UK book Goodnight Spaceman (which I love! Really love!) This awesome partnership means that you could get your hands on a audiobook of Goodnight Spaceman read by the first British ESA Astronaut Tim Peake and recorded by him in space. I'm also sharing two rather cool little crafts to go alongside it \u2013 one below myself which has a free printable and one from Ora. Ready for adventure? Belt up and let me tell you about all of it!\nSuperworm by Julia Donaldson is one of our favourite kids books and while we were reading it the other night I suddenly realised that it would be super easy to do some sensory play along side it. As well as playing with it my three year old daughter really enjoyed helping me set this Superworm sensory play up and we had a good time reading along with the book and acting it out too!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"A schematic picture of the geological history of the southern Finland. a) 1900 million years ago island arcs (green) formed, when two oceanic plates collided. Sediments are formed from the eroded material (blue). b) 1880 \u2013 1860 million years ago the island arcs collide with a microcontinent (yellow) at the Fennian orogeny. Rocks were subjected to high pressure and temperature, and were metamorphosed. c) 1850-1810 million years ago temperature and pressure rises as a result of new collisions and the lower part of the crust starts to melt (pink). Image: Ari Brozinsky and Olav Eklund.\nSvekofennic main area (Finland, eastern Sweden and northern Estonia) was formed, when island arcs collided with the microcontinent at the north. Rocks from the island arcs and ocean sediments were folded and pushed upwards forming a new mountain range. This formation of mountains is called as Fennian orogeny.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"H. Phillip Johnston enlisted in December 1943. He had hoped to be a pilot, but when he and several others in Australia were approached to go to Canada to train as Wireless Air Gunners (WAG), he decided to take the opportunity. After completing his training, Johnston was sent to Mont Joli, Quebec before returning home to Australia.\nIn the following excerpt, the airman recalls the long and arduous journey from Australia to Canada, which began in May 1944.\nWe boarded the S.S. Cape Perpetua, a converted 4,000-ton freighter. We were bunked in holds fitted out with three-tiered bunk beds. Our ship sailed at dusk, and I remember a lot of young faces looking backwards to Sydney Harbour and its famous bridge.\nLife on board ship was relaxing, although our officers made us engage in daily exercise routines. We were sailing unescorted, without the benefit of a convoy. We were cautioned about giving away our position by dropping rubbish overboard or striking a light at night. We were told of the danger of encountering an enemy submarine, and there was regular gun drill by the crew and lifeboat exercise for all. I believe at one stage the crew, in an effort to impress upon us the need for this safety, started a rumour that there was a submarine in the area. My memory is a little hazy on this, but I do remember stories circulating as to what would happen if we encountered an enemy submarine.\nIt was stifling hot in the holds as we sailed through tropics, and many of us took to taking our blanket and lifejacket up on deck to sleep in the open air. It was much cooler, but boy, was that deck hard. On many occasions we encountered a heavy rain shower and then there would be a mad dash to go below. The ship's showers used salt water and we were given a soap that was supposed to lather, but I suspect that was just a promotion by the suppliers. I also believe, apart from the fresh water in the drinking bubblers, we were given a ration of a bucket of fresh water for ablutions. These are vague memories of events some 57 years ago, but they exist in my memory.\nWe finally arrived in San Francisco, where we were given day leave. We were amazed at the size of the city and overawed about being in the United States. We walked for miles, just taking in the sights. We travelled by train to Canada via Portland and Seattle. It was a novel experience after our uncomfortable troop trains in Australia. We had Pullman berths and regular dining, just like the travelling public. I cannot remember if we changed trains at Seattle but I do remember travelling through the Rockies, before arriving at Calgary.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzagwtm

@@ -0,0 +1,5 @@
+{"text":"Secluded yet convenient, this two bedroom unit with north facing balcony is positioned in quiet cul-de-sac and just metres to beach and ocean baths. Original sound condition, all rooms are spacious. Separate lock up garage allows undercover access to full security building . Be quick or the secret will get out!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"A MAN spat full in the face of a former friend following a disagreement over a mobile phone.\nNewbury magistrates expressed shock and disgust at the behaviour of 43-year-old Peter Alan Mobey.\nHelen Waite, prosecuting on Thursday last week, said his victim, Martin Doyle, had bought a mobile telephone from Mr Mobey's wife.\nShe said: \"It was supposed to be a Christmas present for his wife, who is Thai. However, there was a fault with the phone and Mr Doyle tried to return it and get his money back.\nMr Mobey, of Gaywood Drive, Newbury, admitted assaulting Mr Doyle in the Red House pub in Hampton Road, Newbury, on February 7.\nHis has previous convictions from many years ago and a more recent caution for common assault in 2014, magistrates were told.\nPhil Kouvaritakis, defending, said his client's wife works for a phone company and had sold the mobile to Mr Doyle \"as a favour\".\nWhen Mr Doyle discovered it had no Thai language facility he began making calls to Mr Mobey and his wife that were so persistent, they \"verged on harassment\", said Mr Kouvaritakis.\nPresiding magistrate Elizabeth Harrison expressed the bench's disgust at the actions of Mr Mobey, an electrician.\nHe was fined \u00a3170 and ordered to pay \u00a385 costs plus a \u00a320 victim surcharge. In addition Mr Mobey was ordered to pay Mr Doyle \u00a375 compensation for the spitting assault.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"I've been up to several Food Truck Events in Orlando but I've never run into the C&S Brisket Bus, not for lack of trying though. It was inevitable this weekend that we would collide as they were not only attending the Food Truck Rally at Gulfstream Park but also the closing party at #SoBeWFF Trucks on the Beach.\nAt Gulfstream, you had the option to choose from 5 or 6 different sandwiches while the #SoBeWFF event just had the one Brisket Bus Reuben. The Tex-Mex was slow smoked sliced Brisket, Cheddar Cheese and Jalape\u00f1os between 2 slices of Texas Toast. It was such a great sandwich I thought there's no way they could top it, that is until I had their Black N Blue.\nThe Black N Blue with its Blackened Brisket, Roasted Garlic & Blue Cheese Mayo and thick cut Bacon was unbelievable. I pretty much inhaled this sandwich, I'll leave it at that. You MUST seek this mother f'er out!\nThe Trucks on the Beach event saw C&S Brisket Bus put out a nice little 3 bite sandwich. The Brisket Bus Reuben is \"House Cured Pastrami on Old Hearth Rye, Swiss Cheese, Sauerkraut and Horseradish Russian\" topped with a Gherkin pickle halfsie. I'm not a pickle person so after I removed the little fellow it was on. This was another mind-blowing sandwich and I'm not the only one who thought so as Andrew Zimmern (Travel Channel's Bizarre Foods) who hosted the event not only mentioned how much he loved it on stage but tweeted \"Best sandwich I have eaten in a long time. And perfect pastrami\".\nIf you're from South Florida and didn't hit them up then I'm sorry to say you missed out. If you're from Orlando then you are some lucky ducks. But I'm gonna assume you already knew that!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"It's time in three weeks. Sorry I haven't sent letter sooner. Last week I went to the cabin to pick up my deer blind. Then I went to the Bear Creek at Kerry Rd.. I tried to get a address from the farm on the South side and came up with only house number, 13122, Kerry Rd., Brethren. Scott was going to try and get a person to talk to through Todd? Then I went to the farmhouse on the north side and talk to the lady about fishing on her property. She said we will be able to go back on here property that weekend if we want. I didn't ask her what she will charge us. Last time I went back there she charge $.2.00. Then I put my waders on and went back to the wall and tossed panther martins for about a hour. Didn't catch anything. The river is the lowest I've ever seen it. Didn't see any fish. It was sunny and a very nice breezy.\nNow, I plan on going up Wed. morning, as of this writing. It may change due what the rest of you are planning. I will keep you informed if any change. If you will send me a E-mail on when you plan on coming in or not. Looking forward on see all of you.\nI've talk to Jim W. will be up Sat afternoon. Matt B. is planning coming up, not sure when. The rest of you I haven't heard from. Hope all you are having a great summer. Barb and I took Matt's family to a cottage on 8 Point Lake for a week. I now have a fishing partner. Ashlynn caught 35 blue gills, Vaughn. Had a great time with our grand children and family. See you.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"The February 2015 NARI Legal Corner blog post titled, Build a Record You'll Be Proud Of, addressed the importance of recordkeeping for contractors and provided practical guidelines for creating project records.\nTo celebrate the partnership between NARI and FCA US LLC (formerly Chrysler Group), we're asking you to Show Us Your Wheels leading up to and during the 2015 CotY TM Awards Program at NARI's Spring Business Meeting 2015 for a chance to win a Bosch Power Tools prize pack.\nEmployers today are facing the fact that we need to keep our older workforce in place longer \u2014 and we need to help them stay healthy. Many valuable older workers can stay productive on the job with some modifications in his\/her work environment.\nIn a recent article, Entrepreneur Magazine talked about the value of winning industry-specific awards and advised that businesses that are targeted at a niche group of customers should go after awards that highlight their expertise in that area. Winning an industry award\u2014like NARI's CotY\u2014 can help create a buzz about your business by giving customers something to talk about. Industry awards can be a valuable addition to your marketing arsenal, to reinforce the endorsements from satisfied customers.\nThe National Association of the Remodeling Industry (NARI) named 160 Regional CotY (Contractor of the Year)TM winners from the 2015 competition, with 33 team members.\nThe Federal Arbitration Act (\"FAA\") was enacted by Congress in 1925 as a means to ensure that otherwise valid arbitration agreements were enforced by the courts.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzahdji

@@ -0,0 +1,5 @@
+{"text":"Srinagar: The government in Indian-administered Kashmir has set up a commission to probe recent alleged extra-judicial killings by security forces. In February, police said DNA tests confirmed that a supposed Pakistani militant reportedly killed in a gun battle was a local civilian. The body of Abdul Rehman Paddar, a carpenter, was exhumed from a grave in Sumbal near Srinagar. Police are looking into four other reported extra-judicial killings. Human rights groups have for years said that many people the security forces have said were killed after opening fire on them were, in fact, killed in 'fake encounters', in cold blood by the army or police. Protests An order issued by the state's law department on Monday says the commission will look into 'the causes, circumstances and the conspiracy angle' that led to the 'death of some people allegedly in custody or in fake encounters'. It says the commission will fix responsibility for those killings and also make suggestions and recommendations to prevent recurrence of such incidents in future. Retired high court judge, ML Koul, has been appointed to the one-member commission. He has been given three months to submit his findings. The Kashmir valley was rocked by protests in February as police exhumed the bodies of five civilians The killing provoked widespread protests Police said the DNA samples taken from a body matched with those of Mr Paddar's relatives, proving beyond doubt that he was killed in custody after being arrested by other police officers who later said he was a Pakistani militant. Mr Paddar was reportedly detained in the summer capital, Srinagar, in December 2006. Seven policemen have been charged with his murder. His family said he had paid 80,000 rupees (more than $2,000) to a police official to get himself a government job. Instead, it is alleged the police official killed him and claimed a reward for killing a militant. Disappeared Police are also investigating four cases of staged killings, involving police, paramilitary personnel and the army. The army has ordered a separate inquiry into the involvement of soldiers in the killings. Reports say thousands of people have disappeared in Indian- administered Kashmir, many of them after being arrested by the security forces, in the past 18 years. Their families have been demanding the cases be investigated so that the missing people could at least be declared dead.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"To celebrate the release of the Strange the Dreamer paperback, I'm sharing my review of the book!\nStrange the Dreamer is a masterpiece through and through. It's beautifully constructed and the setting and characters are so vivid and intoxicating. It's the story of Sarai and Laslo. She is a magical being who resides in the lost city of Weep, and he is a librarian on an expedition to rediscover Weep.\nThe whole book is a slow-burn, gradually introducing you to this new world. But it has all the familiar Lani Taylor traits you've come to love if you've read her Daughter of Smoke and Bone trilogy. There's magic, mystery, and fairytales. But rather than being super plot driven, it's a character study. The story of a blossoming relationship between these two unlikelies. The scenes when Sarai and Laslo are connected are so atmospheric and heart-warming, I wanted to stay with them forever. Additionally, as much as I loved the primary characters, the secondary ones are also something special. You feel connected to all of them, and I would read a companion novel about every single one!\nBut, there's a twist. An excruciating one that had me reeling for the next book, like, right now. (Luckily, we've not long to wait, as Muse of Nightmares comes out 2nd October.) Strange the Dreamer has to be one of my all-time favourite fantasy novels, and I really can't wait to be immersed in this world once again.\nThis review is going to be short and sweet, just like this book. Lumberjanes, if you don't know already, is a graphic novel series created by a bunch of awesome ladies about a group of awesome girls who spend their summers earning badges for doing outrageously fun things. For example, finding unicorns, or deep sea diving with mermaids. There are already five+ graphic novels in the series, and Unicorn Power is the first middle grade novel to be added to the series that takes the essence of the artwork and puts it in prose form.\nThe great thing about this book was how authentic it was to the already established Lumberjanes brand. The girls all act exactly how they would, and we even learn more about them in different situations because full prose allows for me background info than a graphic novel would.\nAs the cover suggests, April is definitely the central character of the story, so if she's your fave, this one's for you \u2013 but each girl gets a moment to shine.\nThere are also small illustrations that accompany the text and chapter headings, as well as the classic badge descriptions at the beginning of each part. Just like a GN, there are four different badges to focus on.\nMy favourite part of the story, though, was the introduction of Barney, who identifies with 'they\/them' pronouns and only just became a Lumberjane after being part of the male equivalent group. This representation is so important, especially in a middle grade novel, and I hope Barney is more prominent in the next books.\nOverall, this is perfect for Lumberjanes fans looking for a fun and quick read, but also does wonders to introduce an established world to new audiences. Hurrah for hard-core lady types!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Happy New Year from the Open Space Authority!\nThe Open Space Authority is kicking off its 25th Anniversary Year in 2018! The Authority began in 1993 as a grassroots effort by citizen activists wanting to protect Santa Clara Valley's important natural resources. We started as a small agency with an important role to play and have since grown into a diverse organization with greater capacity to make progress on our mission of conserving the natural environment, supporting agriculture, and connecting people to nature. Measure Q has provided further opportunity to fulfill our mission by enabling us to expand public access to nature in and around our urban communities, increase our environmental education programming, and help us maintain our open space preserves for public enjoyment.\nIn this 25th Anniversary Year, we want to celebrate the natural and working lands around us, and just as importantly, celebrate our constituents, who have been so supportive of our work all along the way. We invite you to take every opportunity to get outside and enjoy nature by joining us all year long with fun events throughout Santa Clara Valley. Be sure to check our website for upcoming events.\nOf course, a great deal of planning has gone into these accomplishments. The Open Space Authority prides itself on working closely with a variety of partners on developing foundational research and planning tools that guide our projects, and also inform the work of our communities. These foundational tools include the Santa Clara Valley Greenprint, Healthy Lands & Healthy Economies, Coyote Valley Landscape Linkage Report, Santa Clara Valley Agricultural Plan, and Understanding Our Community.\nCheck our news page regularly for further highlights of the work we and our partners are doing to protect our local natural and agricultural heritage, and to learn more about our past accomplishments.\nThe Open Space Authority is excited to share updates in the quest to protect the Coyote Valley wildlife linkage between the Santa Cruz Mountains and the Diablo Range. The Authority and its partners at the Wilmers Lab at UC Santa Cruz, Peninsula Open Space Trust, and Pathways for Wildlife, started the Bobcat and Gray Fox Connectivity Study last spring and are wrapping up the final field season now with a total of 22 bobcats collared so far! Fitting the bobcats with advanced GPS-collars is generating fine-scale movement data and information that will be vital to informing planners on how these animals are moving in Coyote Valley.\nThe project initially planned to also include gray fox, but since the study began, only one gray fox was spotted in Coyote Valley despite extensive camera monitoring. Additional research would be needed to determine the cause of low fox detections during this study.\nThe bobcat data is helping inform conservation and management actions, including where wildlife crossings over or under roads should be placed in order to reduce wildlife-vehicle collisions. Providing locations for animals to safely cross barriers such roads and highways is part of the conservation strategy outlined in the recently finalized Coyote Valley Landscape Linkage report.\nThe Landscape Linkage report is a critical tool for implementing a shared vision to protect and restore this last chance landscape, which is crucial to protecting ecological connectivity and resilience in the region.\nThe Bobcat and Gray Fox Connectivity Study is anticipated to be completed in 2019 and we will share it with the public and community stakeholders. The Authority will also be featuring Coyote Valley's bobcats in a weekly social media series starting this month! Be sure to follow us on Facebook and Twitter to see photos and videos and get updates on these majestic creatures!\nThe Open Space Authority is a small agency with a big mission and we need to work with like-minded organizations to accomplish our goals. In 2017 the Authority is proud to have increased our work with community partners to conserve land, restore landscapes, connect people to nature, and sustain our natural resources for future generations.\nThe Authority has worked closely with Peninsula Open Space Trust on a variety of Coyote Valley focused projects such as the Coyote Valley Landscape Linkage report, critical acquisitions in Coyote Valley, and the Bobcat and Gray Fox Connectivity Study.\nThe Authority has also been working diligently with the City of San Jose on a Use and Management Agreement to co-manage Sierra Vista Open Space Preserve and Alum Rock Park. This vital partnership includes the City providing onsite office space and storage and in turn Authority staff are assisting with trail maintenance and invasive plant work.\nWildlife Education and Rehabilitation Center has been a wonderful partner to work with in providing live animal experiences to kids, adults, and families throughout the Authority's jurisdiction.\nPartnerships are important to the success of any agency, and the Open Space Authority is honored to be working alongside these amazing organizations. We look forward to seeing our existing partnerships flourish in 2018, and entering into new partnerships as well.\nAs the hills shift from golden to green, you can tell winter has come to the Santa Clara Valley. While you might be spending a bit more time indoors on chilly, rainy weekends, it's a wonderful time to get outside and experience our open spaces.\nIn the winter, waterways seem to change overnight. Local creeks start to swell, and ponds, waterfalls, and seasonal wetlands emerge. These wetlands provide critical habitat for wintering wildlife species, and flood protection for downstream urban communities.\nWinter is a great time for bird watching in our open space preserves. Wetlands and riparian areas in the Santa Clara Valley are key destinations for birds migrating along the Pacific Flyway, so the number of species you are likely to spot explodes. The wet conditions help native amphibian species thrive. The California tiger salamander, California red-legged frog, and Western pond turtle all breed in our local ponds and streams.\nThe Open Space Authority gears up for the season with additional seasonal field staff, working to maintain safe, accessible trails and functional landscapes during winter months. The team works to clear invasive plant species that thrive in the wet weather, assess and repair trails, and monitor drainage systems and spillways to ensure they are intact. Staff also work to evaluate habitat conditions across the preserves.\nRead more about winter in open spaces and download our Winter Hiking Tips on the news page!\nYou can identify me by the patches of white on my face and wings, with a bit of red on my head too. I munch on flying insects but I'm usually found drilling holes to stash my acorns!\nOur new Measure Q Environmental Education Grant Program will be open on January 16, 2018. Grants are available to Public Agencies, Schools and School Districts, and Nonprofits. Learn more on our website or share this flyer with an organization that qualifies!\nThe Measure Q Urban Open Space Grant Program is still open and accepting applications until January 12.\nJoin us for a gentle walk along the first leg of the Arrowhead Trail. We will discuss Coyote Valley's local wildlife and their habitats, and the water sub-basin located in Coyote Valley. Santa Clara Valley is rich in natural resources and we invite you to come and learn how they all fit together.\nIn the winter, all the mysterious creatures and plants who need wet environments come to life. Come explore one of the most mysterious of all: slime molds. Discover a remarkable beautiful organism you may have never noticed before on this slow-paced exploration and engaging educational experience.\nJoin us for a history walk along the Arrowhead Trail, a certified interpretive site for the Juan Bautista de Anza Expedition. As you hike this 4-mile trail, you will learn all about the Anza Expedition and the experiences of those families.\nI am the Acorn Woodpecker! Found in Oak Woodland, across the Pacific Coast. True to my name, I eat acorns which are stashed in the holes I drill into trees. Woodpeckers live in communal groups of about a dozen individuals, who contribute by gathering food and raising young. I can adapt to human development, and may even decide to store my acorns or drill for bugs in wooden buildings.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"*) Calculated for the total population of 460,000,000 in North Africa and the Middle East.\nDominant religion of India, which is really a great collection of beliefs. Hinduism is a polytheistic religion, but many Hindus worship only a few gods, and sometimes only one.\nHinduism is a religion with a complex and rich religious literature, of which the Bhagavadgita is a text appreciated all over the world regardless of the reader's personal belief.\nFor the Hindu, his or her religion is a well integrated part of both everyday life as well as of cultural celebrations. The symbolism of Hinduism is very much present in all aspects of Indian society. The history of Hinduism goes back several thousand years, and it is probably correct to say that it is the oldest of the great religions in the world.\nIn the Middle East, Hinduism is a marginal phenomenon, despite its fairly high number of adherents. There are two reasons for this: First, most Hindus are guest workers from India (often just for few years, and normally without any hope of obtaining citizenship), in wealthy oil producing countries like the United Arab Emirates, Saudi Arabia, Oman and Bahrain. As a result, many have little interest in funding temples or public festivals in the country in which they live. Instead they practice Hinduism inside their own houses, or when they return to India for holidays.\nSecondly, and more importantly, is the fact that Islam is so significant a majority in these countries, and Islam do not consider Hinduism as a religion worthy of special protection, as it does with Christianity, Judaism and the Mandeans. But as long as the Hindus keep their religion hidden from public life, they are normally tolerated.\nHowever, along the coast of Oman and Yemen, there are long traditions for smaller Hindu groups. These are the result of centuries of trade between continents. But even these groups have kept a very low profile, and in preparation of Contents, it was not possible to find information about any Hindu temple or shrine in the region.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"A record number of affordable homes have been approved for construction this year by the City of Edinburgh Council.\nIn total 1,558 homes have been rubber-stamped for building which will lead to \u00a3296m of direct and indirect investment and support 2,180 jobs in the construction and related industries and services in Edinburgh.\nThe figures have been revealed in a new report - Strategic Housing Investment Plan 2012-17 - which sets out the Council's affordable homes strategy for the next five years.\nThis is the first time that the number of approvals for affordable housing has almost matched the 1,660 homes needed every year in Edinburgh. In previous years the number of homes approved for construction has been around the 600 mark.\nHousing Leader Councillor Paul Edie said: \"This really is very exciting news for Edinburgh as we have never seen such a high figure of affordable homes being approved for construction in one year.\n\"And it's not just those families who will be able to live in these homes that will benefit. The knock on effects linked to the construction will see over \u00a3100m pumped into the wider economy and thousands of jobs supported as a direct result.\n\"A great deal of praise must go to the Council's housing team who have made full use of all the funding options available to us to achieve this significant milestone. Scottish Government schemes such as the National Housing Trust and Innovation and Investment Fund have been instrumental in helping us reach this year's figure.\n\"But it's important we do not rest on our laurels and we will continue to find new ways of funding more homes in years to come so the people of Edinburgh are not struggling to find affordable homes to live in.\"\nScottish Governemnt Minister for Housing and Transport Keith Brown said: \"It is encouraging to see the City of Edinburgh reach this milestone in affordable housing and fantastic to see the local authority's commitment to making homes available and within the financial reach of those who need them.\n\"Housing remains a priority for the Scottish Government and we aim to deliver 30,000 affordable homes over the next five years.\n\"To this end, in the face of such massive economic strain, we continue to strive for creative and innovative approaches to provide homes and stimulate the economy.\n\"The City of Edinburgh Council has clearly seen the benefits of continuing to support the construction industry and invigorate the housing market.\"","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzahzwn

@@ -0,0 +1,5 @@
+{"text":"I just upgraded from Iguidance 4 to Iguidance 2009 and cannot find the option to turn off guidance view when making a turn. I prefer it off. Any suggestions ?\nI think the option has been removed from the new iGuidance 2009. If I recall correctly this was possible to control also via the registry in previous versions, and perhaps there is a small chance that the registry settings still work, and only the option buttons have been removed (to conserve space in the dialog window?).\nIn all previous versions of iGuidance I disabled the feature, just like you did. But to tell the truth I personally don't much feel the need to do the same in iGuidance 2009 because of the transparency of the left and right borders.\nFirst I will confess that I'm a total rookie when it comes to iGuidance 2009 so perhaps I'm completely confused about what the original poster is asking.\n- I can click on GUIDANCE. A checkmark appears beside it in the menu and transparent grey areas appear down the full height of both sides of the screen.\n- I can click on MAP. A checkmark appears beside it in the menu. The checkmark beside GUIDANCE disappears and the transparent grey areas also disappear.\nIs this the sort of thing you guys are looking for or am I completely misunderstanding the question?\nYes, Ken. I cannot check the menu items you are describing, because I'm not on the road, but in previous versions there was an option accessible by clicking the main menu button => settings => display options, which let users disable\/enable the \"guidance\", or auto-zoom, feature. I'm not sure if the menu item you mentioned does the same, but it is possible. I will test it tomorrow, when on the road.\nThanks for the suggestion Ken but unfortunately it does not fix the problem for me.\nMarvin, the reason I don't like \"guidance view\" is because I normally view the maps at zoom level 2. When in \"guidance view\" the maps actually zoom out instead of in. Do you remember what the registry edit was to disable it in the older versions ? I read the Iguidance customization thread on Gpspassion but couldn't find it.\nJim, I vaguely recall seeing an option like that in the registry, but I don't have iGuidance 4 on the laptop I use nowadays. I may still have it on one of my PCs at home. I'll try to check it tomorrow.\nCould you guys help me learn a little more about iGuidance by explaining what I'm missing? Why doesn't switching it to MAP view solve the problem? On my installation it turns off the guidance bars on the sides. I confess that I'm \"driving\" it on my desk at the moment so am I missing something that only happens when you are navigating with it?\nKen, when you start driving it automatically switches back to guidance mode when you get to your first turn.\nYeah, I just tested it, but unfortunately the options in the View menu can only switch between the map view mode and guidance mode temporarily. When you continue driving the guidance mode will come on at the next turn.\nIn the registry I see nothing for iGuidance 2009 that could control this, but when I get home I will try to look at the registry settings for iGuidance 4.\nThank you, gentlemen. Don't you just hate \"smart\" software? I would like to declare open hunting season on software designers who think they can make software that knows what I want better than I do!! I don't mind default behaviour that is automatic in some modes, but at least give me a setting to override it.\nIn the options window, where iG4 used to have the buttons for this feature, there are now a couple of new buttons for a different feature, so I think that was the reason the buttons (feature) had to go. Not enough screen realestate.\nMore buttons would not be an issue on a PC, but this software is designed for PNDs first. That's where the main market for the developer is.\nAnother problem with software designers ... they aren't always trained properly in human interface design. Actually, they almost never are.\nButtons are nice but they are not necessary, nor even the best solution in many cases. That button-filled box you are refering to is one of the best examples of bad interface design. It's not the least bit obvious what the whole window is designed for. It takes a lot of reading and a lot of thinking to figure out what is intended. There is no visual grouping of things (at minimum, some grid lines in the window to cause a visual grouping would help, but not solve the problem).\nIn the end, I had to resort to poking buttons to see what resulted before I was able to understand the designer's intent. I HATE it when that's the only way to figure something out because you never know what you are likely to screw up in the process.\nThat screen real estate could have been put to so much better use by a judicious combination of text and radio buttons instead of that single window with a big jumble of buttons in it. A decent design would have allowed them to have more settings in the same space.\nJim, this is great. Thanks for posting it here. I will play with it, too, to see how it works.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Strengthening Teacher Instructional Practices in the N.W.T.\nCan redirecting instructional time improve wellness and outcomes?\nIn this issue, we examine what can be done to support the well-being of all educators and reduce their levels of stress, role overload, and exhaustion. Our educators' emotional well-being matters, period. Let's give it the attention it deserves.\nPublication of an advertisement in Education Canada does not constitute an endorsement by the EdCan Network\/CEA of any advertiser's product or service, including professional learning opportunities.\nTo advertise in Education Canada, contact: Dovetail Communications Inc. (905) 886-6640, ext 306 or [email protected].","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"I'm all cheesy smiles & teary eyes today. The new year feels get me every time but I can honestly say that after looking back over the year, it's been one of the best yet with ASP.\n15 girls. 9 boys. 6 mamas decided to keep the gender a secret until delivery, which is always the most fun.\n5 c-sections. 4 home births. 4 birth center births. 11 hospital births.\nI was at my first birth of the year on New Year's day and spent half of my anniversary with a great family welcoming their first little guy. I spent an early morning driving from downtown Fort Worth to downtown Dallas for a back-to-back birth marathon with a perfectly-timed stop at Whole Foods in between. I learned the value of keeping protein-rich snacks in my go bag because hangry is a real thing, people. I drove hundreds of miles all over the metroplex and spent intimate, precious, sacred time with 24 wonderful families.\nThank you, to everyone who makes this possible \u2013 my clients who let me tell these stories, the encouragement, the sharing, the patience, and all the love. I couldn't do this without of you so thank you thank you thank you.\nHere's to the best 2016 full of babies and great stories!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"We have good news for you: we have decided to extend Passion4Christ registration for one more week. Although we have received a sizable amount of registrations, there is still a little room, and we would like to extend it to you. Maybe you are still down to the wire on whether you can come or not. So, we are extending it till Wednesday of next week, October 13. So, you have one more week left to decided if the Lord would like you to attend this year's Passion4Christ Summit or to invite a friend to come along as well. We would love to see you there. We are pumped for what the Lord has in store for us this year as we dig deep into his word. In communicating with the speakers for this year's Summit, I am excited to hear what the Lord has to say to us through them as they have been studying His word. So, we hope you can make it. We would love to see you there!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Numerous studies show that stress in the workplace is the major source of stress for American adults. So what are the main workplace stressors that you can look out for? And once you identify them, what can you do in order to reduce these stressors?","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzaihjo

@@ -0,0 +1,5 @@
+{"text":"This product is launching with a 'Repurpose This!' campaign on Facebook. People are encouraged to share photos of things they have repurposed and every 90 hours, the most creative project is awarded a prize. At the end of the 90-day campaign, the grand prize winner will receive an iPad2. The team has also launched a commercial highlighting the fact that plastic cups are petroleum-based so they are essentially lined with oil.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Heat shock protein 27 (Hsp27), a member of the small heat shock protein family, is an apoptosis regulator. Our previous proteomic study showed that Hsp27 mainly expressed in human oocyte, and that Hsp27 expression was downregulated in the ovaries derived from women with the polycystic ovary syndrome (PCOS), a well known endocrinal disorder with abnormal apoptotic activity and folliculogenesis. However, the exact effects of Hsp27 downregulation on oocyte development have not yet been clarified.\nThe expression of Hsp27 gene was downregulated in the mouse oocytes cultured in vitro using siRNA adenovirus infection, while the activity of Hsp27 was decreased by microinjection of polyclonal Hsp27 antibody into the cytoplasm of germinal vesicle (GV) oocytes. Oocyte maturation rate was evaluated by morphological observation. Early stage of apoptosis was determined using Annexin-V staining analysis and some critical apoptotic factors and cytokines were also monitored at both mRNA level by real time RT-PCR and protein expression level by immunofluorescence and western blot.\nHsp27 expressed at high level in maturing oocytes. Infection with AdshHsp27, and microinjection of Hsp27 antibody into GV oocytes, resulted in the improved oocyte development and maturation. Germinal vesicle breakdown (GVBD) rates were significantly increased in two AdshHsp27-treated groups (88.7%, 86.0%) and Hsp27 antibody-injected group (77.0%) when compared with control (76.2% in AdGFP, 64.4% in IgG-injected), respectively. In addition, the rates of metaphase II (MII) development in two AdshHsp27-treated groups (73.8%, 76.4%) and Hsp27 antibody-injected group (67.3%) were higher than that in the controls (59.6% in AdGFP, 55.1% in IgG-injected). We also found that the rates of early stage of apoptosis in Hsp27 downregulated groups (46.5% and 45.6%) were higher than that in control group (34.1%) after 8 h of IVM. Similarly, downregulation of Hsp27 caused a significantly enhanced the expression of apoptotic factors (caspase 8, caspase 3) and cytokines (bmp 15 and gdf 9).\nDownregulation of Hsp27 improved the maturation of mouse oocytes, while increased early stage of apoptosis in oocytes by inducing the activation of extrinsic, caspase 8-mediated pathway.\nPolycystic ovarian syndrome (PCOS) is known as one of the most common endocrine disorders affecting approximately 5%-10% of women of reproductive age, and is characterized by chronic anovulation, hyperandrogenism and polycystic change in ovaries [1\u20134]. Accumulation of small antral follicles arrested in their development, with some atretic features, has been shown in ovaries subjected to PCOS [5\u20139]. Those atretic follicles were closely related to inside oocyte competence [10\u201312]. In addition, oocyte developmental competence was susceptible to derangement in PCOS, indicating that abnormal oocyte competence in PCOS was inextricably linked to abnormal follicular development [13\u201317].\nIn the ovary, apoptosis has been implicated in the granulose cells of atretic antral follicles and in regressing corpora lutea [18\u201322]. Derangement of apoptotic activity was observed in PCOS ovary tissue with the altered expression of apoptotic-related regulators, including heat shock proteins (Hsp 90, Hsp 10), nuclear receptor subfamily, dickkopf homologue 3, and so on [23\u201326]. Hsp27, belonging to the small heat shock protein family, is a molecular chaperone protein involved in cellular protection in response to a variety of stresses such as heat shock, toxicants, injury, and oxidative stress [27\u201330]. Emerging evidences show that Hsp27 has strong anti-apoptotic properties by interacting directly with the caspase activation components in apoptotic pathways, consequently exerting protective effects in apoptosis-related injuries [31\u201334]. Interestingly, our previous proteomic study showed that Hsp27, a strong anti-apoptotic regulator, mainly localized in human oocyte, and was downregulated in the ovaries derived from women with PCOS . However, the alteration of apoptotic activity, as well as effect of Hsp27, in PCOS ovaries needs to be further clarified.\nOur hypothesis was that Hsp27 and its related pathways could have some effects on oocyte development, maturation, apoptosis and cell cycle in vivo and in vitro, and even participate in the follicle development and PCOS pathophysiology. In this pilot study, we firstly investigated the effect of Hsp27 downregulation on the meiotic progression and apoptosis in mouse oocyte model cultured in vitro.\nThe ICR mice were fed ad libitum with a standard diet and maintained in a temperature and light-controlled room (20-22\u00b0C, 12\/12 h light\/dark), in accordance with the Animal Research Committee Guidelines of Nanjing Medical University.\nGerminal vesicle (GV) oocytes were collected from 6-week-old female ICR mice. 46-48 h previously, mice were received an intraperitoneal injection of 10 IU of pregnant mare serum gonadotropin (PMSG, Folligon, Intervet, Castle Hill, Australia). Mice were sacrificed, and ovaries were placed in M2 medium (Sigma, St. Louis, MO). Cumulus oocyte complexes were recovered from ovaries by repeatedly puncturing the surface with fine steel needles, and cumulus cells were removed by hyaluronidase treatment (Sigma, 300 U\/ml in PBS) under a dissecting microscope . For preparation of zona pellucida-free oocytes, the oocytes were then exposed to acidic Tyrode's solution (pH 2.5-3.0) with aspiration of the oocyte in and out of a glass micropipette to remove the zona pellucida . Usually the zona pellucida was only partially dissolved and it could be removed by the pipette within 30s. Ding et al reported that zona-free oocytes didn't affect normal fertilization and blastocyst development . After being immediately transferred to M2 and washed three times, 20-25 zona-free oocytes per group were put into 32 \u03bcl droplets of maturation medium of M16 (Sigma) containing 10% fetal bovine serum (FBS; Invitrogen, Grand island, NY) in a 5% humidified atmosphere at 37\u00b0C under a layer of mineral oil. These prepared zona-free oocytes were then used in either control or treatment groups for further investigation.\nThe complementary DNA sequence of Hsp27 was obtained from GenBank (accession no. NM_013560). The potential target sequences for RNA interference (RNAi) were scanned with the siRNA Target Finder and Design Tool available from the Ambion Website . The selected target sequences (shHsp27(1) and shHsp27(2)), 5'-GATCCCCGCTGGGAAGTCTGAACAGTTTCAAGAGAACTGTTCAGACTTCCCAGCTTTTTGGAAA-3'(sense) and 5'-GATCCCCCATGGCTACATCTCTCGGT TTCAAGAGAACCGAGAGATGTAGCCATGTTTTTGGAAA-3'(sense), corresponded to region 541-559 bp and 736-754 bp after the Hsp27 start codon, respectively. The negative control (randomized sequence) was: 5'-GATCCCCCATGG CTAATCCGTTCTGCTTCAAGAGAGCAGAACGGATTAGCCATGTTTTTGGAAA-3'[40, 41]. These sequences were subcloned into pShuttle-H1 according to the method used by Shen et al. The pShuttle-H1-siRNA\/Hsp27 was then recombined with backbone pAdEasy-1 in BJ5183 bacteria. Adenovirus generation, amplification and titer examinations were performed according to the simplified system described by He et al. . Viral titer was determined by plaque assay in 293 cells.\nZona-free oocytes were incubated with adenovirus at the same multiplicity of infection (MOI) in medium at 37\u00b0C for specific durations as indicated in the following experiments.\nHsp27 antibody (stock solution, 200 ug\/ml, goat polyclonal, Santa Cruz Biotechnology, Santa Cruz, CA) was microinjected into the cytoplasm of GV zona-intact denuded oocytes as described by Dai et al. Goat normal IgG-injected (Santa Cruz, CA) oocyte and untreated oocytes were used as controls to assess injection itself damage. To determine maturation rate in vitro, the microinjected GV oocytes were cultured in M16 medium (Sigma) in a 5% CO2 incubator at 37\u00b0C for 14 h. Oocytes without GVs were scored as germinal vesicle breakdown (GVBD) stage, while those with a polar body scored as metaphase II (MII). The microinjection experiments were done 10-12 replicates, using a total of > 300 oocytes. A Nikon Diaphot ECLIPSE TE 300 inverting microscope (Nikon UK Ltd, Kingston upon Thames, Surrey, UK) equipped with Narishige MM0-202N hydraulic three-dimensional micromanipulators (Narishige Inc., Sea Cliff, NY) was used. Microinjection was completed in 40 min, with volume of about 5-7 pl per oocyte.\nStaining was performed with an Annexin-V kit according to the manufacturer's instructions (KenGentec, Nanjing, China). Annexin-V, a phospholipid-binding protein, detects the translocation of phospholipid phosphatidylserine (PS) from the inner to the outer cytoplasmic membrane, which is known to occur during the early stages of apoptosis. At the same time, samples were also stained with propidium iodide (PI) to distinguish live cells from dead cells. Briefly, zona pellucida-free oocytes infected with siRNA adenovirus via co-culturing for 1.5 h and 8 h were washed twice in PBS and stained with 500 \u03bcl of binding buffer, which contained 5 \u03bcl Annexin-V-fluorescein isothiocyanate (FITC) and 5 \u03bcl PI for 5-15 min in the dark. Following this, samples were mounted on siliconized slides and observed under a laser confocal scanning microscope (ZEISS Fluorescent Microsystems, G\u00f6ttingen, Germany).\nTo determine mRNA abundance, real-time RT-PCR analysis was performed using ABI 7300 (Applied Biosystems, Foster City, CA). RNA isolation was accomplished using the RNeasy Micro Kit (Qiagen, Valencia, CA) from the pooled oocytes (20-25 oocytes\/tube). In vitro reverse transcription was carried out using Sensiscript Reverse Transcription Kit (Qiagen) with oligo-dT primer at 37\u00b0C for 60 minutes. For the real time RT-PCR reaction, cDNAs were used as templates for amplification to quantify the steady-state mRNA levels of the tested genes using Quanti Tect SYBR Green PCR Kits (Takara Shuzo Co Ltd, Kyoto, Japan). Relative quantitation of target gene expression was evaluated by the 2(-Delta Delta Ct) method , and the experiment was repeated at least three times using different sets of oocytes. In our study, beta-actin and GAPDH gene were used as the internal standards referred to similar papers [46, 47]. To ensure only target gene sequence-specific, non-genomic products were amplified by real-time RT-PCR, careful design and validation of each primer pair. Primers used for real time RT-PCR are shown in Table 1.\nPrimer sequences used for quantitative real-time PCR reactions.\nOocytes of different treatment groups were fixed in 4% paraformaldehyde in PBS (pH7.4) for at least 30 min at room temperature and then incubated in permeabilization buffer (0.5% Triton X-100 in 20 mM Hepes 3 mM MgCl2, 50 mM NaCl, 300 mM sucrose, and 0.02% NaN3) for 30 min at 37\u00b0C, followed by blocking in 1% BSA for 1 h at room temperature. They were then incubated with Hsp27 antibody (1:100, Santa Cruz, CA), goat polyclonal anti-gdf 9 antibody (1:100, Santa Cruz, CA), rabbit polyclonal anti-cleaved-caspase 3 antibody (1:300; Cell Signaling, Danvers, MA), rabbit polyclonal anti-cleaved-caspase 8 antibody (1:200; Abcam, Cambridge, MA), rabbit monoclonal anti-caspase 9 antibody (1:200; Abcam) and mouse monoclonal cyctochrome c antibody (1:100, Santa Cruz) at 4\u00b0C overnight. After washing, oocytes were incubated with a fluorescein isothiocyanate (FITC)-conjugated secondary antibody (1:100; Beijing ZhongShan Biotechnology Co., Beijing, China) for 1 h at 37\u00b0C, and DNA was counterstained with PI (Sigma). Finally, oocytes were mounted on glass slides with DABCO and examined using ZEISS 510 laser confocal microscopy (ZEISS Fluorescent Microsystems, G\u00f6ttingen, Germany).\nOocytes of different treatment groups (1000 oocytes\/sample) were collected and added immediately into the cell lysis composed of 7 M urea, 2 M thiourea, and 4% CHAPS (W\/V) and 1% DTT (W\/V), 1% Cocktail (V\/V). Proteins were extracted and separated by SDS-PAGE, and transferred onto a polyvinylidene difluoride (PVDF) membrane (GE Healthcare, San Francisco, CA). Following transfer, the membranes were blocked in Tris-buffered saline (TBS) containing 5% skim milk for 1 h at room temperature and then incubated overnight with primary antibodies for cleaved-caspase 3 (1;500; Cell Signalling), cleaved-caspase 8 (1:1000; Abcam), caspase 9 (1:1000, Abcam), Hsp27(1:200; Santa Cruz), and \u03b2-tubulin (1:1000; Abcam) at 4\u00b0C. After washing 3 times in TBST for 10 min each time, the membrane was incubated for 1 h at 37\u00b0C with horseradish peroxidase (HRP)-conjugated secondary antibody (Beijing ZhongShan, Beijing, China). The membrane was then washed 3 times in TBS-Tween (TBST) for 10 min each, and processed using an enhanced chemiluminescence detection system (Alpha Innotech, San Leandro, CA). The molecular weights of the detected proteins were deduced by comparison with recombinant molecular weight standards (New England BioLabs, Ipswich, MA).\nEach experiment was repeated at least three times. All data are presented as the mean \u00b1 SD, and one-way analysis of variance and a log linear model were used to compare the mRNA and protein levels. Chi-square analysis was used to compare the rates of oocyte maturation and early stage of apoptosis. A value of P < 0.05 was considered statistically significant, and if P < 0.01, it was noted.\nAD-293 cells were infected by the adenoviruses packaged with hairpin siRNA targeted against Hsp27\/control. The results showed that the suppression rate of Hsp27 expression was as high as 75% vs. control (Data not shown, P < 0.05) after infecting with Ad-shHsp27 and control for 48 h.\nTo examine the reduction degree of Hsp27 mRNA in mouse oocytes after infected with Ad-shHsp27 adenovirus, real time RT-PCR was performed. As Figure 1B displayed, Ad-shHsp27 significantly reduced endogenous Hsp27 mRNA abundance in mouse oocytes (50%). The suppression degree of Hsp27 at protein level was detected by immunofluorescence (Figure 1A), which was in accordance with the real time PCR. These results suggested that the knockdown of Hsp27 expression by Ad-shHsp27 infecting was effective. Therefore, these two siRNA were chosen for the subsequent experiments.\nAd-shHsp27 effects specific suppression of Hsp27 expression in mouse oocyte. (A) Immunofluorescence detection of Hsp27 expression after Ad-shHsp27 infection for 48 h. Oocytes were fixed in 4% paraformaldehyde and then stained with anti-Hsp27 antibody (green). Chromosome material was counterstained with propidium iodide (red). a) control-infected oocyte. b) shHsp27(1)-infected oocyte. c shHsp27(2)-infected oocyte. (B) The results of real time RT-PCR showing Ad-shHsp27 infection for 24 h in mouse oocytes. The expression level was calculated from the Ct values by the 2(-Delta Delta Ct) method, and the mRNA ratio (arbitrary units) of Hsp27 was calculated with respect to that of control. Bar graphs indicate mean \u00b1 SD of four replicates. *P < 0.05 vs. control.\nThe localization of Hsp27 protein in maturing mouse oocytes was showed in Figure 2A. Hsp27 expression was recognized mainly in the cytoplasm and nuclei (except the nucleolus) of mouse oocytes. To assess the levels of Hsp27 mRNA in the maturing oocyte, real time RT-PCR analysis was performed using cDNAs equivalent in oocytes at different developmental stages (Figure. 2B). Hsp27 expression dramatically increased following oocyte maturation, Western blot analysis confirmed that Hsp27 at protein level also increased following oocyte maturation, and dramatically increased in MII (Figure. 2C), which was consistent with the results of real time RT-PCR and immunofluorescence.\nLocalization and expression of Hsp27 in mouse oocytes from GV to MII cultured in vitro. (A) Immunofluorescence staining of Hsp27 and chromosomes in maturing oocytes. Oocytes culturing for 0 h (GV), 3 h (GVBD), 8 h (MI) and 14 h (MII) in vitro were stained with specific Hsp27 antibody (green) and propidium iodide (red). (B) Real time RT-PCR analysis of Hsp27 mRNA in maturing oocytes. Oocytes were cultured in vitro for 0, 3, 8 and 14 h. A progressive increase was observed with the maturation of oocytes. (C) Western blot analysis of Hsp27 expression in maturing mouse oocytes. Experiments were repeated at least three times. Bars = 20 \u03bcm. *P < 0.05, **P < 0.01 vs. control.\nPolyclonal antibody of Hsp27 was microinjected into oocytes cytoplasm at GV stage to downregulate the activity of Hsp27. After 3 h of microinjection, the GVBD rate (77.0%) significantly increased, when compared with normal control (67.3%) or IgG-injected control (64.4%) (P < 0.01, vs IgG-injected group). After 14 h of microinjection, the maturation rate of MII stage (67.3%) was also higher than those of two controls (below 60%) (P < 0.01, vs IgG-injected group; Table 2). These findings suggested that the lowed Hsp27 activity in mouse oocytes could improve the maturation of oocytes.\nMaturation of mouse oocytes after microinjecting of Hsp27 antibody at 3 h and 14 h of in vitro culture.\n** Values are statistical significance at P < 0.01(vs. IgG).\nOocyte maturation of mouse zona-free GV oocytes was significantly improved by infecting with Ad-shHsp27, when compared with negative control at GVBD stage and MII stage (Table 3). The maturation rates of GVBD stage in shHsp27 (1), shHsp27 (2) groups were 86.0% and 88.7%, which were higher than control (76.2%) (P < 0.01). Accordingly, compared with control (60.8%), the ratios of MII stage in shHsp27 (1) and shHsp27 (2) groups (76.4% and 73.8%) were also increased dramatically(P < 0.01). Same outcome was found in the antibody microinjection (Table 2).\nStages of oocyte nuclear maturation from the different treatment groups after 3 h and 14 h of IVM.\n** Values are statistical significance at P < 0.01(vs. control).\nOocytes were classified into three groups as Anguita et al described . The first group contained necrotic oocytes with PI-positive red nuclei, indicative of membrane damage. Oocytes with a discontinuous green signal originating from the remnant portions of the membrane were viable non-apoptotic oocytes (Figure. 3A). The second group contained viable oocytes which were negative for Annexin-V staining (Figure. 3B). The third group consisted of early apoptotic oocytes with homogeneous Annexin-V-positive signal in the membrane (Figure. 3C).\nOocyte classification by Annexin-V staining. (A) necrotic oocytes. Discontinuous green signal was originated from the remnant portions of the membrane. (B) Oocyte Annexin-V negative: no signal in the cytoplasmic membrane. (C) Annexin-V positive (early stage of apoptosis): a clear green signal is observed in the oocyte membrane. Bars = 10 \u03bcm.\nThe ratios of Annexin-V-positive cells in two shHsp27 groups were higher than negative control (Table 4). After 3 h of treatment, the early apoptotic rate of oocytes infected with Ad-shHsp27 (38.9%, 36.2%) was not significantly different from control (33.8%). The ratios of early apoptotic oocytes in shHsp27-treated groups after 8 h of treatment were 46.5% and 45.6%, which were significantly higher than the negative control (34.1%). The results suggested that Hsp27 downregulation in oocytes could promote the early stage of apoptosis.\nThe rate of early stage of apoptosis in oocytes at 3 and 8 hours after siRNA adneovirus infection, was evaluated by Annexin-V staining in different groups (Control, shHsp27(1), shHsp27(2)).\n3 h and 8 h indicated the time of culture in vitro after adenovirus infection.\n*Significant changes within group (* P < 0.05 vs. control).\nTo elucidate the involved apoptotic pathway(s), the expressions of four apoptotic factors (caspases 8, caspase 9, caspase 3 and cytochrome c) were measured in oocytes following different treatment by real time RT-PCR, immunofluorescence and western blot. As shown in Figure 4 and Figure 5, the results of these assays were accordant. Hsp27 downregulation in mouse oocytes dramatically increased the activitied caspase 8 and caspase 3, while caspase 9 and cytochrome c activities did not change. These results suggested that downregulation of Hsp27 in mouse oocytes resulted in activation exclusively of the extrinsic, caspase 8-mediated apoptotic pathway, rather than the intrinsic, caspase 9-mediated pathway.\nEffect of Hsp27 downregulation in GV oocytes on the expression of some key apoptotic proteins and oocyte-derived growth factors. (A) Real time RT-PCR analysis in mouse oocytes after microinjecting Hsp27 antibody. Oocytes were cultured for 18-24 h. (B) Real time RT-PCR analysis in oocytes after infection with Ad-shHsp27. (C-F) Western blot analysis of key apoptotic factors in oocytes after infection with Ad-shHsp27. Measurements were plotted as the mean of at least three biological replicates \u00b1 SD. Changes are labeled as significant (*) if P < 0.05.\nImmunofluorescence staining of cleaved-caspase 3 in oocytes after microinjecting of Hsp27 antibody (The other factors not shown). Oocytes were fixed in 4% paraformaldehyde after microinjecting of Hsp27 antibody for 36-48 h. Then these oocytes were stained with cleaved-caspase 3 antibody (green). Chromosome material was counterstained with propidium iodide (red). A) IgG-injected oocyte. B) Hsp27 antibody-injected oocyte.\nIn addition, the expressions of two important oocyte-derived growth factors (bmp 15 and gdf 9) after downregulation of Hsp27 in mouse oocytes were also investigated (Figure. 4A and 4B). The results indicated that bmp 15 and gdf 9 were increased significantly in oocyte after downregulation of Hsp27.\nIn the present study, the effect of Hsp27 downregulation on oocyte development and maturation was investigated in the mouse oocyte model cultured in vitro. Expression of Hsp27 gene was downregulated in oocytes using siRNA adenovirus infection, while the activity of Hsp27 was decreased by microinjection of polyclonal Hsp27 antibody into mouse GV oocytes. Interestingly, our results showed that Hsp27 downregulation in mouse oocytes improved oocyte maturation and increased oocyte early stage of apoptosis.\nHsp27 was investigated as an antiapoptotic factor [49\u201351]. Hsp27 could directly bind and co-precipitate with cytochrome c, consequently leading to activation of the caspase 9 and caspase 3 in mouse, rat and human cells [31, 33, 52, 53]. Kamradt et al reported that Hsp27 could negatively regulate cytochrome c- and caspase 8-dependent activation of caspase 3 in human breast carcinoma cells . To our knowledge, there were few reports about the roles of Hsp27 in oocyte. In this pilot study, after downregulation of Hsp27 in mouse oocytes, the ratio of early stage of apoptosis was significantly increased. Meanwhile, the expression of major apoptotic factors i.e. caspase 3, caspase 8 was dramatically increased. These results suggested that downregulation of Hsp27 in mouse oocytes might increase early stage of apoptosis by inducing the activation of the extrinsic, caspase 8-mediated apoptotic pathway.\nOur results showed that the lowed levels of Hsp27 significantly increased GVBD rate and MII rates in both siRNA infection group and antibody microinjection group when compared with controls, indicating that Hsp27 downregulation was positively related to oocyte maturation. This result was also supported by detecting the expression of two important oocyte-derived growth factors-bmp 15 and gdf 9, which were known to be responsible for controlling fundamental physiological processes in oocyte development and follicular growth . Juengel et al reported that immunization against gdf 9 and bmp 15 alone or together in cattle oocytes could block folliculogenesis and reduce follicular size, which indicated the critical role of bmp 15 and gdf 9 on oocyte development and follicular growth . In this study, we found that bmp15 and gdf 9 were noticeably upregulated after Hsp27 downregulation in the mouse oocytes model cultured in vitro, suggesting that there was an enhanced effect of downregulated Hsp27 on oocyte development.\nRecently, there were numerous studies focused on the relation between early stage of apoptosis and oocyte developmental competency in the pooled oocytes cultured in vitro[12, 48, 57, 58]. As we known, early stage of apoptosis was regarded as a sequential, but reversible, process of cell death [10, 57]. As Anguita et al and Jaroudi et al indicated, the oocytes undergoing early stage of apoptosis did not mean that they must develop into late apoptosis, early stage of apoptosis oppositely decreased their developmental competence [48, 59]. Bilodeau-Goeseels and Panich proved that oocytes with early signs of atresia had good developmental potential by detecting the transcriptional activity in early bovine embryos from different classes of cumulus-oocyte complexes . Additionally, some clinical studies provided consistent results that oocytes from slightly atretic COCs with signs of cumulus expansion had a better embryonic developmental capacity after IVF than those considered to be of the highest quality [61\u201365]. Concordantly, the percentage of apoptotic cumulus cells increased when COCs were exposed to FSH. Oocytes from those COCs exhibited a higher developmental potential in terms of blastocyst formation rate [66\u201368]. Those reports suggested that early stage of apoptosis had a positive relation with the improved oocyte developmental potential. In our present study, downregulation of Hsp27 led to a lower antiapoptotic effect and a significant increase in the GVBD rate and MII rate, which was consistent with previous reports . Taking these results together, we speculated that downregulation of Hsp27 induced early oocyte apoptosis, consequently improving oocyte development. In fact, it is difficult at present to understand the molecular mechanism of the correlation between early stage of apoptosis and subsequent maturation of oocyte in follicles in PCOS. Our hypothesis is that downregulation of Hsp27 could be one of the bridges between those events, which is our objectives in future studies.\nPrevious proteomic analysis comparing normal and PCOS ovarian protein profiles identified that expression of Hsp27 in PCOS ovaries was decreased when compared with normal ovarian tissues . PCOS is known as the most common cause of anovulatory infertility, resulting from a disorder of follicular maturation of uncertain aetiology . Several reports showed that apoptosis was perturbed in PCOS ovaries, with overexpression of apoptotic factors and downregulation of anti-apoptosis factors. However, the others showed the reversed results [69\u201371]. Das et al reported that there were significant differences in cell death rate and proliferation rate of granulosa cell populations in PCOS patients [72, 73]. Oocyte development is interdependent with its surrounding granulose cells, and disfunction of granulose cells may contribute to the abnormal folliculogenesis observed in PCOS [5, 74, 75]. Interestingly, we found in this study that the downregulated Hsp27 improved oocyte maturation, which seems to be contradicted with the atresia follicles observed in PCOS. One possible explanation for this contradiction could be that our research was performed in mouse oocyte model cultured in vitro. This model simulates the normal oocyte's development, which could be different from the pathological procedure of PCOS characterized by an abundance of large but immature follicles. We need more studies on the effects of Hsp27 in PCOS pathophysiology in future studies.\nIn conclusion, evidence provided in the present study indicated that downregulation of Hsp27 improved oocyte maturation, and increased early apoptosis of mouse oocytes by triggering the extrinsic, capsase 8-mediated pathway. This is the first report, to our knowledge, to establish a direct link between Hsp27 and oocyte maturation. Relative deficiency of Hsp27 expression in GV oocytes may contribute to the disordered oocyte development in PCOS. Further studies will be required to elucidate the role of Hsp27 in oocyte maturation in vivo and PCOS pathophysiology.\nJin-Juan Liu, Xiang Ma contributed equally to this work.\nThis study was supported by grants from the China National Natural Science Foundation (Nos.30800394), 973 program (2006CB944005) and Jiangsu Health program [XK02200901(NG09)].\nJJL carried out the main experiments and wrote the first draft of the manuscript. LBC performed the antibody microinjection. XM, YGC and JYL designed the study and proofread the final manuscript. All authors read and approved the final manuscript.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Ellis Point is a private beach community in Dagsboro, Delaware, that offers energy-efficient homes with infinite bay views and natural tidal wetlands. The community is flanked by Cripple Creek Golf and Country Club and Holts Landing State Park. It boasts a clubhouse, swimming pool and it's own private beach on the Indian River Bay. Home buyers can choose from a selection of floor plans with prices from the $500's to the $700's.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"The TEN-TEC Model 599AT Eagle signifies strength born from DSP technology in HF design. Listening to input from Ham radio operators from around the world led our team of engineers to a remarkable compact yet high performance transceiver that Hams of all ages and skill levels will find a joy to operate.\ncanceling circuitry, and of course TEN-TEC's famous selective roofing filters.\nThe TEN-TEC Eagle will truly provide years of outstanding performance unequaled by any other radio in its size or price class. You can be assured the Eagle offers more receiver horsepower with new DSP based architecture, Selectable Roofing filters, noise reduction, antenna tuner, and of course TEN-TEC's legendary QSK keying. A tribute to American ingenuity makes the Eagle a radio you can be proud to show your fellow Ham radio operators.\nWhether you are a seasoned contester, DX chaser, net operator or a casual operator, the TEN-TEC Eagle has the performance and convenience that will provide years of operating enjoyment!\nUnlike any other radio in this price class the Eagle offers a combination of DSP and selectable roofing filter options to tailor our listening pleasure. Unlike most transceivers in this price class, TEN-TEC's unique crystal ladder filters help eliminate undesirable signals from entering the receivers first IF stage making a more enjoyable listening experience even in crowded band conditions.\nA TEN-TEC first: A user selectable color display which can be tailored to your favorite color and intensity. Different operating environments have varied lighting conditions so why not tailor your radio to meet those needs?\natmospheric band noise is just a push of the button!\nTired of noise blankers that seldom work in a mobile environment?\nTEN-TEC's unique model 320 optional noise blanker will cancel noise you thought never would be possible.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Their technology, as described (it's not available yet,) differs from existing offerings like NimJam, Net Music Makers and Collaboration Central, which aren't real-time, and the original eJamming software which was MIDI-only. Most likely, it's closer to Audio Fabric's Desktop, and eJamming's just-announced, and inexplicably named, AUDiiO. Both of these support the real-time exchange of full audio.\n\"Real-time,\" however, comes with a caveat in this context, one that Lightspeed doesn't hint at: You might meet your band mates virtually, but their physical location still matters.\nStories and images of musicians jamming on the Internet remind me of three things: Bell Sympatico; my experience 8 years ago with Guitar FX Box; and The 500-Mile Email.\nI think first of Sympatico for reasons obvious only to Canadians. Bell ran an ad campaign here called \"Online Jam,\" and the spots (shown every commercial break for 6 months back in 2002) presented an assortment of musicians, located all over the world, rhapsodizing in a virtual jam session. They sure seemed happy to have their DSL modems, these visually appealing, geographically diverse virtuosos. And every musician I know wanted to jam with that guy in Kenya, even if we couldn't speak his language.\nBut Bell gave up the ads when we figured out, thanks to Myspace, that music on the Internet is visually appalling \u2026 and mostly out of tune.\nGuitar FX Box comes to mind next because of the revelation it brought. Billed at the time as a \"digital stompbox,\" the program convinced me to finally plug my electric guitar directly into my computer. Until then, recording with my PC involved Cakewalk, a Sound Canvas, and Cooledit (back when it was free) with a cheap old mic.\nI had never hooked up an electric guitar, because raw lined-in guitar sounds horrible. Guitar FX Box promised to change that with all manner of effects to fatten up the dry signal. And it delivered, after a fashion. The effects themselves sounded good. But my interface was a lowly Soundblaster Live card for which, in 1999, no ASIO or WDM drivers existed. So the latency I experienced was significant, on the order of 40 milliseconds. It shocked me how disconcerting I found this; and I was enlightened, to the importance of hearing notes as I played them.\n40ms is well above the threshold of human perception, and generally considered unacceptable for any musical use. Especially for percussive instruments, like drums and fast-picked guitar, latencies larger than about 10ms tend to distract the performer. A good analogy for this effect, if you haven't experienced it first hand, is the awkward pauses exhibited by newscasters and their remote interviewees talking via satellite. Granted the delay in those cases is closer to 500ms, but the effect is the same: Humans (and musicians) simply aren't comfortable with a world that doesn't respond in a timely manner.\nThe 500-mile Email is a great story which I'm about to spoil for you if you haven't read it.\nIn brief: A network technician discovers that his server can only send email to machines within a 500 mile radius. There's no technical problem with the remote machines, and the Internet is working fine. He's puzzled, because \"distance\" is a meaningless concept on the Internet. And yet his server just fails to send messages any further than 500 miles. He finally tracks the issue to a bug which causes all outbound connections to break after 3 milliseconds. So any message that takes longer than 3ms gets cut off, and aborts. The punchline: emails travel at the speed of light, and 3ms happens to be the time it takes light to go 500 miles.\nOver the distances we deal with in our everyday lives, the speed of light is effectively infinite. But that changes on the Internet. In fact, signals on fiber optic networks travel a good deal slower than the speed of light. The fiber itself slows light to 2\/3rds of its usual speed, and the various routers and switches that a signal encounters along the way slow it even further.\none of the biggest long-term problems the internet faces is that of Latency (communication delay) due to the limits of light speed. Light is just too slow for instant communication.\nAlthough any type of musical interaction is sensitive to delay and latency, a certain amount is acceptable. As long as the audio stream you are receiving from your collaborators reaches you within 40ms from the time the sound signal was created, you should be able to synchronize reasonably well. This is particularly true when the music is played at slower to moderate tempos. Musical sychronization[sic] among players at faster tempos, such as Bebop Jazz or Speed Metal jams, is optimally achieved when the one-way delay is at or below 30ms.\nIn my experience (though admittedly not with their service,) 30ms is the absolute upper threshold for tolerable latency. Even playing a swelling pad on a keyboard, 30ms is enough that the keyboard's response feels \"off.\" Consider, too, that jamming is inherently bi-directional. Musicians keep themselves in time with visual and audible cues, and you know how important this is if you've played with a hearing-impaired drummer.\nSo one-way delays of 30ms become two-way delays of 60ms. And this completely ignores any latency in the signal chains at either end of the connection.\nOf course, that's why Audio Fabric ultimately states \"you can collaborate in real-time in hi-fidelity with only those who are within several hundred network miles of you.\" And barring any changes to the laws of physics, Lightspeed Audio will offer the same caveat.\nI don't mean to minimize the potential of Lightspeed's technology. Assuming they don't render their name ironic by offering trans-continental jams, and assuming their \"low-latency value-added network and audio CODEC technology\" are as exciting as the marketing department believes, they'll still offer a reasonable real-time experience for local musicians.\nBut make no mistake: the dudes you jam with will speak the same language as you.\nJust a heads-up: Ninjam is not MIDI-only. Quite the opposite; it's audio-only. The thing that sets it apart is the bizarre take on latency \u2013 instead of dealing with latencies of a few milliseconds (or a few seconds), the stream is delayed by the much more musical time of 4 (or any other number) bars.\nIt's weird at best, but not as weird as jamming with latencies of a 30ms, I can tell you. It's not a substitute for going to one another's houses and jamming (less fun too), but you don't have to deal with heavy gear (and computers for the likes of me) and mistakes move across the group differently.\nSo it's not a substitute to real-life jamming; more a complement to it.\nOh, it turns out Ninjam has now been integrated into Reaper (shareware $40 DAW, similar feel to Sonar) so one can play MIDI, synthesize it and stream that.\nD'oh, you're right poorsod. Thanks. I corrected the mistake above.\nI think I'd confused Nimjam with the original version of eJamming.\nTry ConnectionOpen.com Realtime Lossless Jam sessions\u2026 and for now we are free!!!!\nCome try us out \u2026 and Jam live with anyone around the world!!!","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzajcxe

@@ -0,0 +1,5 @@
+{"text":"The talk will provide an overview of the challenges posed by the physical limitations of the underlying silicon based CMOS technology, introduce the next generation of emerging machine architectures, and the anticipated effect on the way we program machines in the future.\nFor the past twenty-five years, a single model of parallel programming (largely bulk-synchronous MPI), has for the most part been sufficient to permit translation of this into reasonable parallel programs for more complex applications. In 2004, however, a confluence of events changed forever the architectural landscape that underpinned our current assumptions about what to optimize for when we design new algorithms and applications. We have been taught to prioritize and conserve things that were valuable 20 years ago, but the new technology trends have inverted the value of our former optimization targets. The time has come to examine the end result of our extrapolated design trends and use them as a guide to re-prioritize what resources to conserve in order to derive performance for future applications. This talk will describe the challenges of programming future computing systems. It will then provide some highlights from the search for durable programming abstractions more closely track track emerging computer technology trends so that when we convert our codes over, they will last through the next decade.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"After Kim Leakena got married and left Rasmey Hang Meas Productions to live with her husband in USA, Rasmey Hang Meas Productions was left with only two female singers: Pich Sophea and Chhit Sovan Panha.\nRasmey Hang Meas Productions' fans especially from overseas had expressed disappointments because Kim Leakena was no longer with Rasmey Hang Meas Productions. So Rasmey Hang Meas Productions needed to spice up their new albums to make their fans happy again.\nThough there is nothing official from Rasmey Hang Meas Productions, Sokun Nisa seems to be Kim Leakena's replacement at this point. Sokun Nisa is now on the rise.\nShe appears every often on Rasmey Hang Meas Productions' new DVDs. For example, on DVD 82 most of the songs are either her solo or duet with Chorn Savanarach. Not only that, there is a rumor that Sokun Nisa will be the main female movie star with Preap Sovath for the up-coming Rasmey Hang Meas Productions' big scale movie Sdech Korn (King Korn).\nIf this is true, Sokun Nisa's popularity will be even greatly rising like a rocket. She seems to be the best choice among Pich Sophea and Chhit Sovan Panha though she seems to be more fit playing a Chinese girl character.\nHer singing style is unique and a few of her songs are very popular right now locally and overseas. Though she has not been acting for any big scale movie so far, her acting skills seem to be fine at this point. With more coaching and training, she will be just fine to be the co-star with Preap Sovath as Sdech Korn.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Living room candidate commercials 1980living room candidate website : living room candidate. Bathroom page 7 interior design shew waplag picturesque rustic small living room ideas with. Teaching beyond the textbook. Living room candidate : clip interior design ~ clipgoo. Living room candidate : clip interior design ~ clipgoo. The living room candidate. The living room candidate 1960 wwwresnoozecom.\n1000 ideas about couches for small spaces on pinterest. Dark grey furniture furniture designs. Light filled contemporary living rooms. 20 captivating mid century living room design ideas rilane. Living room decorating ideas: floating shelves. Gallery of interior design small living room layout wow. Small living room decorating ideas 2013 2014 ~ room. Arm chairs living room bestsciaticatreatmentscom. Gray and brown living room bestsciaticatreatmentscom. Living room theaters portland home design ideas. Modern living rooms.\nPhoto page hgtv. Light brown couch living room ideas what colour curtains. Living room paint colors for 2018. Transitional living room the house of silver lining. Large wall art for living rooms: ideas inspiration. L shaped couch small living roomjpg (800600) interior. Couches for small living rooms image of review small.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"13 November 2008 - From 14-16 november the 20st edition of the elite figure skating competition for the Troph\ufffde Eric Bompard will take place in Paris, France. It is one of the six international qualifying events in the ISU Grand Prix of Figure Skating series. The competition, held since 1987 and formerly known as Troph\ufffde Lalique, is named after the Eric Bompard company, which has been sponsor since 2004. A top-field of 12 Men, 12 Ladies, 8 Pairs and 12 Pairs of Ice Dancing, from 15 countries, will attend the event.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Crock Pot Cream Of Chicken Soup can beat the chill of fall day away. I love crock pot soup recipes and eat them all year long.\nBut there is something about chilly weather that has me craving thick and creamy soups more than a broth-based soup recipe.\nI just wished I had some chilly weather. It's still hot here in Florida, but I know those of you up north are enjoying cooler weather right now.\nSo this Crock Pot Cream of Chicken Soup recipe is for you.\nUnless of course you have been subjected to non-stop rain as I have been.\nRainy days are another good time to curl up on the couch and enjoy a bowl of this Crock Pot Cream of Chicken Soup.\nAlong with it still being stifling hot here in Florida, we have been having rain every day for at least a month.\nUsually, the summer months are our rainy season. A normal Florida rainy season day will consist of an hour or so of rain and then the sun will come out.\nIt seems like since the second week of August the sky opened up and it has been cloudy and overcast every day. I am so over it.\nEven though I am sharing this Crock Pot Cream of Soup recipe today.\nI will be enjoying a bowl of Crock Pot Tuscan Chicken and White Bean Soup today. I'll be sharing that crock pot soup recipe soon.\nRoughly chop the cooked bacon.\nPlace half the chopped bacon and remaining ingredients into a 4-quart crock pot.\nTop each serving of soup with a tablespoon of the remaining crumbled bacon.\nThick and cream Crock Pot Cream of Chicken Soup is a comfort food best enjoyed on a cold or rainy day.\nWhat is your favorite meal to eat on a cold or rainy Fall day?\nIf you are enjoying my Crock Pot recipes be sure to Pin them to Pinterest or share them with your friends and family!\nFor a look at more of my Crock Pot Soup recipes head here.\nCanned soup sure does hold some childhood memories doesn't it. My mom used to make us Campbells Tomatoe soup and grilled cheese sandwiches. I hope you enjoy the recipe!\nYou are very welcome. I hope you enjoy the Homemade Holiday ebook and the recipe!\nCan you sustitute the cream soup with the same amount of heavy cream?\nNo heavy cream is very different than cream soup. You could make homemade cream soup if you'd rather not use canned.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzajqvq

@@ -0,0 +1,5 @@
+{"text":"A potential presidential candidate in the US has registered a domain name containing journalist and television presenter Chuck Todd's name and linked it to her own campaign page.\nCarly Fiorina, a potential candidate for the Republican Party, announced on Twitter yesterday (May 10) that she had registered the domain name chucktodd.org to link to her presidential campaign, carlyforpresident.com.\nIt was the second time she had registered a domain name with a famous person's name in the title.\nFiorina registered the domain just hours after appearing on topical news show \"Meet The Press\", a show Todd presents on the NBC television network.\nOn the show, Todd challenged Fiorina about her time spent as the chief executive of technology company Hewlett-Packard (HP), claiming that she sacked 30,000 workers from the company.\nThe registration of Todd's name follows Fiorina's registration of a domain name including comedian Seth Meyers's name.\nShe registered sethmeyers.org on May 5 after he referenced another domain name, carlyfiorina.org, that had been set up by a Canada-based individual.\nThe website outlines criticism of her time at HP. Fiorina joined HP in 1980 and in 1999 became chief executive. She left the company in 2005.\nIt goes on to show a colon and a bracket to mimic an unhappy face. There are 30,000 in total which symbolises each individual who allegedly left the company during her tenure as CEO.\nAnother website, hilaryclinton.net, also takes users to Fiorina's official page. According to Whois records, it was registered on November 28, 2014, but it is not clear if the registrant has any connection with Fiorina.\nThe spate of registrations has been referred to as #domaingate by many Twitter users.\nJoshua Jarvis, associate at law firm Foley Hoag in Boston, told TBO: \"I fully expect this type of domain name gamesmanship to continue to be a regular part of the political process, for all the usual purposes.\n\"This could be from using them to host websites featuring genuine criticism and attack advertisements, to registering domains for the sole purpose of depriving one's opponent of their use,\" he added.\nLast week (May 4), Fiorina posted a YouTube video confirming that she was running as a potential presidential candidate for the Republican Party in the 2016 general election.\nFiorina could not be reached for comment.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Book a Video consultation with Sharwan Singh Rathore Advocate Peelwa and get best legal advice of your legal problems.\nBook a Message consultation with Sharwan Singh Rathore Advocate Peelwa and get legal opinion without any delay.\nHave a Meeting Sharwan Singh Rathore Advocate Peelwa across your locality and clear your legal doubts easily.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"The MACplus Call Box features a four-button notification panel that can be tailored to user requirements \u2013 for example, medical\/police, mechanical\/towing, gas\/tire and hearing impaired. It's ideal for roadways, bridges, tunnels and commuter rail stations.\nThe software-driven system sends automatic audible and digital signals to a dispatch center and is ADA compliant. Call Boxes alert the dispatch center every 24 hours with a status report.\nThe powder-coated, stainless steel enclosure measures 15\"H x 11 3\/8\"W x 7\"D and features a self closing pneumatic\/mechanical door with ADA-compliant hinges. It includes an activation inger, help-enroute LED light, set of small reflective decals and a 2 inch pole\/wall mounting bracket. This unit requires the separate purchase of the software package listed below for programming the four call buttons.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Get an alert with the newest ads for \"vintage tonka\" in Toronto (GTA).\nA 1970's Tonka Semi-Truck and Horse Trailer. It is made of pressed steel and is 9 1\/2\" (L) x 3\"(H) x 2\" ( w). There are 2 opening doors back and side, #811974 A. In good condition.\nEXACTLY AS PHOTOGRAPHED, SLIGHT BODY DAMAGE, ORIGINAL CHAIN MISSING , COOL OLD TOY AND THE FIRST TYPE OF TOW TRUCK MADE BY TONKA. YOU DO NOT SEE THESE VERY OFTEN. IF AD IS UP IT'S AVAILABLE.\nVINTAGE TONKA METAL DUMP TRUCK XMB-975. In good condition with a few dings and some rust spots. Please see pictures for condition.\nVintage Tonka Orange Mini Construction Truck. Has some obvious wear but hard to find Model.\nThis is in great condition, just a few minor scuff marks that may be able to be cleaned up. Nice bright colurs. Stickers intact. Everything works. Join MAN CAVE GTA on FACEBOOK for more great items.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"This series explores the nuances of setting up Restorative poses as sanctuary for mind, body and spirit. We will concentrate on working with the Chinese Meridian and 5 Element Theory of the Organic and Emotional Body.\nSeasons and energies are reflected in our bodies and emotions, as microcosm reflect the macrocosm, and for Chinese, seasons are associated with the elements, our emotions, specific internal organs, and certain tastes.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzalmpf

@@ -0,0 +1,5 @@
+{"text":"At a minimum, every SQL Server database has two operating system files: a data file and a log file. Data files contain data and objects such as tables, indexes, stored procedures, and views. Log files contain the information that is required to recover all transactions in the database. Data files can be grouped together in filegroups for allocation and administration purposes.\nSQL Server databases have three types of files, as shown in the following table.\nPrimary The primary data file contains the startup information for the database and points to the other files in the database. User data and objects can be stored in this file or in secondary data files. Every database has one primary data file. The recommended file name extension for primary data files is .mdf.\nSecondary Secondary data files are optional, are user-defined, and store user data. Secondary files can be used to spread data across multiple disks by putting each file on a different disk drive. Additionally, if a database exceeds the maximum size for a single Windows file, you can use secondary data files so the database can continue to grow.\nThe recommended file name extension for secondary data files is .ndf.\nTransaction Log The transaction log files hold the log information that is used to recover the database. There must be at least one log file for each database. The recommended file name extension for transaction logs is .ldf.\nFor example, a simple database named Sales can be created that includes one primary file that contains all data and objects and a log file that contains the transaction log information. Alternatively, a more complex database named Orders can be created that includes one primary file and five secondary files. The data and objects within the database spread across all six files, and the four log files contain the transaction log information.\nBy default, the data and transaction logs are put on the same drive and path. This is done to handle single-disk systems. However, this may not be optimal for production environments. We recommend that you put data and log files on separate disks.\nEvery database has a primary filegroup. This filegroup contains the primary data file and any secondary files that are not put into other filegroups. User-defined filegroups can be created to group data files together for administrative, data allocation, and placement purposes.\nFor example, three files, Data1.ndf, Data2.ndf, and Data3.ndf, can be created on three disk drives, respectively, and assigned to the filegroup fgroup1. A table can then be created specifically on the filegroup fgroup1. Queries for data from the table will be spread across the three disks; this will improve performance. The same performance improvement can be accomplished by using a single file created on a RAID (redundant array of independent disks) stripe set. However, files and filegroups let you easily add new files to new disks.\nAll data files are stored in the filegroups listed in the following table.\nPrimary The filegroup that contains the primary file. All system tables are allocated to the primary filegroup.\nUser-defined Any filegroup that is specifically created by the user when the user first creates or later modifies the database.\nWhen objects are created in the database without specifying which filegroup they belong to, they are assigned to the default filegroup. At any time, exactly one filegroup is designated as the default filegroup. The files in the default filegroup must be large enough to hold any new objects not allocated to other filegroups.\nThe PRIMARY filegroup is the default filegroup unless it is changed by using the ALTER DATABASE statement. Allocation for the system objects and tables remains within the PRIMARY filegroup, not the new default filegroup.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Want to increase your effectiveness as a science teacher for the middle grades? Join us and learn about the nature and history of science as well as how to help students in this age group grasp the scientific method. You'll receive lots of worksheets and specific examples of some great experiments you can use in your own classroom. You will discover the principles of direct instruction and many different learning and organizational tools that will benefit your students. You'll even learn how you can use science class to improve the emotional climate in your classroom!\nAll through the course, you will discover worksheets and checklists you and your students can put to immediate use. You'll see how helpful they are in the lessons on the scientific method, writing a research paper, and producing a science fair. You will cover foundational content in both physical science and life science. You will learn how to use a study of the earth's atmosphere to teach students how to make and interpret a variety of graphs\u2014an important skill for standardized testing. You will learn about some of the best Web sites available. By the end of this course, you will have many new skills that will benefit both you and your students.\nI really enjoyed the content of the course and the way it was presented. I gained a lot of scientific knowledge that I perhaps had forgotten. I also gained valuable techniques in conducting not only a science class, but will be able to integrate them into my other contents. Thank you.\nI really enjoyed this class! The instructor's teaching style was very clear, direct, and methodical. She covered all of the topics thoroughly and wrote in a very friendly and interesting style. As I finished each lesson, I was already looking forward to the next! Also, the supplementary materials and resources at the end of each lesson are so valuable and will be very useful to me. I am sure I will refer to all the materials in this course over and over again.\nI got a lot more from than course than I expected. I am not a science teacher by training, and taking this class gave me a lot of foundational information that I did not have. Also, as a special education teacher, I really appreciated this instructor's heart for students with disabilities. She presented very useful information for the general education teacher and provided different approaches so special education students could also be given the opportunity to learn. The resources for science fairs are gold to me.\nThe instructor, Holly Trimble, is very good at getting to the core of instruction. In the past, I had felt like I was teaching bits and pieces of scientific information. It was not until I read the chapter on the drive for equilibrium that I saw it all tied together. But, I had never been able to put that into words to let my students understand that concept. I teach high school science and math, and I found this course invaluable. I will use what I learned in these lessons every day in class!\nThis was the best education course I have ever taken. The lessons were great and the resources given at the end of each lesson were terrific. I wish I had taken this course many years ago - my students would have benefited from it!\nThis was a very helpful course and the instructor was wonderful! She broke down the information into manageable chunks and included real classroom stories. She also included a ton of supplementary information to help us research anything we might need to use in our classrooms. I made a notebook of all the lessons, and I know it will be a very useful guide for me this year!\nI have taken many science courses in my teaching career, but no course has really taught me science and how to use it in my classroom like this one! It has been previously hard for me to teach science because I never understood it myself. Science concepts were never explained in a way that I could understand them until now. I will never again dread teaching science. Thank you so much!\nThis was a great course to not only refresh one's science knowledge, but also to gain a ton of great science teaching ideas, both in terms of content and execution. The instructor provides lots of great checklists and worksheets for both the students and teacher. I highly recommend this course. If you still rely on just worksheets and the \"occasional\" activity or experiment this course will change how you approach teaching science and make science the most exciting part of the day for your students.\nThe instructor did an outstanding job of presenting a comprehensive, insightful science class for teachers of fourth to sixth graders. She truly led by example. The class has been such a boost for me, and I'm sure for the others who've taken it. I am more knowledgeable and have more tools to start using with my students tomorrow! Her willingness to share such complete resource lists and expertise tell of her love for students and teachers alike. Thank you!\nI was so pleased with this class. So much was covered that helped me to become a better teacher: science concepts, lesson planning, organizing units, classroom management. and more. I appreciated the knowledgeable, common-sense approach of the teacher and am excited to share this love of science with my students in a more coherent way this fall. Thank you!!\nIn your first lesson, you will examine the challenges and joys of teaching science to middle school students. You will learn why science can be difficult to teach and some specific ways to overcome those difficulties. You will discover some ways to help your students use textbooks effectively and some great tricks to help improve memory. Then you will examine some different types of scientific research. You will focus on using the scientific method to design great experiments and you will become an expert at identifying control and experimental groups, and control independent and dependent variables.\nIn this lesson, you will learn about the lives of four scientists who challenged a conventional theory about our solar system. You will see how our present understanding of the solar system changed over time. You will discover the differences between, models, theories, and laws and discover a lesson plan that will help your students understand the nature of science. Then you will learn about direct instruction and how it lays a strong foundation for higher-level thinking skills. You will learn about a valuable concept called the Zone of Proximal Development, which will free you to meet the needs of individual students. You will examine scaffolding and go through a lesson plan step-by-step that us can use as a model.\nExamine steps successful students follow when they learn new information. You will learn to help students go through these steps and how you can meet four distinct objectives when teaching new material. You will learn to use outlines, charts, and concept maps and a checklist to help keep students organized. Then you will discover a guide to help your students in writing research papers including: pages to help organize notes, questions they should answer, a way to record references, and templates for bibliographies.\nIn this lesson, you will learn specific ways you can become a teacher who understands the importance of emotional climate in the classroom to foster learning and encourage students' efforts. Then you will review some basic principles of chemistry. You will examine states of matter. By the end of this lesson you will understand thermal, mechanical, and chemical equilibrium and how to teach those concepts to your students.\nReview common characteristics that all living creatures share. You will discover the way all living creatures are organized and the different roles of organ systems. You will examine modern cell theory and discover ideas for activities to teach these concepts to your students. Then you will learn about homeostasis, which is the maintenance of a stable internal environment no matter what is happening in the environment. You will also examine equilibrium in eco-systems and discover a unit study----the development of an environmental notebook.\nThis final lesson will show you how to use a topic in earth science to help students master the skill of reading and interpreting several types of graphs, which are found on standardized tests. You will cover pie charts, single and multiple bar charts, single and multiple line charts, and scatter plots. Then you will discover some worksheets and checklists to guide you and your students through a science fair. The process will be made more manageable through a guide for oral presentations and a sample sheet for judging science fair entries.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"There is 1 \"Sea Front two Bedroom Apartment\" available in our hotel.\nIt is a 60sqm apartment, which consists of two separate bedrooms, and another separate room where there is a small fully furnished kitchen and a small living room, which can also accommodate another person. In this apartment there is a spacious and functional bathroom with glass shower cabin and three balconies with wonderful sea views.\nRobes, slippers, hair dryers and cosmetic items offered to guests of this room type.\nThere is also a flat TV in each bedroom.\nThis apartment is suitable for a family with up to three children, or two couples.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"#36894678 - Menus are designed exquisitely beautiful, stylish and easy to..\n#49328574 - Chalkboard Menu Template of Food and Drinks. Monochrome Vector..\n#50937296 - Wooden barrel signboards for cafe, restaurant, bistro, brasserie,..\n#69115967 - Series of backgrounds decorated with flowers, old town views..\n#65655146 - Series of the street cafes with people, men and women, in the..\n#40014686 - Street cafe, chocolate, cupcake, cake, cup of coffee, donut,..\n#51061894 - Restaurant or cafe menu design template with vintage retro art..\n#82898684 - Cafe shop exterior.\n#77035992 - bakery logo with text space for your slogan tagline, vector..\n#82898690 - Cafe shop exterior.\n#74430860 - Girls in street cafe.\n#96673795 - Tea vector engraving label. Hand drawn engraved vector sketch..\n#80975102 - Fashion people in the street cafe. Street cafe with flowers in..\n#81635042 - Bistro best food, hot and tasty estd 1969 logo template hand..","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Miguel Suro :Miguel A. Suro is the Florida lawyer and blogger behind The Rich Miser, where he and his wife Lily share practical tips, life hacks, and reviews to help you live well for less.\nAwesome post. You have shared so many options to choose from in this post that I believe one visit to the city won't be enough. You have shared some amazing suggestions. I am just wondering where to start from. I love parks and beaches, basically I love outdoor spots so I guess I will start my journey from there.\nYou're welcome! Have (free) fun in Miami!","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzamxaz

@@ -0,0 +1,5 @@
+{"text":"If you travel a lot for business, you may feel like you never have enough time to travel for personal reasons. While business travel can at times be draining, you can use your work trips to your advantage. By turning your work trip into a getaway, you can maximize the time that you spend away and have more fun, too. Here are some great ways to turn your work trip into a getaway.\nIf you have meetings or events planned for work, it can be an advantage to wake up early and get some personal activities done on your own time. This will allow you to squeeze more fun in, even on the busiest of days. Ideas include scheduling a morning jog or going to museums or attractions that open earlier in the day. If this isn't an option, alternatively fill your evenings with local fun instead of lounging around your hotel room.\nIf you're in charge of picking the hotel that you stay out for work trips, being strategic during the planning process is a must. You can look for a hotel that is nearby the most attractions so that you can easily get around and explore. You can also consider staying at a hotel that offers excellent amenities like staying at a hotel with a top-rated spa \u2014 which will make it easier for you to enjoy the perks of the hotel in your free time.\nIf you're traveling for business, it can be worthwhile to extend your trip. This is an excellent option if your work is flexible on the days that you fly in and out for your event or conference. Doing this allows you to take advantage of already being at a new destination. While it may cost you vacation or personal days, you already made an effort to get to where you need to be \u2014 so why not explore and see and do more?!\nTake some time to research your work destination and make a list of top activities you want to do and restaurants that you'd like to eat at. If you need to schedule work meetings or activities for your group, you can schedule at these places. If you can't choose those places, at least schedule events near the attractions you want to see most. This makes it easier for you to do activities that are personally exciting to you while still taking care of your work needs.\nYou can have fun on all of your business trips if you're willing to step outside of your comfort zone \u2014 plan to do at least one local activity while on your trip. Examples include trying a local meal or catching a local concert or performance. This will make every work trip more memorable.\nJust because you're traveling for work doesn't mean it has to be boring. Schedule some fun and be smart with your planning so that you can create your own getaway.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Beautiful spaces define this very special home in the heart of Linden Hills.\nJust steps to the Minneapolis Chain of Lakes and Linden Hills village, this 1985 built jewel features an open floor plan, soaring vaulted ceilings, tons of natural light and wonderful balconies and decks to enjoy! Gorgeous living room with 18' ceilings lined with skylights, a gas fireplace, built-in shelving and seating, hardwood floors and opens to the deck and screened porch. The kitchen and dining room flow beautifully together and open to the front balcony. The main floor also has a full bath and 2 bedrooms, one that opens directly to the screened porch to enjoy the outdoors in this treetop setting. Upstairs is the master suite featuring the bedroom with vaulted ceilings, balcony and a full bath with separate tub and shower. Upper level also has an office niche at the top of the stairs that overlooks the living room. The lower level family room walks out to the private back yard and landscaped grounds. The laundry and attached 2 car garage are also on this level. An amazing home in the heart of Linden Hills that is a great condo alternative, easy to button up for travel and easy access to every amenity of the Cities. Just steps to Bde Maka Ska and an easy walk to Lake Harriet and to the charming shops and restaurants in the Linden Hills Village.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"If you fancy taking part in the I Love My Post 1 Year Celebration this is the last week to sign up! At the moment the prize post is a lovely $150 and together we can make it better! Co-Host slots, host pages and more all still avaliable to find out more just click HERE.\nIf you are yet to participate in a hop they are really simple to get the hang of all you need to do is 'hop' around, hopefully finding some new great reads!\nThanks for co-hosting Vicky! I am a new Follower of your blog. Have a wonderful weekend.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Will Yakowicz is a writer based in New York.\nA few years ago, Israel Shamir's anti-Israel vitriol would have been marginal and largely ignored. But in the age of WikiLeaks, a Holocaust-doubter can become a legitimate source of news. Part 2 of 2.\nIsrael Shamir is a slippery Holocaust-doubter whose anti-Semitic, anti-Israel views are\u2014in the age of WikiLeaks\u2014finding a new audience. Part 1 of 2.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Marina front condo located just outside downtown Manteo in the Shallowbag Bay Marina community. The unit is 1 Bedroom and 1.5 Bath (accommodating 4), and is non-smoking and pet free with a Saturday turn-day. This is an elevator building with community pool and hot tub available Memorial Day through Labor Day. The community has an on-site fitness center and game room. Master suite comes with a King bed and jetted tub in private bath with separate shower. Queen Sleeper Sofa in living area with covered deck, 2 TVs, DVD and CD player, board games, books, puzzles, and ceiling fans. View of Roanoke Sound, Manteo Waterfront and Jockey's Ridge from porch. Public parking around building.","meta":{"redpajama_set_name":"RedPajamaC4"}}

data_all_eng_slimpj/shuffled/split2/finalzzzanvha

@@ -0,0 +1,5 @@
+{"text":"1 Who is Jennifer Hielsberg?\n7 What is Natasha Jennifer Hielsberg's Net Worth?\nBorn on an unspecified date in 1985, in Tampa, Florida USA, Jennifer Hielsberg is a 33-year-old Caucasian model, but best known to the world for being the wife of Bret Bielema, the former head football coach of the University of Arkansas, while he also coached various other teams, and thus has a significant amount of popularity in the US. Jennifer had a number of personal successes herself over the course of her modeling career during the last decade.\nJennifer was apparently an only child, raised in her birthplace by parents of unknown identities and professions. As for her education, she attended an unspecified high school, from where she is thought to have matriculated in 2003, then enrolled into the University of Wisconsin, pursuing a psychology major, and graduating in 2006.\nAlthough the specifics about her jobs are largely unavailable, it is known that Jennifer had been pursuing a modeling career from an early age. She also has some work experience in finance, meaning she was active in two professions at the same time.\nAs for Jennifer's romantic involvement, it is known that she dated Bret Bielema for three years before he proposed to her during a cruise in March 2011. However, it was almost a month until the public found out, as Bret announced their engagement on the 1st of April in the same year. They married a year later, on the 10th of March 2012, and now have a daughter named Brielle. On the 8th of July 2017, Bret tweeted a picture of his newborn child, stating: 'Beyond anything @jenbielema & I could ever dream of as parents. Please welcome Briella Nichole Bielema born 4:44 AM on 7\/8\/17 weight 7.8 lbs.' They live together with their child \u2013 there hasn't been any controversy surrounding their union.\nBorn Bret Arnold Bielema under the sign of Capricorn on the 13th of January 1970, in Prophetstown, Illinois USA, Bret Bielema is a 48-year-old Caucasian college football coach. He is perhaps best known to the world for serving as head football coach at the University of Wisconsin-Madison from 2006 to 2012, during which time he achieved a 68-24 record. He has also had a number of other coaching jobs over the course of his sometimes lucrative college football coaching career. He was apparently an only child, raised in his birthplace by parents of unknown names and professions. As for his education, he attended an unspecified high school, from where he matriculated in 1988, then enrolled in the University of Iowa, from where he graduated with an unknown degree in 1991. His overall head coaching record is 97-58, while his teams made the Big Ten list three times in between 2010 and 2012, and the Big Ten Leaders Division once in 2011. He was also given the Big Ten Coach of the Year Award in 2006, thanks to his 12-1 overall record that year. As for coaches that served under him, Chris Ash is his former apprentice, and at the moment the coach of the Rutgers Scarlet Knights football team of Rutgers University.\nWhat is Natasha Jennifer Hielsberg's Net Worth?\nHave you ever wondered how rich Jennifer Hielsberg is, as of mid-2018? According to various authoritative sources, it has been estimated that the total of Jennifer's accumulated wealth is close to $500,000, while her husband's net worth is said to be over $8 million, with a current annual salary of $3.2 million. He has made his fortune primarily as a college football coach, mostly as the coach of the Arkansas Razorbacks football team. As his career continues to develop, the said amount can be expected to increase.\nConcerning the physical attributes of the former model, her body shape is generally described as hourglass, while her hair color is light blond and her eyes are light brown.\nDue to the major influence of social networks, it is nowadays a regular thing for active celebrities to nourish a close and active relationship with their fans, for the sake of increasing the popularity of the projects they're working on, and thus their own net worth. Cari herself seems to be a regular subscriber, if not the leading example of this celebrity trend, as her presence is quite ubiquitous on most of the popular social media networks. She doesn't have a Facebook page, but her Twitter account has over 65,000 followers, and her Instagram account more than 6,000 fans.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"These days, it seems the relationship between a brand and it's blog is an imperative one. Not only is it a tool to promote your product, but a blog enables the aesthetic to develop naturally, by being exposed to cultural and commercial influences. Young designers such as Maddie Moxham and Charlie May, have built a 'world' for their work to live in. Understanding the designers influences, experiences and journey of their work, humanises the product and allows the customer to aspire to the lifestyle 'required' to wear or own it.\nBy editorialising the brand, it gives the product context and encourages a consumer to visit their 'shop' on a regular basis, whether or not they wish to purchase anything. With increasingly sophisticated technology, starting your own business is becoming easier and easier, but it also means, brands have to become more innovative in creating incentives to purchase from you. By giving the consumer an alternative reason to visit them, they are placing their product at the forefront of their mind, hopefully, one day, turning that traffic into sales.\nSo business owners out there, get blogging!","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Russia's Victor Minibaev secured men's 10 metres platform honours on the final day of the International Swimming Federation Diving Grand Prix in Rostock.\nYing Wei led a Chinese one-two in the women's 3 metres springboard final at the International Swimming Federation Diving Grand Prix in Rostock.\nWorld champions Evgenii Kuznetsov and Ilya Zakharov claimed European Championships gold in the men's synchronised three metres springboard event at the Royal Commonwealth Pool in Edinburgh today.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"Naomi Sirad is a woman whose troubled life compels her to leave Tel Aviv for Jerusalem with the hope to have a fresh start. Moving into a new apartment, seemingly in a quiet neighborhood, she learns that a woman that lived in the same apartment committed suicide but her piano is still there, which will play a significant role in restoring Naomi's confidence in herself.\nNaomi, what you will learn in the beginning, had an unsuccessful suicide attempt and luckily survived. While the reason is not given as to what exactly led to such a desperate moment of her life, Naomi seems to be struggling even more now when she tries to stay away from the piano left by a woman whose attempt to take her own life succeeded. But soon, when the troubled young pianist meets, at first, Simcha, a mute preteen boy from an orthodox family, and later on, Maya, an activist who seeks answers, Naomi's life will take an unexpected turn.\nNaomi's challenges continue as the new neighborhood does not welcome her the way she expected. Her family continues worrying about her, and she herself is too alarmed by the appearance of Simcha. As the story unfolds, the slow-paced drama makes Naomi to face not only her past, but the past of a previous tenant, whose death, she learns soon, was suspicious. As she agrees to help Maya to bring to light whatever happened to the deceased woman, Naomi meets Fabrizio, a priest who agrees to teach her to play the instrument.\nA Quiet Heart's synopsis or even the review itself may not sound so fascinating, but it's very engaging and an interesting piece to watch. Games of Thrones' Ania Bukstein as Naomi is solid and able to carry the entire film on her shoulders. As she delivers an impressive performance, through that it enables you to see Naomi in a different light, understand why she loses her confidence and desire to leave music, but more importantly, you will realize her own reasons to hang on to life itself a bit longer, maybe for a few decades extra.\nThere is an interesting concept in A Quiet Heart and that is something I would like to bring up. It's a story about a woman who is a concert pianist and wanted to kill herself ; she may repeat her attempt, you never know. But now, as she lives in the same apartment where a woman killed herself, Naomi will have to learn to grow above the pain she has, and find new reasons to keep going. In the end, A Quiet Heart is a movie worthwhile seeing. If you like foreign drama filled with religious values and the importance to overcome an inner pain, then this film should end up in your top ten list.","meta":{"redpajama_set_name":"RedPajamaC4"}}
+{"text":"No matter what season it is, the Grim Reaper, a 24\/7 workaholic, never takes a holiday. No carefree swims or languid cocktail hours for Thanatos in the summertime; no party blowouts for him at New Year's.\nWhat initially peaked the Steiny Road Poet's interest in talking to someone who knew Toklas well was to understand how Toklas' growing interest in Catholicism played into what was done with Stein's remains after she died.","meta":{"redpajama_set_name":"RedPajamaC4"}}