Upload 1006 files to data/part_3

data/part_3/00818e7aff802314bc06a2f478f31fbd.json

@@ -0,0 +1 @@
+{"metadata":{"id":"00818e7aff802314bc06a2f478f31fbd","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/856d224f-2b06-4a43-881e-1c2c32f248bf/retrieve"},"pageCount":14,"title":"Physical, chemical and sensory properties of cassava (Manihot esculenta) -sweet potato (Ipomoea batatas) gari","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":187,"text":"Cassava is a tropical root crop, requiring at least eight months of warm weather to produce [21]. In sub-Saharan Africa, cassava is processed using methods which improve its food safety limitations. It is mainly a subsistence food crop grown for food by small-scale farmers; the surplus is sold. Roots can be harvested between 6 months and 3 years after planting [15]. Cassava has multiple uses: it is consumed in many processed forms, used in the industry and also as livestock feed [5]. Its roots are made into granular flours. Flours are of three types, yellow gari, white gari, or intermediate colour, with yellow gari considered the best product in Nigeria. Gari is a granulated product, made from the lactic acid fermentation of cassava roots, and cherished by urban consumer because of its convenience, long shelf life and its ready-to-eat form [17,25,6]. Unit operations involved include peeling, washing, grating, dewatering, fermentation, and roasting [29]. The resulting dry granular gari can be stored for a long period. It may be pound or ground to make fine flour. It comes in various particle size, categorized as: rough, medium, and fine."},{"index":2,"size":162,"text":"Sweet potato (Ipomoea batatas) is a hardy and nutritious staple food crop, which is grown throughout the humid tropical and subtropical regions of the world, from sea level to 2,700m altitude [32]. It has short growing period of 90-120 days [31]. The crop requires just sufficient water and attention for their cultivation. The tuberous root features oblong/elongated shape with tapering ends and has smooth outer skin whose color ranges from red, purple, brown, and white, depending on the variety [34]. Sweet potato does not have the cyanogenic limitation associated with cassava, yet less recognised than the latter. This can be attributed to its relatively lower level of utilization. Nutritionally, sweet potato is one of very high caloric foods (provides 90 calories/100g vs. 70 calories/100g of potato), a rich source of dietary fibre, antioxidants, vitamins, and minerals. It is a good source of vitamin A [28]. However, sweet potato is yet to be recognized as a vital ingredient in food production and safety."},{"index":3,"size":117,"text":"The use of sweet potato and cassava to produce gari has been discovered to be technically feasible [18,24]. However, there still lies a drawback in the area of sensory properties of the obtained product. This problem can be attributed to the enzymatic browning of the polyphenolic compounds in the tubers of sweet potato. This is yet the main limitation in the acceptability of sweet potato gari by the potential consumers [24]. There have been efforts to solve this problem but with little or no success. Therefore, the aim of this work was to study the effect of different production methods on the physical, chemical and sensory properties of gari produced from cassava roots and sweet potato tubers."}]},{"head":"Materials and methods","index":2,"paragraphs":[{"index":1,"size":35,"text":"The bitter cassava TS53201 (Manihot esculenta crantz) and yellow fleshed sweet potato tubers roots were obtained from the Teaching and Research Farm, Faculty of Agriculture, University of Ilorin. They were processed few hours after harvesting."}]},{"head":"Preparation of Lime-Sodium Metabisulphite Solution","index":3,"paragraphs":[{"index":1,"size":67,"text":"Fresh lime (Citrus aurantifolia) fruits were cut into halves to extract the juice. The juice was then clarified using a sieve and 160 ml of this was made to 5 litres with water. A solution containing 35 g of sodium metabisulphite (food grade) in 5 litres was prepared. The lime and sodium metabisulphite solutions were mixed together and then further diluted with water up to 20 litres."}]},{"head":"Production of Cassava-Sweet Potato Gari","index":4,"paragraphs":[{"index":1,"size":118,"text":"The method described by [24] was used with few modifications. The modifications included pretreatment of sweet potato to prevent enzymatic browning, and cassava-sweet potato mixing at different stages in the course of production, as this forms the basis of the difference in the production methods to be studied. The research method adopted is presented on Table 1. The cassava roots and sweet potato tubers were washed with clean water to remove soil and adhering dirts, and then peeled separately with sharp knives into separate bowls. Peeled cassava roots were further washed in clean water to remove any adhering dirts, while the peeled sweet potato tubers were immersed in lime-sodium metabisulphite solution for 20 minutes to prevent enzymatic browning."}]},{"head":"For Production method 1:","index":5,"paragraphs":[{"index":1,"size":95,"text":"After washing, some of the peeled cassava roots and sweet potato tubers were taken and mixed according to these proportions: 90% cassava and 10% sweet potato, 80% cassava and 20% sweet potato. Then the two resulting mixtures were grated separately. The remaining sweet potato and cassava were also grated separately. The grated cassava-sweet potato mash of each ratio was then bagged in a porous jute bag as well as the mashes of pure cassava and sweet potato in separate jute bags. The bags were tied and the mashes were left for fermentation for three days."},{"index":2,"size":38,"text":"After three days, the mashes were put under hydraulic press and dewatered for two days. The resulting grits were then broken and sieved using a local sieve with an aperture (square holes) of about 2 mm 2 ."},{"index":3,"size":67,"text":"For production method 2: Some of the grits from the 100% sweet potato and 100% cassava grits were again taken and mixed according to the same proportions (i.e., 90% cassava and 10% sweet potato, and 80% cassava and 20% sweet potato). At this point, there were six samples, all of which were then roasted separately. The resulting gari samples were then allowed to cool at ambient temperature."},{"index":4,"size":64,"text":"For production method 3: Again, two more mixes were prepared by mixing some of the 100% cassava gari and 100% sweet potato gari, according to the same proportions (90% -10% and 80% -20%). The remaining 100% cassava gari and 100% sweet potato gari were left unmixed, now making a total of 8 mixes. Figure 1 represents the flow chart of the three production methods.  "}]},{"head":"Percentage yield of Cassava and Sweet Potato Gari","index":6,"paragraphs":[{"index":1,"size":72,"text":"The method described by [23] was used to determine the percentage yield of the products. Cassava and sweet potato roots were weighed prior to peeling. Immediately after roasting and cooling, the gari samples from both 100% cassava and 100% sweet potato were weighed, and the percentage yields were calculated using this formula 1 below: % Yield of gari from cassava and sweet potato = weightof obtained 100% weightof rootsbefore peeling gari "}]},{"head":"Determination of chemical properties of Cassava-Sweet Potato Gari","index":7,"paragraphs":[{"index":1,"size":44,"text":"Prosimate composition Moisture content. This was determined by drying 2 g of each of the gari samples in an oven at 105 o C for about 2 hours. The difference between the weights before and after drying was calculated as the moisture content [1]."},{"index":2,"size":51,"text":"Crude fibre content. The crude fibre content of the various gari samples was determined by defatting (with petroleum ether) and boiling (with H 2 SO 4 and NaOH) 2 g of the gari samples followed by incineration in a murfle furnace. The incinerated sample was thereafter cooled in a desiccator [1]."},{"index":3,"size":30,"text":"Ash content. Gari sample (2 g) was incinerated in a murfle furnace to burn off all organic components present. The residue left after the ashing was the ash content [1]."},{"index":4,"size":28,"text":"Crude protein. The protein content of the gari samples was determined by digestion of 2 g of the sample followed by distillation and titration as described by [1]."},{"index":5,"size":40,"text":"Carbohydrate content. This was calculated by subtracting the sum of the percentage contents of moisture, crude fibre, ash, crude protein and crude fat from 100%. i.e., carbohydrate content = 100% -%(moisture + crude fibre + ash + crude protein +fat)"},{"index":6,"size":53,"text":"(2) Crude fat content. This involved the extraction of 2 g of each of the gari samples in a soxhlet apparatus with a petroleum ether, after which the samples were dried in an oven and cooled in a desiccator. The weight lost during extraction was the fat content of the gari samples [1]."},{"index":7,"size":81,"text":"pH Determination. The pH of the gari sample was determined using the method of [2]. Each of the gari samples (10 g) was put into a 100 ml beaker and 100 ml of distilled water was added to it. This was allowed to stay for a few minutes after which it was filtered with a whatmann filter paper. The filtrate was then taken and tested using a standardized pH meter. Triplicate values were obtained, the mean of which was then calculated."},{"index":8,"size":97,"text":"Determination of total titratable acidity. The percentage total titratable acidity of the gari samples was determined using the method described by [12]. Five grams of each of the samples was dissolved in a beaker and made up to 100 ml with distilled water, then allowed to stand for about 30 mins. The resulting suspension was filtered with a filter paper, and 25 ml of the filtrate was taken and titrated against 0.1 M NaOH, using phenolphthalein as indicator. The end point was obtained when the colour became pink. The mean (TTA) was then calculated from triplicate values."},{"index":9,"size":153,"text":"TTA (%) = 0.005X x 100 = 0.01X, where X is the mean titre value. Determination of hydrogen cyanide content. The residual hydrogen cyanide (HCN) content of gari was determined using the method of [10]. Using this metod, thirty grams (30 g) of gari was milled and homogenized with 250 ml of 0.1 M orthophosphoric acid. The homogenate was centrifuged. The supernatant was taken as the extract; 0.1 ml of the enzyme (linamarase prepared from the freshly harvested cassava roots) was added into 0.6 ml of the extract. The 3.4 ml of the acetate buffer (pH 4.5) was added and stirred to mix. After which 0.2 ml of 0.5% chloramin-T and 0.6 ml of colour reagent were added and allowed to stand for 15 min. for colour development. The absorbance value was obtained at 605 nm against a blank similarly prepared containing all reagents and 0.1 ml phosphate buffer added instead of KCN."},{"index":10,"size":26,"text":"Calculation. The data from the standard were used to obtain a standard curve and its slope (b) by plotting absorbance values (Y-axis) against standard concentrations (X-axis)."},{"index":11,"size":60,"text":"The unknown mean absorbance (A) and the weight of the sample (w) were used to calculate the residual hydrogen cyanide, using the formula: Residual cyanide = A x 250 x 0.4151 b x W and the unit in mg HCN equivalent kg -1 sample (formula 3). Where A is absorbance, b is the slope, and W is weight of sample."}]},{"head":"Determination of Physical and Technological Properties","index":8,"paragraphs":[{"index":1,"size":80,"text":"Swelling index. The method of [33] was used for the determination of swelling index (SI) with slight modification. Ten grams (10 g) of the garisample was transferred into a clean, dried, calibrated measuring cylinder. The gari was gently leveled by tapping the cylinder and the initial volume recorded. Fifty milliliter (50 ml) of distilled water was poured into the cylinder and allowed to stand for 4 h. The value for SI was taken as the multiples of the original volume."},{"index":2,"size":84,"text":"Water Absorption Capacity. The method of [30] as described by [3] was followed for the determination of water absorption capacity. One gram (1 g) of gari was weighed into an already weighed clean dried centrifuge tube. Twenty milliliter (20 ml) of distilled water was poured into the centrifuge tube and stirred thoroughly; centrifuge at a speed of 3500 rpm for 45 min. The supernatant was discarded and the tube and its content reweighed. The gain in mass was taken as the water absorption capacity."},{"index":3,"size":64,"text":"Bulk density. The method of [8] was used for bulk density (BD) determination. Ten grams (10 g) of the gari were transferred into 50 ml measuring cylinder. The cylinder was tapped repeatedly for 5 min. The BD of the gari sample was calculated as the mass of gari over the volume at the end of tapping. The mean value was recorded from triplicate determinations"}]},{"head":"Sensory evaluation","index":9,"paragraphs":[{"index":1,"size":119,"text":"A multiple -paired comparison test as described by [14] was used. Panelists were selected from among gariconsumers. Fifteen panelists were made to assess the gari samples in the dry particulate form for taste, colour, aroma, sourness, texture, and overall acceptability. The cassava-sweet potato gari samples were made into \"eba\" and were assessed by twenty panelists for aroma, taste, texture, colour, mouldability, and overall acceptability. The gari samples were also assessed in soaked form for aroma, taste, texture, colour, soakability and overall acceptability. In each case, the samples were rated according to a 9-point hedonic scale of preference with ratings ranging from 1 (dislike extremely) and 9 (like extremely). The results of the evaluation were then subjected to statistical analysis."}]},{"head":"Statistical Analysis","index":10,"paragraphs":[{"index":1,"size":46,"text":"The Statistical Package for Social Sciences (SPSS version 16.0) was used to statistically analyze the data generated from the experiments. The data were further subjected to analysis of variance (ANOVA) to determine significant differences among the samples, and the means were separated with a Tukey test."}]},{"head":"Results and discussion","index":11,"paragraphs":[]},{"head":"Percentage Yield of Cassava-Sweet Potato Gari Production","index":12,"paragraphs":[{"index":1,"size":120,"text":"The percentage yields of the various cassava-sweet potato gari samples ranged from 20 to 28%, with 100% cassava gari having 20%, 100% sweet potato gari having 28% while 10% and 20% substitution level of sweet potato had 20.8% and 21.6%, respectively. [13] reported 15-20 % conversion rate for cassava gari, while [24] reported 40-42% for sweet potato gari. The difference between the 28% conversion rate obtained in this research work and the 42% reported by [24] could be attributed to the difference in the moisture contents of the products which were 6.28-7.10% and 7.95-8.8% respectively. The difference could also be as a result of factors ranging from tuber varieties, time of harvesting, age of plant, to other environmental factors [13]."},{"index":2,"size":142,"text":"The proximate composition of the various cassava-sweet potato gari is presented in Table 2. The moisture contents ranged from 10.10 -12.30%. The 100% sweet potato gari had the highest level of moisture content while the lowest was 100% cassava gari. There was a significant difference (p<0.05) among the cassava-sweet potato gari samples and an increase in the level of moisture content as the level of sweet potato incorporation increased was observed (Table 2). This variation can be attributed to the difference in the production methods. The highest moisture content recorded for 100% sweet potato gari could be attributed to the fibrous nature of sweet potato which would make moisture removal during roasting more difficult hence, longer roasting time requirement to obtain the same level of dryness. Moisture content of 10% is recommended for storage of gari by Standard Organisation of Nigeria [27]."},{"index":3,"size":135,"text":"The crude fibre contents of the cassava-sweet potato gari samples ranged from 1.93 to 1.98%. Cassava-sweet potato gari with 20% level of sweet potato of method one had the highest crude fibre content while that of method three with 10% sweet potato incorporation had the lowest value. The samples however did not differ significantly (p>0.05). Though the expected increase in the level of crude fibre contents of the cassava-sweet potato gari samples with increase in the level of sweet potato incorporation was not obtained, the values are close to those (1.24-1.64%) recorded by [18] The deviation from the expected trend might be as a result of the difference in the production method. Crude fibre through its water absorption capacity has been found to aid bowel movement and aid digestion [4] and therefore significant in diet."},{"index":4,"size":124,"text":"The protein contents of the gari samples differed significantly (p<0.05) and ranged from 1.43 to 4.29%. Cassava-sweet potato gari of method one which had 10% sweet potato had the lowest crude protein content while that of method three with 10% sweet potato had the highest amount. It was expected that the protein content would increase invariably with increased level of sweet potato incorporation which was however not the case. This deviation could be as a result of the effects of the different production methods on the protein content of the cassava-sweet potato gari samples. However, [24] and [18] reported protein contents of 1.27-2.38% and 2.56-3.07%, respectively for gari samples in their research work. These are fairly similar to the values obtained in this study."},{"index":5,"size":204,"text":"The fat contents of the various cassava-sweet potato gari samples ranged from 1.31 to 2.11%, and differed significantly among the samples (p<0.05). Gari from 90% cassava and 10% sweet potato and 80% cassava and 20% sweet potato from method one and three had the highest and lowest fat contents respectively. These values agree with the 1.08 -2.11% reported by [24]. The variation in the level of fat content could be attributed to the effect of the different production methods on the cassava-sweet potato gari samples. The ash content of the cassava-sweet potato gari samples ranged from 1.13 to 1.31% and differed significantly (p<0.05). Cassava-sweet potato gari with 20% sweet potato incorporation of method one had the highest level of ash content while 100% cassava gari had the lowest. These values fall within the range of values (0.12-0.48%) and (1.40-1.82%) reported by [24] and [18] respectively. The cassava-sweet potato gari of method one with 80% cassava and 20% sweet potato recorded the highest value probably due to the level of sweet potato in it. Ash content is a representation of mineral content in food.Therefore the cassava-sweet potato gari will be a good source of minerals which are essential in many biochemical reactions of the body."},{"index":6,"size":314,"text":"There was a significant difference (p<0.05) in the carbohydrate contents of the cassava-sweet potato gari samples. Gari from 10% sweet potato of method one (mixing just before grating) had the highest carbohydrate content while 10% sweet potato gari of method three (mixing just before roasting after grating) had the lowest. The carbohydrate content of the cassava-sweet potato gari (78.11 -83.59%) are close to the 82.53 -87.10% reported by [24]. Except for method 3, there was a decrease in the carbohydrate content of the cassava-sweet potato gari with increased level of sweet potato incorporation which suggests that the cassava roots used had more carbohydrate content than the sweet potato used, or sweet potato incorporation increased level of fermentation which consequently resulted to higher level of carbohydrate break down. This might be as a result of higher sugar content in sweet potato which is the main substrate for fermentation. Sweet potatoes contain simple sugars such as glucose, fructose, sucrose and maltose which make up about 32% of its carbohydrate content [20] The values obtained for the total titratible acidity (TTA) and pH are shown in Table 3. There was a significant (p<0.05) difference among the samples in terms of TTA. The values ranged from 1.36 to 1.70%. Sweet potato gari (100%) had the highest TTA while 10% sweet potato gari of method 3 had the lowest. This could be attributed to the high level of free sugar in sweet potato which increased its tendency to readily undergo lactic acid fermentation. There was a significant (p<0.05) difference in the pH values obtained for the cassava-sweet potato gari samples (Table 3). The values ranged from 4.65 to 4.90. These were within the range of values (4.42-5.98) reported by [27] for gari samples. The pH of gari is also a function of the extent of fermentation. The lower the pH, the better will be the keeping quality of gari."},{"index":7,"size":143,"text":"There was a significant (p<0.05) difference among the cassava-sweet potato gari samples in terms of hydrogen cyanide (HCN) content (Table 3). Cassava gari (100%) had the highest HCN content while that of 100% sweet potato had the lowest. Table 5 shows the HCN contents of the various cassava-sweet potato gari samples. The highest level of HCN obtained for 100% cassava gari could be attributed to the high content in the raw cassava root. Sweet cultivars of cassava can produce as little as 20 mg of HCN per kg of fresh roots, while bitter ones may produce more than 50 times as much [14] The value obtained would be far less than what was in the raw cassava root as a result of the detoxification brought about by fermentation [22] tissue disintegration (Hahn et al., 1987), dewatering, roasting, etc., in the course of production."},{"index":8,"size":438,"text":"The physical and technological properties of cassava-sweet potato gari samples are shown in Table 4. The swelling index of the samples ranged from 330 to 450%, with 20% cassava-sweet potato gari of method 2 having the highest value and that of 100% sweet potato had the least. These values agreed with those (301-430%) reported by [24] The high values can be attributed to the dryness of the gari samples as indicated by the low moisture content (6.28-7.01%). Swelling index indicates the ability of the gari to swell and this is influenced by the quantity and starch components (amylose and amylopectin) present in the gari. Swelling index has been shown to give a greater volume and more feeling of satiety per unit weight of gari to a consumer and a swelling index of at least 3.0 (300%) was recommended to be preferred by consumers [9,7). In each of the columns, any means not followed by the same superscripts are significantly different (p<0.05) KEYS: C 100 SP 0 : 100% cassava gari C 0 SP 100 : 100% sweet potato gari C 90 SP 10 (M1): 90% cassava, 10% sweet potato gari mixed before grating C 80 SP 20 (M1): 80% cassava, 20% sweet potato gari mixed before grating C 90 SP 10 (M2): 90% cassava, 10% sweet potato gari mixed before roasting C 80 SP 20 (M2): 80% cassava, 20% sweet potato gari mixed before roasting C 90 SP 10 (M3): 90% cassava, 10% sweet potato gari mixed after roasting C 80 SP 20 (M3): 80% cassava, 20% sweet potato gari mixed after roasting  The loose and packed densities of the gari samples fell within 0.50-0.63 g/ml and 0.53-0.67 g/ml, respectively. The highest bulk density was obtained for 100% sweet potato gari sample while the lowest was recorded for 10% sweet potato substituted gari sample of method one. These can be compared with the values (0.50 -0.58 g/ml) reported by [18]. Sweet potato gari (100%) had the highest loose and packed densities. This can be attributed to its finer particle size, as was observed from the hand feels of the various gari samples. This resulted to lesser space between the particles and more compactness, thereby reducing the volume; and the lesser the volume, the more the density. Except for method three, there was increase in the level of bulk density with increased level of sweet potato incorporation, which once again suggests the effect of the different production methods on the cassavasweet potato gari. Higher packed bulk and loose bulk densities mean that more quantity of gari can be packed than for the same specific volume of lower densities [11]."},{"index":9,"size":70,"text":"Cassava-sweet potato gari of method two with 20% sweet potato had the highest water absorption capacity of 7.5 ml/g while that of method two with 10% sweet potato had the lowest (5.7 ml/g). The values are close to the values (7.70 -8.16 ml/g) reported by [18]. The 80% cassava and 20% sweet potato gari from method two which had the highest water absorption capacity also recorded the highest swelling index."},{"index":10,"size":78,"text":"The results of the sensory evaluation are presented in Tables 5, 6 and 7. In each of the columns, the samples whose means are not followed by the same superscripts are significantly different (at p<0.05) In each of the columns, the samples whose means are not followed by the same superscripts are significantly different (at p <0.05) In each of the columns, the samples whose means are not followed by the same superscripts are significantly different (at p<0.05)"},{"index":11,"size":209,"text":"The cassava-sweet potato gari samples when assessed in their dry particulate form differed significantly (p<0.05) in all the sensory attributes evaluated. Least rated in all attributes was 100% sweet potato gari, with mean scores of 3.93 (dislike slightly) in aroma, 4.13 (dislike slightly) in sourness, 5.33 (neither like, nor dislike) in texture, 2.60 (dislike moderately) in colour, and 4.00 (dislike slightly) in overall acceptability. Most preferred in aroma, sourness, texture and colour was 10% sweet potato substituted gari sample of method one, with preference ratings falling within the range of \"like moderately\" and \"like very much\". Both 10% sweet potato substituted gari of method one and 100% cassava gari shared the highest mean score in overall acceptability and this corresponds to \"like very much\" on the hedonic scale of preference (Iwe, 2003). When the gari samples were made into eba and evaluated, there were also significant (p<0.05) differences in all the sensory attributes. In terms of mouldability and overall acceptability, 10% sweet potato substituted gari was liked moderately and very much, respectively. In soaked forms, the cassava-sweet potato gari samples differed (p<0.05) significantly in all the sensory attributes, with 10% sweet potato substituted gari sample of method 1 having the highest rating (corresponding to \"like very much\") in soakability."},{"index":12,"size":54,"text":"The difference in level of preference can be attributed to the effect of the different production methods as well as the different levels of sweet potato incorporation. Gari from 90% cassava and 10% sweet potato from method one was most preferred due to the presence of sweet potato in moderate level in the product."}]},{"head":"Conclusions","index":13,"paragraphs":[{"index":1,"size":26,"text":"The study revealed that the different methods of cassava-sweet potato gari production have significant effects on the physical, chemical and sensory qualities of cassava-sweet potato gari."},{"index":2,"size":36,"text":"It can be concluded that the inclusion of sweet potato in the production of gari by 10% is acceptable as attested to by the responses of the panelists selected for the sensory evaluation of the products."},{"index":3,"size":23,"text":"The method involving mixing of 90% cassava and 10% sweet potato just before grating gave a gari product of the highest overall acceptability."},{"index":4,"size":33,"text":"Gari produced from the three methods had good proximate coompositions; the various cassava-sweet potato gari products had protein, fat, carbohydrate and ash contents that compared favourably well with those of 100% cassava gari."},{"index":5,"size":32,"text":"The study has also shown that through modifications of traditional method, the physical and technological properties of gari, such as swelling index, bulk density and water absorbtion capacity, could be well improved."}]}],"figures":[{"text":"Figure 1 . Figure 1. Flow Chart for the production of Cassava-Sweet Potato Gari "},{"text":"Table 1 Research Method of Cassava-Sweet Potato Gari Treatments Cassava (%) Sweet Potato (%) Point of Mixing  C 100 SP 0 100 0 No mixing C 100 SP 01000No mixing C 0 SP 100 0 100 No mixing C 0 SP 1000100No mixing C 90 SP 10 (M1) 90 10 Just before grating C 90 SP 10 (M1)9010Just before grating C 80 SP 20 (M1) 80 20 Just before grating C 80 SP 20 (M1)8020Just before grating C 90 SP 10 (M2) 90 10 Just before roasting C 90 SP 10 (M2)9010Just before roasting C 80 SP 20 (M2) 80 20 Just before roasting C 80 SP 20 (M2)8020Just before roasting C 90 SP 10 (M3) 90 10 After separate production C 90 SP 10 (M3)9010After separate production C 80 SP 20 (M3) 80 20 After separate production C 80 SP 20 (M3)8020After separate production  "},{"text":"Table 2 Chemical Properties of Cassava-Sweet Potato Gari  Samples Moisture Crude Fibre Ash Protein Fat CHO SamplesMoistureCrude FibreAshProteinFatCHO  (%) (%) (%) (%) (%) (%) (%)(%)(%)(%)(%)(%) C 100 SP 0 10.10 a 1.95 a 1.13 a 1.84 a 1.41 a 83.57 e C 100 SP 010.10 a1.95 a1.13 a1.84 a1.41 a83.57 e  ±0.01 ±0.01 ±0.01 ±0.02 ±0.01 ±0.25 ±0.01±0.01±0.01±0.02±0.01±0.25 C 0 SP 100 12.30 e 1.93 a 1.19 ab 1.81 a 1.42 a 81.30 b C 0 SP 10012.30 e1.93 a1.19 ab1.81 a1.42 a81.30 b  ±0.01 ±0.01 ±0.02 ±0.01 ±0.01 ±0.54 ±0.01±0.01±0.02±0.01±0.01±0.54 C 90 SP 10 (M1) 10.50 c 1.96 a 1.18 abc 1.43 a 1.34 ab 83.59 e C 90 SP 10 (M1)10.50 c1.96 a1.18 abc1.43 a1.34 ab83.59 e  ±0.02 ±0.01 ±0.02 ±0.03 ±0.02 ±0.01 ±0.02±0.01±0.02±0.03±0.02±0.01 C 80 SP 20 (M1) 11.20 d 1.98 a 1.15 abc 2.05 a 1.31 bc 82.49 c C 80 SP 20 (M1)11.20 d1.98 a1.15 abc2.05 a1.31 bc82.49 c  ±0.01 ±0.01 ±0.01 ±0.04 ±0.01 ±0.05 ±0.01±0.01±0.01±0.04±0.01±0.05 C 90 SP 10 (M2) 10.16 ab 1.95 a 1.14 bc 2.01 a 1.33 c 83.41 e C 90 SP 10 (M2)10.16 ab1.95 a1.14 bc2.01 a1.33 c83.41 e  ±0.01 ±0.01 ±0.01 ±0.02 ±0.01 ±0.16 ±0.01±0.01±0.01±0.02±0.01±0.16 C 80 SP 20 (M2) 10.90 d 1.96 a 1.30 c 1.56 a 1.44 c 82.84 d C 80 SP 20 (M2)10.90 d1.96 a1.30 c1.56 a1.44 c82.84 d  ±0.01 ±0.01 ±0.02 ±0.03 ±0.05 ±0.41 ±0.01±0.01±0.02±0.03±0.05±0.41 C 90 SP 10 (M3) 12.25 e 1.93 a 1.31 d 4.29 b 2.11 d 78.11 a C 90 SP 10 (M3)12.25 e1.93 a1.31 d4.29 b2.11 d78.11 a  ±0.01 ±0.02 ±0.01 ±0.01 ±0.05 ±0.01 ±0.01±0.02±0.01±0.01±0.05±0.01 C 80 SP 20 (M3) 10.24 bc 1.97 a 1.20 d 3.14 c 1.88 c 81.57 bc C 80 SP 20 (M3)10.24 bc1.97 a1.20 d3.14 c1.88 c81.57 bc  ±0.04 ±0.01 ±0.01 ±0.02 ±0.03 ±0.02 ±0.04±0.01±0.01±0.02±0.03±0.02  "},{"text":"Table 3 Other Chemical Properties of Cassava-Sweet Potato Gari  Samples TTA pH HCN SamplesTTApHHCN  (%)  (mg/100 g) (%)(mg/100 g) C 100 SP 0 1.60 e ±0.05 4.75 ab ±0.05 2.16 e ±0.01 C 100 SP 01.60 e ±0.05 4.75 ab ±0.05 2.16 e ±0.01 C 0 SP 100 1.70 e ±0.05 4.90 b ±0.00 0.56 b ±0.05 C 0 SP 1001.70 e ±0.05 4.90 b ±0.00 0.56 b ±0.05 C 90 SP 10 (M1) 1.49 bcd ±0.04 4.70 a ±4.65 2.11 e ±0.01 C 90 SP 10 (M1) 1.49 bcd ±0.04 4.70 a ±4.65 2.11 e ±0.01 C 80 SP 20 (M1) 1.41 abc ±0.01 4.65 a ±0.05 1.07 e ±0.01 C 80 SP 20 (M1) 1.41 abc ±0.01 4.65 a ±0.05 1.07 e ±0.01 C 90 SP 10 (M2) 1.36 ab ±0.01 4.65 a ±0.05 1.22 c ±0.01 C 90 SP 10 (M2) 1.36 ab ±0.01 4.65 a ±0.05 1.22 c ±0.01 C 80 SP 20 (M2) 1.54 cd ±0.01 4.70 a ±0.00 1.31 d ±0.01 C 80 SP 20 (M2) 1.54 cd ±0.01 4.70 a ±0.00 1.31 d ±0.01 C 90 SP 10 (M3) 1.27 a ±0.03 4.70 a ±0.00 0.74 b ±0.01 C 90 SP 10 (M3) 1.27 a ±0.034.70 a ±0.00 0.74 b ±0.01 C 80 SP 20 (M3) 1.46 bcd ±0.00 4.70 a ±0.00 0.58 a ±0.04 C 80 SP 20 (M3) 1.46 bcd ±0.00 4.70 a ±0.00 0.58 a ±0.04 In each of the columns, any means not followed by the same superscripts are significantly different In each of the columns, any means not followed by the same superscripts are significantly different (p<0.05)    (p<0.05)  "},{"text":"Table 4 Physical andTechnological Properties of Cassava Sweet Potato Gari  Samples Swelling index Loose Bulk Packed Bulk Water Holding SamplesSwelling indexLoose BulkPacked BulkWater Holding  (%) Density Density Capacity (%)DensityDensityCapacity   (g/cm 3 ) (g/cm 3 ) (ml/g) (g/cm 3 )(g/cm 3 )(ml/g) C 100 SP 0 370 0.50 0.53 7.2 C 100 SP 03700.500.537.2 C 0 SP 100 330 0.63 0.67 6.6 C 0 SP 1003300.630.676.6 C 90 SP 10 (M 1 ) 340 0.48 0.53 6.3 C 90 SP 10 (M 1 )3400.480.536.3 C 80 SP 20 (M 1 ) 400 0.53 0.56 6.8 C 80 SP 20 (M 1 )4000.530.566.8 C 90 SP 10 (M 2 ) 380 0.53 0.59 5.7 C 90 SP 10 (M 2 )3800.530.595.7 C 80 SP 20 (M 2 ) 450 0.56 0.59 7.5 C 80 SP 20 (M 2 )4500.560.597.5 C 90 SP 10 (M 3 ) 400 0.53 0.56 7.1 C 90 SP 10 (M 3 )4000.530.567.1 C 80 SP 20 (M 3 ) 390 0.50 0.53 6.8 C 80 SP 20 (M 3 )3900.500.536.8  "},{"text":"Table 5 Results of Sensory Evaluation of Cassava-Sweet Potato Gari  Sample Aroma Sourness Taste Texture Colour Overall Acceptability SampleAroma Sourness Taste Texture Colour Overall Acceptability C 100 SP 0 6.60 b 6.67 b 7.47 b 7.20 bc 7.40 e 7.60 b C 100 SP 06.60 b6.67 b7.47 b7.20 bc7.40 e7.60 b C 0 SP 100 3.93 a 4.13 a 4.47 a 5.33 a 2.60 a 4.00 a C 0 SP 1003.93 a4.13 a4.47 a5.33 a2.60 a4.00 a C 90 SP 10 (M1) 6.87 b 6.87 b 7.20 b 7.67 c 8.07 e 7.60 b C 90 SP 10 (M1) 6.87 b6.87 b7.20 b7.67 c8.07 e7.60 b C 80 SP 20 (M1) 6.00 b 5.53 ab 6.33 b 6.67 abc 6.87 cde 6.67 b C 80 SP 20 (M1) 6.00 b5.53 ab6.33 b6.67 abc6.87 cde6.67 b C 90 SP 10 (M2) 6.33 b 5.93 b 6.33 b 6.20 abc 5.93 bcd 6.33 b C 90 SP 10 (M2) 6.33 b5.93 b6.33 b6.20 abc5.93 bcd6.33 b C 80 SP 20 (M2) 6.33 b 6.07 b 6.93 b 6,73 abc 5.47 bc 6.93 b C 80 SP 20 (M2) 6.33 b6.07 b6.93 b6,73 abc5.47 bc6.93 b C 90 SP 10 (M3) 6.53 b 6.53 b 7.07 b 6.53 abc 6.73 bcde 7.13 b C 90 SP 10 (M3) 6.53 b6.53 b7.07 b6.53 abc 6.73 bcde7.13 b C 80 SP 20 (M3) 6.13 b 5.67 ab 6.20 b 6.00 ab 5.20 b 6.33 b C 80 SP 20 (M3) 6.13 b5.67 ab6.20 b6.00 ab5.20 b6.33 b  "},{"text":"Table 6 Results of Sensory Evaluation of Cassava-Sweet Potato Eba  Samples Aroma Taste Texture Colour Mouldability Overall SamplesAroma Taste Texture Colour MouldabilityOverall       Acceptability Acceptability C 100 SP 0 6.75 b 6.95 b 6.85 bc 6.90 bc 6.65 ab 7.05 bc C 100 SP 06.75 b6.95 b6.85 bc6.90 bc6.65 ab7.05 bc C 0 SP 100 4.10 a 4.65 a 5.45 a 3.20 a 5.55 a 4.20 a C 0 SP 1004.10 a4.65 a5.45 a3.20 a5.55 a4.20 a C 90 SP 10 (M1) 6.95 b 7.05 b 7.30 c 8.10 c 7.45 b 7.90 c C 90 SP 10 (M1) 6.95 b7.05 b7.30 c8.10 c7.45 b7.90 c C 80 SP 20 (M1) 6.20 b 6.35 b 6.45 abc 6.05 b 6.20 ab 6.45 b C 80 SP 20 (M1) 6.20 b6.35 b6.45 abc6.05 b6.20 ab6.45 b C 90 SP 10 (M2) 7.10 b 6.85 b 6.50 abc 6,75 bc 6.80 ab 6.60 b C 90 SP 10 (M2) 7.10 b6.85 b6.50 abc6,75 bc6.80 ab6.60 b C 80 SP 20 (M2) 5.85 b 6.05 ab 6.90 ab 5.70 b 6.15 ab 5.90 b C 80 SP 20 (M2) 5.85 b6.05 ab6.90 ab5.70 b6.15 ab5.90 b C 90 SP 10 (M3) 6.50 b 6.65 b 6.60 abc 6.15 b 5.95 a 6.30 b C 90 SP 10 (M3) 6.50 b6.65 b6.60 abc6.15 b5.95 a6.30 b C 80 SP 20 (M3) 6.20 b 6.50 b 6.25 abc 6.60 b 6.65 ab 6.65 bc C 80 SP 20 (M3) 6.20 b6.50 b6.25 abc6.60 b6.65 ab6.65 bc  "},{"text":"Table 7 Results of Sensory Evaluation of Soaked Cassava-Sweet Potato Gari  Samples Aroma Taste Soak Texture Colour Overall SamplesAroma TasteSoakTexture ColourOverall    ability   Acceptability abilityAcceptability C 100 SP 0 7.00 b 6.90 b 7.10 b 6.90 b 6.70 ab 7.10 b C 100 SP 07.00 b6.90 b7.10 b6.90 b6.70 ab7.10 b C 0 SP 100 5.10 a 4.80 a 4.80 a 5.10 a 3.60 b 4.90 a C 0 SP 1005.10 a4.80 a4.80 a5.10 a3.60 b4.90 a C 90 SP 10 (M1) 6.10 ab 6.80 b 7.50 c 6.80 ab 7.90 c 7.40 b C 90 SP 10 (M1) 6.10 ab 6.80 b7.50 c6.80 ab7.90 c7.40 b C 80 SP 20 (M1) 5.90 ab 6.30 ab 6.30 abc 6.50 ab 6.80 bc 6.80 b C 80 SP 20 (M1) 5.90 ab 6.30 ab6.30 abc6.50 ab6.80 bc6.80 b C 90 SP 10 (M2) 7.00 b 7.00 a 6.70 bc 6.70 ab 6.90 bc 6.90 b C 90 SP 10 (M2) 7.00 b7.00 a6.70 bc6.70 ab6.90 bc6.90 b C 80 SP 20 (M2) 6.10 ab 6.60 b 5.40 ab 6.60 ab 5.90 b 6.20 ab C 80 SP 20 (M2) 6.10 ab 6.60 b5.40 ab6.60 ab5.90 b6.20 ab C 90 SP 10 (M3) 6.90 b 7.10 a 6.90 bc 6.90 b 7.00 bc 7.10 b C 90 SP 10 (M3) 6.90 b7.10 a6.90 bc6.90 b7.00 bc7.10 b C 80 SP 20 (M3) 6.30 ab 6.80 b 5.90 bc 6.50 ab 6.60 bc 6.60 ab C 80 SP 20 (M3) 6.30 ab 6.80 b5.90 bc6.50 ab6.60 bc6.60 ab  "}],"sieverID":"7872b3fc-9ae2-4001-af6d-58371e05be71","abstract":"Introduction. Food safety is one of the problems facing sub-Sahara African countries like Nigeria. The use of wholesome indigenous crops and improved methods of production of major foods is a way forward."}

data/part_3/0098ae9367c42a78ef35ecb2d3768b7e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0098ae9367c42a78ef35ecb2d3768b7e","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H041758.pdf"},"pageCount":12,"title":"thiopian highlands and implications for the downstream Blue Nile 1","keywords":["Blue Nile (Abay)","upstream-downstream","watershed management","water allocation","degradation","sediment","modelling"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":104,"text":"rty and food oods depend ent strides in ed, integrated resource-base Basin, water n as the Abbay in Ethiopia), has historically benefited downstream people in Sudan and Egypt in different , 2008) ater quantity nges in land, tion pressure, elopment are agricultural oth potential of water flowing downstream. It is widely recognized that improved water management in the Abbay catchemnt could significantly increase water p to alleviate flicts among lders, a two years research project has started. This hypothesizes that with increased scientific knowledge of the hydrological, hydraulic, in Ethiopia (Abbay), constraints to up-scaling management practices and promising technologies within the catchment can downstream"},{"index":2,"size":10,"text":"The major research questions being addressed by the project are:"},{"index":3,"size":12,"text":"and reverse 2: What are the downstream impacts of these interventions? ity?"},{"index":4,"size":68,"text":"erlying hypothesis and all require in depth research to answer them. A substantial effort is being undertaken to identify interventions, prove concepts and evaluate their impacts. Strong partnerships have been developed with various institutions jointly undertaking the research. This paper presents discussion of methodologies, on-going work and preliminary results, focusing on a review of literature covering meteorology, hydrology, water use, development potential and sediment transport within the basin."},{"index":5,"size":83,"text":"The need for integrated water resources management to alleviate pove insecurity especially in semi-arid Africa, where over 80% of rural livelih directly on land and water resources, cannot be overemphasized. Rec sustainable resource management have recognized the need for a broad bas approach that coordinates the activities of people dependent on a common to achieve resource-use efficiency, equity and sustainability. In the Nile from the Ethiopian highlands, particularly from the Blue Nile (know ways: agriculture, livestock, industry and electrical power (Awulachew et al"},{"index":6,"size":98,"text":"The sustainability of such use, the availability of the resource in terms of w and quality is heavily affected and continues to be affected by dramatic cha water and livestock management in the upstream catchment. High popula lack of alternative livelihood opportunities and the slow pace of rural dev facilitating deforestation, overgrazing, land degradation and declining productivity. Poor water and land management by upstream uses reduces b runoff yields and the quality availability for various stakeholders within the catchment. This would hel the impacts of natural catastrophes such as droughts and reduce con stakeholders dependent on the river."},{"index":7,"size":42,"text":"Proposed by diverse stakeho watershed, and institutional processes of the Blue Nile be overcome, resulting in significant positive benefits for both upstream and communities (i.e. win-win scenarios).  1). Figure 2 shows the major tributary rivers as categorized by Hydrosult et al (2006)."},{"index":8,"size":62,"text":"The Abbay-Blue Nile 2 Sub-basin covers an area of 311,548 km 2 (Hydrosul and the river is the principal tributary of the main Nile River. It provides 62 reaching Aswan (World Bank, 2006). The river and its tributaries drain a lar of the central, western and south-western highlands of Ethiopia before dr plains of Sudan. The co the Blue Nile below Sennar."},{"index":9,"size":239,"text":"The basin is characterized by highly rugged topography and considerable Rainfall varies significantly with altitude and is considerably greater in the Ethiopian highlands than on the Plains of Sudan (Figure 3). Rainfall ranges from nearly 2,000 ith the White , the average annual rainfall over much of the basin is less than 500mm. Above Rosieres, the average annual rainfall is about 1,600 mm. It increases from about 1,000 mm near the Sudan border to between 1,400 and 1,800 mm over parts of the mm/yr in the Ethiopian Highlands to less than 200mm/yr at the junction w Nile. Within Sudan upper basin, in particular in the loop of the Blue Nile south of Lake Tana. Rainfall exceeds 2,000 mm in parts of the Didessa and Beles catchments. ater balance ve the spatial distribution of runoff within the basin. The runoff distribution is especially important for prediction of erosion and sedimentation. Although many semi-distributed models claim to predict the spatial distribution of runoff, very few have been validated. Currently, we feel that using several models in combination may result in the best outcome. Our understanding of the hydrology can be enhanced by using a combination of model predictions. We are using both the simple parameter SWAT model based on the generalized curve number method and a modified version of SWAT which incorporates the Blue Nile oscillated around the mean there was a gene increased (Ahmed, A, 2006, Hydrosult et al, 2006)."}]},{"head":"Runoff Mechanisms and Water Availability","index":2,"paragraphs":[]},{"head":"Modeling runoff","index":3,"paragraphs":[{"index":1,"size":307,"text":"Many models have been used to study the hydrology of the Abba Awualchew et al. ( 2008) identifies 13 rainfall-runoff models that have bee other models for the hydrology of the whole Nile). None of these mode adopted in the basin and development of similar models continues. The q answered remains; what simulation model or models should be used for s hydrology for the Abay/Blue Nile basin? Since the direct runoff is depend the total rainfall and only slightly influenced by the intensity of the ra models are also appropriate because they require minimal input data (e.g., (P) and potential evapotranspiration (PET) data that are generally a interesting approach to simulate this phenomenon was developed by Tesfa (2006) employing a hyperbolic sine function to assure that the soil storage to be filled, after the dry season, before runoff is produced in significant qua Ultimately there is a need for additional model development because w models only provide the discharge at the watershed outlet and do not gi modifications reflecting actual behavior of climate and the watershed runo processes. At this stage, in addition to reviewing the various existing mo employed SWAT, taking the Gumera watershed as a sub-basin for modeling we have generated flow at the outlet in combination with sediment m analyses of the impact of different land and water management interventi section 4 below). Accordingly, the modelling and performance evaluation SWAT provides (calibration, validation) resulted in Nash -Suttclif efficiency (ENS) of ( 0 There is very little irrigation in the Ethiopian Blue Nile catchment. The area is currently estimated to be little a include the small-scale traditional schemes it is certainly an underestimat total. Currently, the only major irrigation scheme in the Ethiopian part of th the Finchaa sugar cane plantation (8,145 ha), which utilizes water after through the hydropower plant at the Finchaa dam."},{"index":2,"size":121,"text":"In contrast to Ethiopia, Sudan utilizes significant volumes of Blue N irrigation and also for hydropower production. Two dams (i.e., Sennar and R been constructed on the main river approximately 350 km and 620 km Khartoum. These provide hydropower (primarily for Khartoum) as well as huge Gezira and Rahad irrigation schemes. t of the Nile sustainable socio-economic development. There is significant potential for additional exploitation and both Ethiopia and Sudan plan to further develop ber of years. rojects will cover a total of more than 174,000 ha, which represents 21% of the 815,581 ha of potential irrigation 3 estimated in the basin (BCEOM, 1998) (Figure 5). Major irrigation schemes that are currently being planned and/or implemented are described in Table 2."}]},{"head":"Future development potential","index":4,"paragraphs":[{"index":1,"size":21,"text":"The Nile riparian countries have agreed to collaborate in the developmen water resources to achieve the water resources of the river."},{"index":2,"size":15,"text":"In Ethiopia possible irrigation projects have been investigated over a num Currently envisaged irrigation p  "}]},{"head":"Source: various","index":5,"paragraphs":[{"index":1,"size":208,"text":"In the Ethiopian Blue Nile more than 120 potential hydropower sites have b (WAPCOS, 1990). Of these 26 were investigated in detail during the prep Abay River Basin Master Plan (BCEOM, 1998). The major hydropo currently being contemplated in Ethiopia have a combined installed capaci 3,634 MW and 7,629 M. The exact figure depends on the final design of the consequent head that is produced at each. The four largest schemes being c dams on the main stem of the Blue Nile River. Of these schemes the furthe the Tana-Beles intra een identified aration of the wer projects ty of between dams and the onsidered are st advanced is -basin transfer which will have an installed capacity of 460 MW. As part of this development a number of irrigation dams are also planned on the tributaries n will be added t is estimated . The possible ered is in the esents 20-40% of the technical potential in the timated by the Ministry of Water Resources. er stations source of the ainly on and ck hills (Jebels), which have become devoid of vegetative cover. Most of this is deposited on the footslope of the hills and does not enter the drainage system. but given the main rivers. carry heavy"},{"index":2,"size":110,"text":"The problems of erosion are compounded by intrinsic factors, not only related to the institutional, d use policy, cio-economy, y watershed, cultivation practices, conservation xistent. Some re almost no measurements of bed load. As a consequence detailed evaluation and modeling of sediment transport in the basin is very difficult. However, previous direct and indirect studies have been made at various locations. These include bathymetric surveys at Roseires and Senar reservoirs in Sudan as well as at Lake Tana in Ethiopia. These provide useful information on sediment impacts. A study of the long term impact of sediment in the Senar dam over 56 years , shows the flowing into Lake Tana."},{"index":3,"size":82,"text":"In addition to the schemes discussed, it is anticipated that power generatio to several of the proposed irrigation projects where dams are being built. I that this could provide an additional 216 MW of capacity (BCEOM, 1998) total annual energy produced by all the hydropower schemes being consid range 16,000 -33,000 GWh/yr. This repr Ethiopian Blue Nile (i.e. 72,000 GWh/yr) es Currently it is anticipated that much of the electricity generated by these pow could be exported to Sudan and possibly Egypt."}]},{"head":"Erosion, Sediment and Sedimentation Problems","index":6,"paragraphs":[{"index":1,"size":101,"text":"According to Hydrosult et al (2006b), the Ethiopian plateau is the main sediment in the Blue Nile system. Some erosion occurs within Sudan, m around the ro Some water induced soil movement also occurs on the flat clay plains, poorly developed surface drainage system little of this sediment reaches the However, those streams which do reach the river during the rainy season sediment loads. physical and hydraulic properties of the river but also various social, political issues. Erosion and sediment problems are strongly related to lan natural resources management, level of development of the so degradation/deforestation of the tributar measures, etc."},{"index":2,"size":114,"text":"Information concerning the sediment load of the Nile is nearly non e measurements of suspended sediment load are available, but there a sediment deposition never caused the loss of volume to exceed ½% (i.e. 4.6 per year (Ahmed et al., 2006). However, in the following period sedimentation increased dramatically to a rate of 80 million m 3 per year reduction of 400 million m³ (43%) in only 5 years. Overall, the Sennar dam its original reservoir capacity (660 million m 3 ) in 61 years. The d Million m 3 ) (1981-1986) (9½%) i.e. a lost 71% of rastically increased rate of sedimentation between 1981 and 1986 is partly attributed to enhanced incoming n."},{"index":3,"size":317,"text":"st reservoir in about 200 km acity was 650 entation rate (1985)(1986)(1987)(1988)(1989)(1990)(1991)(1992) with a rate of 60 Mm per year and a reduction of 427 Mm 3 . As with the Sennar dam, this change can be attributed to increased inflowing reservoir and , reveals that on rate of Lake Tana is 3.5 mm/year. This implies there is significant sediment deposition (loss up to 10.5 Million m 3 per year). Unless drastic shallow lake deposition of ducted in this study is to investigate the erosion, sediment transport and sedimentation phenomenon at various scales with a ent level (i.e. b-basins (i.e. latter will be . In addition vestigated the r strips using nd secondary t the outlet of ation) shows .2%, -16.9%) ment. This is particularly, useful to understand and estimate the overall sediment yield of the entire Blue Nile basin, particularly given the problem of data unavailability of sediment yield in watersheds. The results of the vegetative filter strip for non tolerable erosion rate at base scenario exceeding 11 ton/ha shows that, an average annual sediment yields were reduced by 52 % to 62 % for a 5m buffer strip and 74.19% to 74.35% for a 10m strip (Tenaw, 2008). The significance of the study is that it is possible to identify critical erosion risk area, understand the sediment and runoff generated from various sub-watersheds, sediment due to increased upstream erosion and partly to poor dam operatio Roseires dam, which was constructed in 1964 on the Blue Nile, is the bigge Sudan with an initial capacity of 3.3 Billion m 3 . Roseires dam is located upstream Sennar dam. In the first 15 (1976)(1977)(1978)(1979)(1980)(1981)(1982)(1983)(1984)(1985) years the drop in the cap millions m 3 with a rate of 43 Mm 3 per year. A drastic increase in the sedim occurred in the period 3 sediment, poor reservoir operation as a result of changing policies in irrigation management etc."},{"index":4,"size":44,"text":"Comparison of bathymetric surveys of Perangeli in 1987 and Kaba in 2006 the annual sediment depositi erosion and sedimentation measures are undertaken, the impact on the (maximum depth 14m) will be significant. Of particular concern is the sediment at the mouth of the rivers."},{"index":5,"size":45,"text":"As further undertaking of the research being con number of different methodologies. Research will be conducted at catchm detailed modeling of erosion processes, sub watersheds, tributary su empirical estimates of sediment yield) and large lakes and reservoirs. The based primarily on bathymetric and sedimentation studies."},{"index":6,"size":102,"text":"Results of the modeling in the Gumera watershed provide useful knowledge to the runoff simulation result discussed in section 3.1 above, we have in erosion and sediment yield, impact of interventions using vegetative filte unmodified SWAT modelling environment. We have used both primary a physical, hydrological and sediment data measured in the catchment and a the watershed. Accordingly, sediment simulation result (calibration, valid ENS of (0.85, 0.79), R 2 of (0.74, 0.62), and mean deviation of (-14 showing a good agreement between measured and simulated monthly sedi evaluate impact of interventions of watershed management and thereby proper degradation reversal measures be adopted."},{"index":7,"size":33,"text":"e Abbay-Blue management endent on the sting various has a strong cts of future management, water allocation and policy and ns. It is anticipated that it will also contribute significantly and establish good "}]},{"head":"References","index":7,"paragraphs":[]},{"head":"Conclusions","index":8,"paragraphs":[{"index":1,"size":82,"text":"This paper provides an overview of water and land management issues in th Nile. Preliminary results of a research project on \"Improved water and land in the Ethiopian highlands and its impact on downstream stakeholders dep Blue Nile\" have been presented. The project in addition to applying and te models and approaches to generate improved knowledge of the basin, emphasis in analayzing situation of the existing condition and impa interventions with respect to watershed institutio synergies with existing NBI and ENTRO projects. "}]}],"figures":[{"text":"1: What are the successful interventions that help improve productivity degradation? 3: What are the opportunities for enhancing rural livelihoods and food secur These questions are broadly defined to prove the und 2. Characterization of the Abbay (Blue Nile) River System t et al., 2006) % of the flow ge proportion opping to the nfluence of the Blue Nile and the White Nile is at Khartoum. The Dinder and Rahad rise to the west of Lake Tana flow westwards across the border joining variation of altitude ranging from about 350 masl at Khartoum to over 4250 masl. in the Ethiopian highlands (Figure "},{"text":"Figure 1 Figure Figure 1 Map of the Blue Nile showing elevation, main tributaries and key geographic features (Source: Awulachew et al, 2008) "},{"text":"Figure 3 : Figure 3: Mean annual rainfall across the Abay -Blue Nile catchment The highest basin temperature varies from 44°C to 21 o C in Sudan in "},{"text":"Figure 5 : Figure 5:Map showing potential sites for future \"modern\" irrigation schemes in the Ethiopian Blue Nile "},{"text":" to Ministry of Water Resources, The Federal Democratic Republic of Ethiopia ent in Abay ment Forum ceeding. Addis Ababa, Ethiopia t, Comatex Nilotica and T and A Consulting. 2006. TRANS-BOUNDARY ANALYSIS: ABAY -BLUE NILE cal regional lity study. Report to ahun,D., Moges, S. Awualchew, S.B. 2006. Water Balance Modeling and Estaimation of Sub-Basin Water Yield from Blue Nile River Basin. In Proceeding of Nile Basin Development Forum, 2006. The Role of the Nile River in Poverty Reduction and Economic Development in the Region, 28 November -02 December 2006. 17p Tenaw, M. 2008. SWAT based run off and sediment yield modeling (a case study of Gumara watershed in the Lake Tana sub basin) Ethiopia. Arbaminch University, M.Sc. Thesis "},{"text":" Ahmed A.A., (2006). \"Multipurpose Develoment of the Eastern Nile, Inventory\", ENTRO Report, Sudan.Awulachew, S. B, McCartney, M., Steinhaus, T, Mohamed,A. 2008. hydrology, sediment and water resources use in the Blue Nile BCEOM, 1998. Abbay River Basin Integrated Development Master Plan P Endale, Y.D. 2006. Assessment of Water Demand for irrigation developm Basin (A case of tributary development scenario). In The Nile Develop (2006) pro Hydrosult Inc, Tecsult, DHV and their Associates Nile Consul SUB-BASIN. NBI-ENTRO (Nile Basin Initiative-Eastern Nile techni Organization). Norconsult, 2006. Karodobi Multipurpose project, pre-feasibi Ministry of Water Resources, The Federal Democratic Republic of Ethiopia Tesf "},{"text":"From Hydrology to Existing water use Ethiopia currently utilizes very little of the Blue Nile water for a range reas its inaccessibility, the fact that major centers of population lie outside of t there are inadequate resources for investment etc. To date only two rela hydraulic structures have been constructed in the Ethiopian Blue Nile catc two dams (i.e., Chara Chara wei hydropower. The combined capacity of the power stations they serve represents approximately 30% of the total currently installed power ca country (i.e. 731 MW)(World Bank, 2006).    ff generating ff generating    dels, we have dels, we have    . Within this . Within this    odeling and odeling and    ons (see also ons (see also    of unmodified of unmodified    fe simulation fe simulation  .76, 0.72) , correlation coefficient (R 2 ) of (0.87, 082), and mean .76, 0.72) , correlation coefficient (R 2 ) of (0.87, 082), and mean deviation of (3.29 %, -5.4%) showing a good agreement between measured and deviation of (3.29 %, -5.4%) showing a good agreement between measured and simulated monthly flows. See Tenaw, M. (2008) for further information. simulated monthly flows. See Tenaw, M. (2008) for further information. 3.2   3.2    ons, including ons, including    he basin and he basin and    tively minor tively minor    hment. These hment. These   r and Finchaa) were built primarily to provide r and Finchaa) were built primarily to provide    is 218 MW is 218 MW    pacity of the pacity of the    total irrigated total irrigated   bove than 10,000 ha, but since this does not bove than 10,000 ha, but since this does not    e of the real e of the real    e catchment is e catchment is    it has passed it has passed    ile water for ile water for    oseries) have oseries) have    south-east of south-east of    water for the water for the    y at the two dams y at the two dams is 295 MW which represents 25% of the countries total capacity (i.e., 1200 MW from is 295 MW which represents 25% of the countries total capacity (i.e., 1200 MW from and hydr  s). The existing irrigation scheme exceeds 1.3 and hydrs). The existing irrigation scheme exceeds 1.3 lion hectares, see Table 1. M n 50% of tion and maintenance cost of lion hectares, see Table 1. Mn 50% oftion and maintenance cost of ezira irrigation scheme in Sudan goes for de-silting of the irrigation canals. ezira irrigation scheme in Sudan goes for de-silting of the irrigation canals. ore, both the Roseires and Sennar re ave lost significant storage ore, both the Roseires and Sennar reave lost significant storage ity due to siltation, with mo ment flowing in from the Ethiopian highlands ity due to siltation, with moment flowing in from the Ethiopian highlands Scheme Command Area (ha) Crops SchemeCommand Area (ha)Crops  "},{"text":"Table 1 : Existing Irrigation Schemes in the Sudan (Source:Ahmed, 2006)     The installed power capacit The installed power capacit  "},{"text":"Table 2 . An analysis of water resources required to support the Ethiopian irrigation proposed in the Abay River Master Plan(BCEOM, 1998), indicates that a 5,750 Mm 3 would be needed to irrigate between 370,000 and 440,000 ha. T approximately 12% of the mean annual flow into Sudan (see above). Mm 3 more water than is abstracted at present. Sudan is also planning to increase the area irrigated in the Blue Nile bas new projects and extension of existing schemes are anticipated to add 889,340 ha by 2025 (Table2). The major those c ently achieved in the Gezira and other schemes, this w More r More r  "}],"sieverID":"0f0ff8e5-01c8-4ea4-97a0-d9737de7cda4","abstract":"collaborative ater and land stakeholders n highlands, am people in ctrical power. ng land, water ure, lack of g uctivity. Poor d the quality ood insecurity ing, and poor cognized that crease water estions to be help improve gradation? What are the impacts downstream? What are the opportunities and constraints enhancing rural livelihoods and food security? This paper hysical based es for erosion and sediment modelling and water availability and access for various production systems. Synergies and complementarities with the Nile Basin shared vision and subsidiary action projects, particularly within the Eastern Nile are also highlighted."}

data/part_3/0151b2e7f5614c8ce7ab0a5132d88654.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0151b2e7f5614c8ce7ab0a5132d88654","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/81f0453e-eaa7-4a84-9ca6-4bf6d554039a/retrieve"},"pageCount":52,"title":"THE FOOD ENEMlES TO COUNTERACT WHY PACKAGING AND WHAT ARE THE PACKAGING REQU l REtvlENTS' PACKAGING SOLUTIONS PACKAGING MATERIALS","keywords":[],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[]},{"head":"Soybean processing and utilization: The way to good health!","index":2,"paragraphs":[{"index":1,"size":164,"text":"Tropical soil biology and ferrility (TSBF) an institute of International Center For Tropical Agriculrure (CI A T) , was founded in 1984 and its main activiry includes research on the role of biological and orgaruc resources in tropical soi! biology and fertiliry and its relationship to the narural and social environment in order to pro vide farmers with improved soi! management practices to sustainably improve their livelihoods. However successfuJ resource management and sustainable agriculrura! productiviry need to go still further addressing socio-culrural realities in the realms of market, health and policies. The central hypothesis is that narural resources management research \\Vill have more leverage if the apparent gaps between investrnent in the narural source base and equitable income generation and distribution can be bridged Under lhe ne\\V framework investment in soi! fertiliry management represents a key entry point to sustainable agriculrural productivity growlh, and a necessary condition for obtaining positive net returns to olher types of farm investrnent. Therefore TSBF pursues lhe following objectives:"},{"index":2,"size":27,"text":"• To improve lhe livelihoods of people reliant on agriculrure by developing sustainable pr06table, socially just and resilient agriculrure production systems based on integrated soi! fertility management"},{"index":3,"size":14,"text":"• To develop sustainable land management practices in tropical areas while reversing land degradation"},{"index":4,"size":23,"text":"• To enhance lhe human and social capital of all TSBF-CIAT stakeholders for research and management on lhe sustainable use of tropical soils."},{"index":5,"size":165,"text":"TSBF-CLA T strategy of povert)' reduction through science led research has be en linked to h eallh (nutrition), food consurnption, and markets and it addresses lhe real needs of lhe poor; interacting between lhe components of soi! fertiliry, production yields, markets, processing, nutrition and health. Success fuJ resource management and sus tainable agriculrural producti,~ry need to be pro poor i.e. it must touch lhe realms of soi! ferriliry, markets, income generations, food/nutrition securiry, nutrition and heallh. Ir is at lhe farmer's advantage if a multi purpose crop like promiscuous soybeans was adopted which will improve lhe soi!, lhereby increasing the yields of even subsequent crop planted at lhe same time allowing the farmers to have a good incorne. Also, lhe farmer being able to process sorne of lhe soybeans fOI the household lhus improving the nutrition o f rnembers of the household especially the children. In particular the zero to three years where the development of the brain is crucial and malnutriríon (diseases) is nfe."},{"index":6,"size":44,"text":"In an increasingly entwined vicious cyde, food insecurity heightens suscepríbility to HIV exposure and infecríon while HIV / AIOS heightens vulnerability to food insecuriry and poverty. Envirorunental, human and economic health is so intertwined that it is often difficult to disrínguish cause from effect."},{"index":7,"size":107,"text":"In above context, a project was approved by the Rockefe11er Foundaríon for an iniríal penod of 2 years Guly 2005 -Jlll1e 2007) aiming at using soybean processing and utilizaríon as an entry point to solving nutriríon and health problems of rural and urban households, affected by HIV / AJOS in targeted areas in Kenya. The project which is being implemented by TSBF is in co11aboraríon with AMP ATH and in dose associaríon with a sister project on 'Explonng the mulríple potenríals of soybeans in enhancing rurallivelihoods and sma11 industry in East Afríca', also fW1ded by the Foundaríon (2004Foundaríon ( -2007)), and focusing on alle\\~ating soybean marketing bottlenecks."},{"index":8,"size":116,"text":"In the current project, processing is being fostered at the household and the community leve!. The project has cartied out baseline surveys, product development (parrícularly in food fortificaríon), design and testing of processing technologies, fo11ow up surveys of impact assessment, and turning of a wide range of target groups. U tilizaríon research and promoríon will stress soybean's advantages in household consumpríon and will train women associaríons and groups concemed with social and health welfare. Food fortificaríon and incorpora río n of soybeans in the tradiríonal foods consumed in rural Kenya is tbe main strategy of the project. Foods that are 10ca11y consumed are idenrífied and thereby forríficaríon or incorporaríon usiog soybeans is done. Such food indudes:"},{"index":9,"size":4,"text":"• Soy Chin Chin      "}]},{"head":"General Information","index":3,"paragraphs":[{"index":1,"size":1,"text":"DehuU:"},{"index":2,"size":1,"text":"Part:"},{"index":3,"size":1,"text":"Residue:"}]},{"head":"Weight and mea sures","index":4,"paragraphs":[{"index":1,"size":1,"text":"Cup:"},{"index":2,"size":2,"text":"Dessert Spoon:"},{"index":3,"size":1,"text":"Teaspoon:"},{"index":4,"size":5,"text":"5 'j, cups of water: "}]},{"head":"Problems in the processing of soybeans to food","index":5,"paragraphs":[{"index":1,"size":16,"text":"To produce a quality food product at household level che following problem s must be Qvercome:"},{"index":2,"size":34,"text":"• Eliminano n o f che beany flavour -The beany flavour is eaused when an enzyme (Iipoxyge nase) comes in comaet with che fat in the soybean eells in the presence of eold water."},{"index":3,"size":43,"text":"• Removal of f1 atul ence -F1atulence is caused by che presenee of oligosaechandes in all beans including soybeans and humans do not have galactosidase acnvity in the digesnve traet. However this effeet can be reduced wich heat trearment and by alkaline soaking"},{"index":4,"size":71,"text":"• Inaenvation o f che ann-nutrinonal faetors e.g. trypsin inbibitors can be des troyed wich moist heat. \\XIh en legumes are roasted des truenan of trypsin inhibitors are not complete, but roasting previously soaked soybeans can effect complete destruetion of anti nutrinonal factors. Also rapid destrucnon can take place if the soybeans was briefly boiled (20 -30 minutes), then soaked and chen cooked in water wich baking soda or soclium bicarbonate."},{"index":5,"size":28,"text":"• \\XIhen the soybea ns are cooked chese chemicals e.g. soclium bicarbonate che simmering water should be changed to allow the beans to simmer in clean wa ter."},{"index":6,"size":16,"text":"• Adclition of salt at the beginning of cooking soybeans will prolo ng che cooking time"}]},{"head":"Conversions","index":6,"paragraphs":[{"index":1,"size":42,"text":"As you have probably nonced by now, Kenya is ron on che metric sys tem. This sometimes makes it clifficult to figure out measurements and temperatures. Even cornmon food products have clifferent names. Here are a few guidelines to help you out.  "}]},{"head":"Solid measurements","index":7,"paragraphs":[]},{"head":"How to Shop Safely [or Perishable Food","index":8,"paragraphs":[{"index":1,"size":89,"text":"When shopping E or ra\\V and cooked perishable Eoods, be sure the fo od is being stored at a safe tempera tute in the store. Don't select perishable food from a non-refrigerated aisle display. Never choose packages which are tom or leaking. To guard against crosscontamination, put raw meat and poultry into a plastic bag so meat juices \\Von't drip on o ther foods, such as letruce and fruit that will be eaten raw. PUl refrigerated or frozen items in tbe shopping cart last, and take food home immediately."},{"index":2,"size":77,"text":"Ready-to-cat Foods When ordering food from the deJi department be sure the clerk washes his hands between handling raw and cooked items, or puts on new plastic gloves. Don't buy cooked ready-toea t items which are touching raw items or are displayed in the same case. Although the risk associated with foods [rom deJi counters is relatively low, persons at risk mal' choose to avoid these foods or thoroughly reheat luncheon meats and hot dogs before eating."},{"index":3,"size":45,"text":"Shelf-Stable Foods Don't purchase cans that are dented, leaking, or bulging; food in cracked glass jars; or [ood in tom packaging. Tamper-resistant safety seals should be intact. Safety buttons on metalJids should be down and should not move or rnake a clicking noise when pushed."},{"index":4,"size":40,"text":"Although product dating is not required by Federal regulations, observe any \"use-by\" dates found on products. Do nol use if beyond expiration date! Follow carefully the handling and preparation instructions on product labels to ensure tep quality and sa fety."}]},{"head":"Food Storage at Home","index":9,"paragraphs":[{"index":1,"size":34,"text":"lnunediately refrigerate or freeze perishabJe foods after transporting tbern horne. Use a refrigerator thermometer to be sure the refrigerator is cooling to 4 oC or below; the freezer should be at -17 c C."},{"index":2,"size":70,"text":"Refrigerator Make sure thawíng juices from meat and poultry do no t drip on other foods. Leave eggs in their carton for storage and don't place them in the door of the refrigerator. Keep the refrigerator elean. Store ground meat, poultry, and fish up to 1 or 2 days; other red meats, 3 to 5 days. After cooking, use within 3 to 4 da ys or freeze for longer storage."}]},{"head":"Freezer","index":10,"paragraphs":[{"index":1,"size":69,"text":"Food stored constantly at _17 c C will always be safe. Ooly the quality suffers with lengthy storage. Jt is of no concern if a product date expires while the product is frozen. Freezing keeps food safe by preventing the growth of microorgarusms that cause both food spoiJage and foodborne illness. Once thawed, however, these micro bes can again become active, so handle thawed items as any perishable food."},{"index":2,"size":89,"text":"Pantry (Food Store). Store canned foods and other shelf stable products in a cool, dry place. Never put them aboye the stove, under the sink, in a damp garage or basement, or any place exposed to h.igh or low temperature extremes. Store high acid foods such as toma toes and other fruit up to 18 mo nths; low acid foods such as mea t and vegetables, 2 to 5 years Food Handling At Home Food borne illness can be caused by improper food handling or preparation in the home."},{"index":3,"size":59,"text":"Wash, utensiJs, can openers, cutting boards, and countertops in hot, soapy water before and after coming in contact with raw meat, poultry, or fish. Wash kitchen towels and cloths often in hot water in a washing macrune. Wash hands with soap and warm water before and after handling Eood, and after using the bathroom, changing diapers, or handling pets."},{"index":4,"size":53,"text":"Eating Out Many cases of food borne illness are caused by restaurant, and take-out foods. People at u sk should avoid the same food s when eating out as they would at home. Meat, po ultry, and fish should be ordered \\Vel! done; if the food aruves undercooked, it should be cooked again"}]},{"head":"Cutting Boards","index":11,"paragraphs":[{"index":1,"size":24,"text":"Research shows that nonporous surfaces, such as plasric, marble, tempered glass, and pYIOcetatnlC are easier 10 clean than wood. Wood surfaces are considercd porous."},{"index":2,"size":56,"text":"Regardless of the type of cutting board you prefe.r, wood or a nonporous surface, consider using one for fresh produce and a separate one for raw meat, poult.ry, and seafood. This will prevent bacteria on a cutting board that is used for raw meat, poult.ry, or seafood from crosscontaminating a food that requ.i.res no further cooking."},{"index":3,"size":36,"text":"Cutring boards need ro be maintained and morutored for cleanliness. They should be washed with hot, soapy water. Solid hardwood cutting boards are dishwasher safe; however, wood lamina tes should nol be washed in the dishwasher."},{"index":4,"size":40,"text":"After thoroughly washing your cutting board, you can sarutize it with a solurion of 1 teaspoon chlorine bleach in a quart of water. Once cutting boards of any type become excessively woro or develop hard-ro-clean grooves, they should be ruscarded."}]},{"head":"Cookiug Food Safely","index":12,"paragraphs":[{"index":1,"size":77,"text":"Do not eat raw or undercooked meat, poult.ry, fish, or eggs. For people with ArOS, the mOSI important thiug is to use a food thermometer to be sure meat, fi sh, eggs, and stews reach at least 71°C. Roast whole poult.ry to 82 oC; poultry breasts to 77 oc. When reheating foods in the microwave, cover and rotate or sru foods once or twice during cooking and check !he food in several spots with a food thermometer."},{"index":2,"size":1,"text":"14 "}]},{"head":"PART 11: HYGIENE AND SANITATION","index":13,"paragraphs":[{"index":1,"size":45,"text":"Most cases o f food borne illness can be p revented if everyone who handles and prepare food leams about Bacteria and food handling. Bacteria is everywhere but ir can be stopped with Iittle as the know how of how to use water and soap."}]},{"head":"TO REDUCE FOODBORNE DISEASES THE FOLLOWING FACTS MUST BE LEARNED:","index":14,"paragraphs":[{"index":1,"size":17,"text":"1. Bacteria are a part of al! living things and are found on all raw agriculrural products;"},{"index":2,"size":19,"text":"2. Harrnful bacteria can be transferred from food to people, people onto food, or from one foad to another;"},{"index":3,"size":8,"text":"3. Bacteria can grow rapidly at room temperature;"},{"index":4,"size":21,"text":"4. Growth of harmful bacteria in food can be slowed or stopped by refrigerating or freezing (explain alternatives at village level);"},{"index":5,"size":27,"text":"5. Food borne illness can produce syrnptoms from rnild to very se!lous. IUness can oeeur from 30 minutes to two weeks after eating food conraining harmful bacteria;"},{"index":6,"size":25,"text":"6. People who are most likely to beeome siek from food-related illness are infants and young ehildren, senior eitizens and people \\\\~th weakened immune systems."},{"index":7,"size":15,"text":"There are FOUR simple steps to fight bacteria. These are CLEAN, SEPARATE, COOK AND CHILL"},{"index":8,"size":45,"text":"• Clean -wash hands, utensils and surfaees in hot soapy water befare and after food preparation, and espeeiaUy after preparillg meat etc. Using a disinfeetant cleaner or a mixture of bleaeh and water on sutfaces and antibacterial soap on hands can provide sorne added proteetion."},{"index":9,"size":24,"text":"• Separare -Keep raw meat etc away from ready-ro-eat foods; never place eooked food on a plate chat pre'~ou sly helps raw meat, etc."},{"index":10,"size":26,"text":"• Cook -Cook food to the proper temperarure and check for doneness ,vith a food thermometer. Cook eggs until both the yolk and wrute are firmo"},{"index":11,"size":38,"text":"• Chill -Refrigerate or freeze perishables, prepared food and leftovers within !\\vo hours and make sure that the refrigerator is set at no rugher than 4 degree, Centigrade and that the freezer unit is set at -18 Centigrade."}]},{"head":"Proper hand-washing","index":15,"paragraphs":[{"index":1,"size":27,"text":"Hand washing should ideaUy be washed with soap under running water. Rubbing hands vigorously 15-20 seconds until a soapy lather appears and serubbing between fingers and fingemails."},{"index":2,"size":38,"text":"\\Vhere there's no water system running water can be organized by using a water butt ,vith a tapo If there is a shortage of water, using soap with a smaD guantity of water in a bowl is adeguate."},{"index":3,"size":5,"text":"Washing hands should be done "}]},{"head":"Method","index":16,"paragraphs":[{"index":1,"size":10,"text":"• Remove stones, damaged beans and any other foreign materials"},{"index":2,"size":21,"text":"• Add soybeans to boiling water to which bicarbonate of soda is added and allow to boil* fO! 25 -30 minutes."},{"index":3,"size":6,"text":"• Dehull beans and drain properly."},{"index":4,"size":20,"text":"• Dry beans in the sun / oven at low meruum setting (where possible fust air cIry beans under fan)"},{"index":5,"size":11,"text":"• Grind into flour, sieve and package or use as desired."},{"index":6,"size":29,"text":"* Soaking of soybean for 8 -10 hours, can be done before boiling fo! the basic methods in which case the boiling time may be reduced by few minutes."},{"index":7,"size":9,"text":"It must be noted that boiling is very essential."}]},{"head":"EXAMPLES OF PRODUCTS MAnE FROM SOYMILK","index":17,"paragraphs":[{"index":1,"size":36,"text":"1. Making Soyrnilk Soaking soybeans, grinding them with water, makes soymilk. The fluid which results after straining is called soymilk. You can rnake soymilk at home with basic kitchen tools or wirh a soymilk machi ne."},{"index":2,"size":55,"text":"Traditionally, soym.ilk has a beany taste which is well accepted by the users. By using correct processing techniques, rhis beany taste can be reduced or e1iminated. Recently, with many new uses for soym.ilk having been discovered, the recognition oE soymilk's healrh benefits and with improved flavor and textute, soymilk now has wide and cising acceptance."}]},{"head":"Nutritional Values of Soymilk","index":18,"paragraphs":[{"index":1,"size":51,"text":"Plain soymilk is very nutritious: [t is an exceUem source o f high quality proteins, ¡soflavones and B-Vitamins. Soym.ilk is free of the milk sugar (Iactose) and is a good choice Eor people who are lactose imoleram. Also, soymilk is a good alternative for those who are allergic to CDW'S milk."}]},{"head":"Instructions before making milk","index":19,"paragraphs":[{"index":1,"size":99,"text":"Inspect Soybeans and son discarding ¡he bad ones , check fo reign marters rhoroughl y. Was h them at leasr 4 times or until the water is deao. Soak the beaos io warer ovemight (or at least 8 ro 10 hours). They should be soft, swollen and grindabl e. Agaio was h and insp ect, removing any unswollen ones. Grind in a blender with 2 to 3 cups o f water, then sieve through a very thin doth. Repeat this grinding and sieving pro ces s adding 2 to 3 cups warer ea eh time until you are through."},{"index":2,"size":32,"text":"Add your fiavour i.e. little salt, honey, vanilla, if you wish. Bring it ro b oil for about 10 minutes. The milk stays good for a few days (3) in the refrigeraror."},{"index":3,"size":41,"text":"Many people find the cast o f commercial soymilk to be prohibitive and make soymilk at home. Soymilk can be made at hom e by soaking and crushing Soybeans using tradicional stone grindings, traditional blender and electrical blender as the tools."},{"index":4,"size":5,"text":"How do we make soymilk?"},{"index":5,"size":2,"text":"Melhod 1"},{"index":6,"size":29,"text":"Step 1: Ingredients You need about 125g WhoJe soybeans to make 1 litre o f soymilk. Therefore approximately 1 kilo of soybeans gives 5 litres o f soy milk."},{"index":7,"size":17,"text":"Step 2: Soaking the soybeans Clean the soybeans and soak them in warer for 8 -10 hours"},{"index":8,"size":22,"text":"Step 3: Heating tbe soybeans (optiona1l To remo ve the beany raste -oil the beans in clean water for about 10 minutes."},{"index":9,"size":41,"text":"Step 4: Grinding Ihe soybeans Grind the soaked soybeans either using the electrical blender, or tradicional stone grinding / traditional blender in warm water. Mix with water in a blender. Sieve the mixture through a clean cloth and recover the soymilk."},{"index":10,"size":58,"text":"The insoluble material which remains on the sieve is called okara, and can be used as an ingredient for cooking ugali by mixing ,,>ith maíze fiour, porridge mixing with millet, or chapa tos mixing with wheat flour. (Note: before )'ou mix okara with other flour, allow the okara tO boj] / cook for about 10 minutes, then mix)"},{"index":11,"size":36,"text":"Step 5: Boiling the soymilk Heat the soyrnilk till boiling point and continue boiling for about 5 to 10 minutes. Afrer cooling, the soyrnilk is ready and can be kept in the frielge for 3 days."},{"index":12,"size":35,"text":"Step 6: Flavouring the soymilk (optional} The soyrnilk can be drunk as such but taste can be improved by adding sorne salt (also cow milk COntains a lot of salt), sorne little honey or molasses."},{"index":13,"size":1,"text":"Requiremeots:"},{"index":14,"size":27,"text":"3 '/2 cups so)'beans (500g) Note: The use of elean drinking water for grincling and sieving is essenrial so as to avoid contaminarion of milk at source."}]},{"head":"Metbod III","index":20,"paragraphs":[{"index":1,"size":10,"text":"1. Soak beans in cold water for about one hour."},{"index":2,"size":41,"text":"2. Drain off water and dehull beans 3. Put enough water ro cover beans on f!re, allow to boil and add the bicarbonate o f soda 4. Put dehulled beans in the boiling water and allo\\V to boil for 10-15 minutes."},{"index":3,"size":14,"text":"5. Blend irnmecliately and conrinue with the same procedure as in Method 1 above."}]},{"head":"COMMERCIAL SOYMILK MAKING","index":21,"paragraphs":[{"index":1,"size":82,"text":"The VitaGoat system allows villagers to preserve their extra produce without relying on electricity. The device uses a bicyele-powered grinder and wide varie!)' of locally available fuels to prepare protein-rich soymilk, soy yogUrI, tofu, and nut butters, as weU as fruit and vegetable purees and energy drinks. VitaGoat users fust apply pedal-power to grind soybeans, cereals, fruits, or vegeta bies at arate that is lOto 50 rimes faster tl1an handgrinding. This process alone produces flours, pastes, nut butters, and even ground coffee."},{"index":2,"size":73,"text":"For foods that reguire cooking, users then feed VitaGoat's steam boiler with wood, coal, gas, or even dung chips. The boiler, which is 10 times more efficient than open-fue cooking, injects stearo into a 15-liter vessel, where cooking under pressure saves both time and fue!. A fmal fearute of the VitaGoat is a hand-operated screw-press that can be used to extrude liguid out of cooked proteins for products like tofu and soy yogurt."},{"index":3,"size":29,"text":"The VitaGoat has four main components although one of these, the bicycle grinder, can be used on irs own in situations where only dry foods are processed without cooking."},{"index":4,"size":102,"text":"Steam boiler: Operating on either wood or other hard fuels ar liquid gas, ¡he boiler is estimated to be 10 times mare fuel efficient than uaditional open fue cooking and more efficient than improved stove-design cooking. Water is heated in an innee chamber and me resulting steam is re-heated in a tube, creating a \"superheated steam\" that is much hotter than regular steam. The boiler is inexpensive to build, safe, and can be taken apart for cleaning. This latter fealure is critical since most boilers accwnulate scale on their inner shells and eventuaUy fail. Guidelines in operating a boiler are as follows:"},{"index":5,"size":11,"text":"• Keep boiler full of water when not using. (reduces rusting)"},{"index":6,"size":19,"text":"• After filling a cold boiler, release unwanted air pressure by briefly opening steam valves on boiler and cooker."},{"index":7,"size":25,"text":"• Always blow-down (empty) the hot boiler at the end of the day and refill with water befare quirting. Open blow-down valve carefully and slowly."},{"index":8,"size":38,"text":"• Never leave a hot boiler to cool completely without blowing down and refilling. This can cause a vacuwn which can damage the pressure gauge ot food or wash water to be sucked inro the boiler from cooker."},{"index":9,"size":19,"text":"• Keep the boiler pressure above 25 Psi and below 80 Psi when nonnally producing steam for the cooker."},{"index":10,"size":35,"text":"• Sorne safety telease val ves are set ro 90 Psi and SOrne are higher. Confinn the setting on your safety valve. Make sure release valve is connected to a pipe and away from operarors."},{"index":11,"size":34,"text":"• If pressure approaches 90 Psi make sure steam valves are open on both boiler and cooker. If that does nor reduce the pressure, let some water slowly out of the blow down valve."},{"index":12,"size":39,"text":"• If the safety re1ease valve opens, do not panic about the extra noise. Ir \\Viii clase by itself when it has released enough steam pressure. This is a normal and safe event bur should be avoided if possible."},{"index":13,"size":18,"text":"• Keep at least a medium size fue going al! times unless ir is clase to quitting time."},{"index":14,"size":114,"text":"Keep sorne water visible in the sight glass. FiII boiler when water drops below the bottom of the glass. Do not fill the boiler above the top of the glass Cooker: Made from stainless steel, this vessel can cook up to 15 liters of food per batch, under pressure, thus greatly reducing cooking time and saving fue!. lt is equipped \"\"\"th temperature and pressure gauges and a saEety pressure relief valve. Product is Eed through an easily removable top opening and steam enters the vessel through openings located on the bottom oE the vesse!. Cooked product exits the cooker through a valve controiled bottom opening. Guidelines in operating a cooker are as foll ows:"},{"index":15,"size":20,"text":"• Maximum capacity is 15 litres. For soymilk 12 litres oE water combined with mashed soybean. Mix before loading cooker."},{"index":16,"size":22,"text":"• Cook soymilk up to 11 0 degrees centigrade then close steam valve and release cooked product in one or two minutes"},{"index":17,"size":22,"text":"• Cook fruit and vegetable purees, soups, sauces etc up to 100 degrees centigrade then close steam valve and release cooked product."},{"index":18,"size":22,"text":"• Never let the cooker pressure rise above 30 Psi. At 40 Psi the saEety release valve will open-releasing hot food product."},{"index":19,"size":46,"text":"• If the pressure gauge shows any pressure when the temperature is belo\\\\' 90 degrees centigrade, gently push the small Ht pin button on the top of the cooker (use a spoon or tool) . TIlls willlet unwanted air pressure out and let steam pressure build"},{"index":20,"size":47,"text":"• For soymilk production: iE the press ure gauge reaches 30 psi but the temperature has no t reachedl 1 O degrees centígrade, simply close the steam valve and wait a few minutes before releasing the Eood. Tms should never happen iE the previous rule is followed."},{"index":21,"size":44,"text":"• When releasing cooked food, open the main valve very slowly at first-then open it enough to allow a continuous flow. Neve! open the valve fuUy under pressure until the end (tO be sure ail the product is out.) Close valve irrunediately after emptying."},{"index":22,"size":23,"text":"• Be prepared to partíaily or fuUy close the steam valve iE the boiler pressure tlrops below 25 Psi. Resume after boiler rises."},{"index":23,"size":45,"text":"• For cleaning: Wash underside of lid sideways without turning upside down . Keep the two openings clear oE Eood. Inside oE cooker can be soaked Mth cool water and then washed Mth a mild detergent and water. Use a long brush through the outlet."},{"index":24,"size":21,"text":"• Make sure steam valve is closed to prevent wash water being sucked into boiler from possible vacuum in cooling boiler."},{"index":25,"size":30,"text":"yoghurt maker eups and foUow the same direerions as fO! dairy yoghurt. If you don't have a yoghurt machine you can put the yoghurt in an oven at 42 -4S0C."},{"index":26,"size":13,"text":"After about 5 -6 hours, when the yoghurt gets finn, ehill the yoghurt."}]},{"head":"Making Ibe soy yoghurt Ibicker","index":22,"paragraphs":[{"index":1,"size":46,"text":"You will norice that home made yoghurt will be a little runnier than dairy yoghurt. To improve the truekness of the soy yoghurt you can add one leve! teaspoon of agar powder, which is premixed in SOm! wa ter, to the soymilk when ir sratts boiling."},{"index":2,"size":30,"text":"You can also use eom starch ot arrowroot as a thiekenet. Disperse 2 teaspoon of starch in 30m! eold water and add this mixture to the soymil.k just before boiling."},{"index":3,"size":14,"text":"Leading eornmercial Dames have very good Jive culture and is available in super markets."},{"index":4,"size":11,"text":"Buy the one inrueated 'NATURAL YOGHURT and mix with your milk)."}]},{"head":"Soy Cassava Bites","index":23,"paragraphs":[{"index":1,"size":1,"text":"Ingredienls:"},{"index":2,"size":1,"text":"3 "}]},{"head":"Tofu","index":24,"paragraphs":[{"index":1,"size":52,"text":"T his is the most widely consumed soyfood in the world today. This so ft, white, almost cheese like product is favoured for its versatility, mild flavour, and high nutritional value. lt is natural!y p rocessed from whole soybeans and, as a result, rerains a good deal of the soybean's important nutrients."},{"index":2,"size":23,"text":"Method 1. Take fresh soyrnilk while still hot, at a temperature berween 80-85C, and place in a large pot that has a cover."},{"index":3,"size":45,"text":"2. Prepare a coaguIant of 0.5 litres of Calcium or magnesium Chloride or Calcium or Magnesium Sulfate at 10% strength (this is based on a soymilk batch o f ap prox. 15 liters). This is equivalent to approx. 4 Thsp (60rnL) or food grade powder."},{"index":4,"size":10,"text":"Altematively, a 9% Acetic acid(vinegar) solucio n can be used. "}]},{"head":"Recipe DirectioDs","index":25,"paragraphs":[{"index":1,"size":37,"text":"In a pan melt (he margarine and add the sugar / honey, cinnamo n and apples. Cook over medium heat during 5 minutes, or until the apples are a bit so ft (but no t too soft)."},{"index":2,"size":25,"text":"In a bowl, mi..\" the w hea t lIour with the baking powder. Add the eggs and soymilk. Beat until you get a smooth butter."},{"index":3,"size":42,"text":"Put the apple mixture in an oven pan. P our the butter evenly over the apples. Place uncovered in a prehea ted ove n ro 22 degrees centigrade (425 degrees Fahrenheit). Bake during about 15 minutes until the apple pancake is golden."},{"index":4,"size":32,"text":"Decorate the apple pancake with sifted powdered sugar and serve it innmediately. In a bowl, combine the wheat flour, baking powder, sugar, nutrneg and cinnamon. Make sure that there are no clumps."}]},{"head":"Pumpkin Pancakes","index":26,"paragraphs":[{"index":1,"size":16,"text":"In another bowl, combine the pumpkin, eggs, soy milk, oil and va nilla extrae!. Beat well."},{"index":2,"size":11,"text":"Add the dry ingredients from the other bowl and beat well."},{"index":3,"size":60,"text":"Pre-heat a greased paneake pan over a medium heat. Pour t\\Vo or rhree tablespoons of butter in the pan to form a paneake. Bake eaeh side about one minute or unril slightly browned. Serve the pumpkin paneake with brown sugar or with honey. 5. Mix together with the wann water .nd beat very well lUltil smooth and free from lumps."}]},{"head":"Soy Potato Pancakes","index":27,"paragraphs":[{"index":1,"size":66,"text":"6. Cover mixture with a clean cloth .nd put in a warm place to rise (about 2 hrs) 7. Heat the oil .nd fry mixture in spoonfuls until golden brown.  12. Slowly roro the ja! upside down, so that any bacteria on the lid O! in the space at the • top of the jar are killed. Leave the jar upside down until it is cold."},{"index":2,"size":48,"text":"13. When the jars are cold, test each lid to make sure ir ha s a good seal. If the curd is o f good quality (dear curd clumps have formed with a yellowish-greenish liquid between them), then cover the vessel and allow eo stand for 10 minutes."}]},{"head":"Soy Potato Cake","index":28,"paragraphs":[{"index":1,"size":27,"text":"If the curd formacion is weak, add the remaining coagolant solucion and stir 2-3 times very gently. Cover the vessel and allow to stand for 10 minutes."},{"index":2,"size":20,"text":"5. The coagulation process is complete when large curd pie ces or thkes float in a light yellow transparent whey."},{"index":3,"size":87,"text":"6. Remove most of the whey by using a colander and a laelle (the whey can be kept as an excellent cleaner for the system) and transfer the remaining curd to a cheeseclothed lined pressing box. 7. For soft tofu, press for 30-60 minutes with a 5 kg load; For finn tofu, press for 60-90 minutes with a 10 kg load. Note though that the relative firmness of the tofu also depends on type of coagulant used, coagulation temperature and the protein level of the soyrnilk base."},{"index":4,"size":51,"text":"8. Cut the pressed tofu into 6-8 blocks and cool in water for 60-90 minutes, preferably with water circulation. This cames away most of the coagulant flavoUIs that remain in the tofu. It also improves the shelf life. 9. Refrigerate any portions that will remain unused for more than 4 hours."}]},{"head":"Soy Food Mixes","index":29,"paragraphs":[{"index":1,"size":1,"text":"Ingredients:"},{"index":2,"size":53,"text":"1 Cup steamed soy paste 3 cups cooked mashed rice / cooked mashed yam / cooked mashed insh or sweet pota toes.  Ugali is generally bland and ís served wirh vegetable relish and/ or stew. Roasted meat with Ugali .nd tos sed salad is a delicacy. The dish is quick ro prepare .. "}]}],"figures":[{"text":" Abbreviation dsp tsp "},{"text":" cup bucter, sugar, or rice = 8 ounces = about 250 gram s 1 cup fl oue = 4 ounces = about 125 grams 1 cup powdered sugar = 5 ounces = abour 150 grams "},{"text":" the eassava flour with the wa ter.2. Make soy flour into smooth truek paste using par! of the miJk and mix with the \\Ve! gamo 3. Add salt, sugar and pepper. 4. Bea! in the egg (if used) 5. Add soy milk to bring mixture to a soft dough.6. Using a spoon, pUl mixture into hOI oi!little al a time and fry. the ingreruents. Melt sorne baking oi! (olive / sunflower or any good oil) in a pan and prehear. Pour '/2 cup of bulter in the pan and bake both sides until golden brown. "},{"text":"3. Stir the soymilk and sprinkle 2/3 of the coagulant on the surface of the soymilk. Stir 2-3 times in the opposite direction to ensure that the coagulant is well dispersed in the soymilk. Cover the vessel; with the lid. 4. Let stand for 5 minutes, then lift the cover and break the upper layer slowly to check "},{"text":" flour with the baking powder and salt. Add the potato, soymilk, soybean oil, eggs and mix all together to form the butter. Put rhree tablespoon o f the butter in a greased pan, form pancakes and bake on medium heat unril the paneakes are golden brown and slightly firmo Serve the pa tato pancakes immediately. Sift wheat flour and soy flOUI together in a bowl.2. Add sugar, salt and nutmeg 3. Beat in the egg with the milk 4. .lVUx together to a non -sticky texture 5. Roll out thinly. Cut into desired shapes 6. Fry in ho t oí! and drain 7. Serve or store in an air-flour into dry bowl 2. Add salt and part of sugar 3. Cream the yeast with little of the sugar and mix with w.nn milk 4. M.ke a well in the centre of the dry ingredients in the bowl and pour In the liquid mixture. "},{"text":" doughnut. Mandazi are made [rom dough of a mixture of flour and baking powder. The dough is rolled out, cut into sbapes and deep the water to boil and dissolve the sugar in it 2. While stirring, sprinkle so)' flour into the water .nd stir to mix thorough1y 3. Simmer for five minutes stirring all ¡he time 4. Remove from fue and cool to room temper.ture 5. Sift flour and baking powder together and add to the soy sugar mixture. Mix everything in pliable dough 6. Knead the dough well 7. Roll the dough out to about 1 em rhiekness 8. Cut into desired shapes ( circles or squaIes OI triangles) 9. Deep fry the rounds/sqllilres or triangles in hot fat for about 10 minutes 10. Serve hot or cold Accompaniments: Tea coffee cocoa or any other beverage the wheat flOOI and the soy flOUI together in a clean bowl 2. Add water to the flOUI and Imead the dough well. 3. Roll the dough out ro about 1 cm thiclmess 4. Cook fOI 5-10 minutes until brown. / honey with the rnargarine unril crearny. Add the soy pulp, salt, soy milk and the egg. Mix very well. Finally add the fiour, oat fiakes and baking powder. Put srnall heaps of the dough on an greased plate and bake about 12 minutes in an oven (180°C) To glaze: 1 egg 1 leve! teaspoon 1 table spoon sugar 1 tablespoon water Method 1. Blend one tea spoon sugar with wann water 2. Sprinkle the yeast on top and leave for ten minutes or until the yeast froth s then whisk or stU. If using ascorbic acid tablet dissolve it in the wann yeast liquid 3. Mix the salt, temaining sugar and floU! in a large wann mixing bowl 4. Rub in the fal. Make a well in the centre of the floU! mixture 5. Add the yeast Jiquid and into the well and blend with a wooden spoon or fork. Work to a finn dough. (The dough is the right consistency when it does nit stick to the bowl 6. Turn onto a floured bored and koead until well pressed with a Jightiy floured finger, it springs back and tile in1pression disappears. Do not over koead the dough. "},{"text":" Ingredients 1 big or 2 m ediurn sized sweet potatoes (about lkg) 1 '/2 cups soy milk 1 dsp. Sugar Or 3 lumps of sugar (opcio nal) cooked, peel and rub through a sieve, add salt 3. Mix with soy milk, sugar (if used) and margarine 4. Bake in a moderate oven for about 30 minutes Soy mix Ilours Ingredients 1 cup steamed soy paste 3 cups cooked mashed rice/ cooked mashed mo or sweet potatoes 4dsp vegetable oil 2~;' cups o f water 2 fU1 ely chopped toma toes 2 dsp chopped onions 2 dsp finely ground debo ned dry fish 1 dsp finely chopped vegeta bi es Salt to taste Method 4. Add steamed soy paste to any of the above chosen food and mix with water S. Warm the oil and fry slightly the chopped toma toes and onions 6. Add the oi! to the soy mixture and put on the fue 7. Cook for about five minutes 8. Add the ground crayfish or ground fish together wieh fned ingreclients. Add solt to taste Tofu TlUs is the most widely consumed soyfood in the world today. TlUs soft, wmte, almost cheese like produce is favoured for irs versatility, mild flavour, and mgh nutririonol value. It is naturaJIy processed from whole soybeans and, as a result, retains a good deal of the soybean's impo rtant nutrients. Method 1. Take fresh soymilk while still hot, at a temperature between 80-85C, and place in a large pot that has a caver. 2. Prepare a coagulant of 0.5 litres of Calcium or magnesium Chlonde or Calcium or Magnesium Sulfate ae 10% strength (tms is bascd on a soymilk batch of approx. 15 liters). Tms is equivalent to approx. 4 Tbsp (60rnL) or food grade powder. Altemarively, a 9% Acecic acid(vinegar) solurion can be used. 3. Stir the soymilk and sprinkle 2/3 of the caagulant on the surface of the soymilk. Stir 2-3 times in the opposite clireccion to ensure that the coagulant is well clispersed in the soymilk. Cover the vessel; with the lid. 4. Let stand for 5 minutes, then lift the cover and break the upper layer slowly to check curd informaríon. "},{"text":" stearned soy paste to any of the above chosen foods and mix with the water.2. Warm the oil and fry slightly the chopped tomatoes and omon. "},{"text":" 3. Add the oil to the soy mi.\"ture and put 011 the fue.4. Cook for about 5 minutesSoy UgaliUgali ís the most widely eaten dish in Kenya. It ís stiff cooked rnL'Cture (somerhing like dough) of water and maize meal or maize meal and milletl sorghum flour.Ho\\Vever maíze meal ís rhe mosr commonJy used. "},{"text":"Ingredients1 cup of warer 2 cups maize meal (or rnL'[ture o f maize meal with wimbi or sorghum or cassava flour y, cup raw soy flour Method 1. Bring the water t boil 2. \\X'hile stirring, sprinkle th e raw soy flour into rhe boiling water and simmer for 2 nunutes 3. Increase hea t and add maize meal 4. Using a wooden spoon, stir vigorously until a smooth stiff rnL'ture is achieved 5. Reduce heat and cook fo r 10-25 minutes stirring occasionally 6. Mould Ugali into cake-like shape by drawing the mixture toge ther 7. TUfn on ro a piare and shape as desired 8. Serve hot Accompanirnents: Vegerable, sauce Variation: Maize meal can be mixed with wimbi or sorghum or cassava E/our: the rate of 1 part f10ur to 2 parts maize meal Soy-Wimbi Ugali Maize meal ugali \\Vas discussed earlier. In wimbi ugali, finger millet Oour is mixed ,,~th maize meal ugali. OthetWÍse the preparation and the procedure is the same as rhar of maize me al ugali. Ugali is popular in Wesrern Kenya. stirring, sprinkle soy flour into the boiling water. Cook for about 2 minutes 3. lncrease heat and add wimbi flour. Stir vigorously until a smooth stiff mixture free of lumps is attained. 4. Reduce heat and cook for 10-25 minutes stirring occasionally 5. Mould Ugali into cake-like shape by drawing the mixture together 6. Turn on to a plate and shape as desired 7. Serve hot Soy Nuts Soy nuts are made from whole soybeans wmch have been soaked in water and then baked until crisp and brown. Soy nuts are similar in texture and flavour to peanuts. Soy nuts can be found in different flavours, such as salt or paprika. Soy nuts are easily made at home by soaking dry soybeans in enough water to cover for three hours. Then drain and spread the soy nuts in one layer on a weU-oiled cookie sheet. Roast at 350°F (190°C), stirring often, until well-browned. Salt to taste and store the soy nuts in an airright container. Nutritional values oC soy nuts (per lOOg salted soy nuts): "},{"text":"TABLE OF CONTENTS  INTRODUCTION INTRODUCTION Soybean processing and utiliza non : The way 10 good health! Soybean processing and utiliza non : The way 10 good health! General Informanon General Informanon Weighl and measutes Weighl and measutes Abbrevianon Abbrevianon  "},{"text":" Certain types oE Eood borne illness are caused by bacteria which can grow on Eood. The bacteria can inEect humans when the Eood is improperly handled or inadequately eooked. As with many other types oE inEeetions, persons with AIDS are at higher risk Eor developing severe iIlness or dying Erom these illnesses. Three types oE bacteria are oE particular concern Listeriosis is caused by Lis/eria monocylogenes which can be found on many different types of food. Uft,ria infecrions are much m ore cornmon in persons with AIDS than healthy peopIe. Emergency Substitutions Food Safety for People Living with HIV / AIDS (PL W1:lA) Emergency Substitutions Food Safety for People Living with HIV / AIDS (PL W1:lA) If rou don't have: Persons with Acquired Irnmunodeficiency Syndrome (AIDS) are susceptible to many types substitute If rou don't have: Persons with Acquired Irnmunodeficiency Syndrome (AIDS) are susceptible to many types substitute Baking Powder, 1 tsp. oE inEection including illness Erom Eood borne pathogens. They are at higher risk than are 1 tsp. Cream of tartar 1/4tsp. Baking soda us/eria infecrions in AJOS patients are usually severe and are often fatal. us/,ria monocy/ogenes Baking Powder, 1 tsp. oE inEection including illness Erom Eood borne pathogens. They are at higher risk than are 1 tsp. Cream of tartar 1/4tsp. Baking soda us/eria infecrions in AJOS patients are usually severe and are often fatal. us/,ria monocy/ogenes Buttermilk, 1 cup otherwise healthy individuals E or severe iIlness or death. AEEected persons must be espeeially 1 tbs, lemon juice or vinegar plus enough milk can be acquired from a variety of foods including soft cheeses that are unpasteurized and Buttermilk, 1 cup otherwise healthy individuals E or severe iIlness or death. AEEected persons must be espeeially 1 tbs, lemon juice or vinegar plus enough milk can be acquired from a variety of foods including soft cheeses that are unpasteurized and 1 cupo Let stand 5 min before using. vigilant when handling and cooking Eoods. The reeornmendations provided here are some ready-to-eat E oods such as ho t dogs or REARY-TO-EAT meats. 1 cupo Let stand 5 min before using. vigilant when handling and cooking Eoods. The reeornmendations provided here are some ready-to-eat E oods such as ho t dogs or REARY-TO-EAT meats. Brown Sugar, 1 cup designed to help prevent baeterial Eood borne illness. 1 cup wrute sugar plus 1 tbs honel' Brown Sugar, 1 cup designed to help prevent baeterial Eood borne illness. 1 cup wrute sugar plus 1 tbs honel' Chocolate, w1sweetened l ance How Can Persons with AIDS Prevent Food borne Illness? 3 Ths cocoa powder plus 1 Ths. oil Chocolate, w1sweetened l ance How Can Persons with AIDS Prevent Food borne Illness? 3 Ths cocoa powder plus 1 Ths. oil Corostarch, 1 Ths. Why Do Bacteria Endanger People with AlDS? 2 Ths flour Food must be handled sa fely at every stage from purchase through consumption. Critical Corostarch, 1 Ths. Why Do Bacteria Endanger People with AlDS? 2 Ths flour Food must be handled sa fely at every stage from purchase through consumption. Critical Coro Syrup, 1 cup When the AIDS virus damages or destroys the body' s irnmune system, the person becomes 1 cup wrute sugar plus 1/, cup water points are transporting perishable foods home from the store irnmediately; prompt, safe Coro Syrup, 1 cup When the AIDS virus damages or destroys the body' s irnmune system, the person becomes 1 cup wrute sugar plus 1/, cup water points are transporting perishable foods home from the store irnmediately; prompt, safe Egg,1 whole more vulnerable to infection by Eood borne bacteria and other pathogens. For example, the / 4tsp.baking powder plus 2 Ths Appropriate storage; thorough cooking te destroy bacteria and other pathogens; and prompt refrigeration Egg,1 whole more vulnerable to infection by Eood borne bacteria and other pathogens. For example, the / 4tsp.baking powder plus 2 Ths Appropriate storage; thorough cooking te destroy bacteria and other pathogens; and prompt refrigeration iquid milk, water or broth) eornmon pneumonia, whieh is caused by a bacterial inEeetion oE the lungs, can oeeur in any of leftovers. iquid milk, water or broth) eornmon pneumonia, whieh is caused by a bacterial inEeetion oE the lungs, can oeeur in any of leftovers. Garhc, 1 clave individual but occurs mueh more &equently in persons with AIDS. In addition, when /8tsp. garhc powder Garhc, 1 clave individual but occurs mueh more &equently in persons with AIDS. In addition, when /8tsp. garhc powder Ginger root, grated 1 tsp. pneumorua strikes a person with AIDS, it causes a more severe iIlness and is thus more / 4tsp. ground powder Ginger root, grated 1 tsp. pneumorua strikes a person with AIDS, it causes a more severe iIlness and is thus more / 4tsp. ground powder Ho ney, 1 cup dangerous. 1/. cup wrute sugar plus 1 /, cup water Ho ney, 1 cup dangerous.1/. cup wrute sugar plus 1 /, cup water Light Cream (half & h.llf) 1 cup What Types ofFoodbome Bacteria are ofParticular Concero to Persons with AlDS? 1 Ths melted margarine plus enough whole Light Cream (half & h.llf) 1 cup What Types ofFoodbome Bacteria are ofParticular Concero to Persons with AlDS? 1 Ths melted margarine plus enough whole  milk to make 1 cup milk to make 1 cup Lemon Juice, 1 tSp. 1/ . tsp vinegar Lemon Juice, 1 tSp.1/ . tsp vinegar rvWk , l cup 1 12 cup evaporared milk plus 1 12 cup water rvWk , l cup1 12 cup evaporared milk plus 1 12 cup water Molasses Eor persons with A1DS: So/mol/ella, Campy/obacter jejuni, and U steria lJIonocylogenes. Honey Molasses Eor persons with A1DS: So/mol/ella, Campy/obacter jejuni, and U steria lJIonocylogenes. Honey Mustard, dry 1 tsp. 1 Ths prepared mustard Mustard, dry 1 tsp.1 Ths prepared mustard Ouion, chopped 1 smaU SalmoneUa bacteria are the most cornmon cause oE Eood borne illness. The bacteria are 1 tsp. ouion powder or 1 Tbs dried minced Ouion, chopped 1 smaU SalmoneUa bacteria are the most cornmon cause oE Eood borne illness. The bacteria are 1 tsp. ouion powder or 1 Tbs dried minced oman cornmonly Eound on raw or undereooked meats (especially poultry) and can be found in eggs oman cornmonly Eound on raw or undereooked meats (especially poultry) and can be found in eggs Source Crea m even before they are cracked open. Salmondlosis can affeet anyone, but occurs almost tOO Plain yogurt or the Chambiko cultured milk Source Crea m even before they are cracked open. Salmondlosis can affeet anyone, but occurs almost tOO Plain yogurt or the Chambiko cultured milk Product (in the yeUow bag)o When strained times more frequently in persons with AIDS than in o therwise healthy persons. Product (in the yeUow bag)o When strained times more frequently in persons with AIDS than in o therwise healthy persons. through Cheese c1oth, it's just like sour cream. Furthermore, Sa/monella inEcctions, which occur in persoDs with AIDS, can be parriculatly through Cheese c1oth, it's just like sour cream. Furthermore, Sa/monella inEcctions, which occur in persoDs with AIDS, can be parriculatly Sugar,1 cup difficult to treat and are more likely to lead to D EATl-J. 1 cup brown sugar or 2 cups sifted powdered Sugar,1 cup difficult to treat and are more likely to lead to D EATl-J. 1 cup brown sugar or 2 cups sifted powdered  sugar sugar Tomato J uice, 1 cup Illnes s from Campylobacter jejuni is also caused by bacteria that can somerimes be found '12 cup tomato sauce plus '/, cup water Tomato J uice, 1 cup Illnes s from Campylobacter jejuni is also caused by bacteria that can somerimes be found '12 cup tomato sauce plus '/, cup water Tomato Puree, on food, especially raw poultry. This illness occurs about 35 rimes more frequently in 1 Ths 1 Ths. ketchup Tomato Puree, on food, especially raw poultry. This illness occurs about 35 rimes more frequently in 1 Ths 1 Ths. ketchup Tomato Puree, 1 cup persons with AIDS than in othenvise healthy persons. Many persons contraet t.his form oE 1 Ths. tomato paste plus enough water to Tomato Puree, 1 cup persons with AIDS than in othenvise healthy persons. Many persons contraet t.his form oE 1 Ths. tomato paste plus enough water to make 1 cup Eood poisoning by improperly handling or cooking poultry. Raw miJk and contamina ted make 1 cup Eood poisoning by improperly handling or cooking poultry. Raw miJk and contamina ted drinking water can al sa be sources of Camp)'/obacter infectians. drinking water can al sa be sources of Camp)'/obacter infectians.  "},{"text":"Never leave perishable Cood out oC refrigeratioo )ooger tbao 2 hours, 1 hour in air tem peratures ahoye 32°C SaCe Handling oC LeftoversBacteria begin to mulciply rapidly in the \"danger zone\" between 4°C (recommended , refrigerator temperarure) and 60°C. Therefore, bacteria on food left out at room temperarure will become unsafe in a matter of hours. Refrigerate leftovers at 4°C or below or freeze (-1 8 oC) as soon as possible. .Oi,,~de leftovers into shallow containers. This encourages rapid, even cooling. Cover with airtight lids or endose in plas cic wraps or aluminum foil. Use leftovers within 3 to 4 days • • 1 t 1 1 t 1  "},{"text":" Wash beans and put into the boili.ng wa ter and aliow to boil for about 10 minutes. Cook the filterate (milk) for about 15 -20 minutes by steaming, or directly over fue on low heat .nd stir constantly to avoid sricking ro post: skimming off the scum.13. Add salt and sugar and stir to clis solve. 14. Remove from fue. Add flavouring and use. 14. Remove from fue. Add flavouring and use. Keep milk in pre-sterilized bottle and seal. Keep milk in pre-sterilized bottle and seal. Keep milk in sterilized bottle, put bottle in cold water and allow to boil fOI about 10 minutes Keep milk in sterilized bottle, put bottle in cold water and allow to boil fOI about 10 minutes ,cool and refrigerate. ,cool and refrigerate. Method II Method II 1. Clean beans 1. Clean beans 2. Boil enough water to cover beans, adding half the bicarbonate of soda 2. Boil enough water to cover beans, adding half the bicarbonate of soda 3. 4. Pour off water 3. 4. Pour off water 5. Put beans into another boiling water into whieh remaining bicarbonate of soda has 5. Put beans into another boiling water into whieh remaining bicarbonate of soda has been added. been added. 6. Boil for another 10 -15 minutes. 6. Boil for another 10 -15 minutes. 7. Remove froln water. 7. Remove froln water. 8. D ehull. 8. D ehull. 9. Put beans into a blender irnmediately and grind using part of the drinking water. 9. Put beans into a blender irnmediately and grind using part of the drinking water. 10. Mix pas te with the remaining wa ter and put in a clean white clo th bag and fold. 10. Mix pas te with the remaining wa ter and put in a clean white clo th bag and fold.  "},{"text":"than mast other seeds so rinse until the water you drain off mns clear. Set soy sprouts aside Bake at the centre of the oven at 230 degrees Celsius gas mark 8 for 30-35 minutes 14. Remove from the oven turn out the rin and coo1.Combine all of the ingredients to create thick slurry about like pancake bulter. If the soyrnilk is cold , wann it before adding for faster yeast ac rion. Let rise in the bowl untiJ it's like a sponge and bubbly and light when stírred. (a souree of heat wilI help) Put the bowl on Soy sprouts are available in health food stores and even supermarkets. But the best way to get soy sprouts is by growing sprouts at home. Soybeans can be sprouted in the same manner as other beans and seeds.Put Vz cup of soy beans into a glass jar (a masan jar is fine) and add 2-4 times as much cool water. Allow soy beans to soak for 8 -12 hours. Do not cover the jar because the sprouts need airo Drrun off the soak water. Rinse thorough1y with cool water. The soak water is a starchier 7. Shape the dough into a bowl, put in a bowl and cover with a cloth or put into a large oiled polythene bag 8. If using ascorbic acid lea ve for S minutes 0111y if not leave until the dough is nearJy double in size (about 1-1' / ,hoUIs at room temperature 9. Knead again (knock back) then shape 10. Pul in a warm greased bread rin 11. Brush with a glaze made by mixillg 1 egg 1 leve! tablespoon 1 sugar and 1 table spoon water 12. Cover the dough loosely with oiled polythene and allow lo \"prove\" (cise) again-about 40-45 minutes Ingredients lcup Fresh ground whole wheat flour 1 2 tsp. 2 tsp. I tsp. Method Batch Okara from soy rnilk maker Yeast Vital wheat gluten Sorghum molasses Butterrnilk powder Soybean oil (oprional) Soy milk a skillet 10 avoid overheatíng the bowl, and eover it wjth a damp towel) \\'V'hen the sponge is ready, sOr in unbleaehed wrute flour untiJ the dough can be kneaded for se,>eral minutes to ereate a good feeL knead the dough again without it being too sricky. T rus kneadllg can be a little longer than the fust to crea te a good spring 10 the bread. Fonn the dough into a block about the size o f your bread plan. SPROUTS What Are Soy Sprouts? Although they are not as popular as mW1g bean or alfalfa spreuts, soy sprouts (a1so called soybean sprouts) are an exeeUent so urce of proteins, ,.-jtamins and isoílavones. During spreutíng mos! of the undesirable carbohydrates are metabolized, the protein digesribility in1proves and the trypsin inhibitors are inaetivated. Unique is the formarion of aseorbic acid How to make your own soy sprouts? out of sunlight and at room temperature between rinses. Rinse and drrun agrun in 8-12 hours and repeat this for 5-7 days. Store the soy sprouts in a refrigerator. 1. Lower heat and cook for about 5 minutes. Add more water if necessary to get soft consistency 2. Add chopped vegetables and allow cooking for about 5 more minutes 13. Molasses Wheat Bread Let rise in the bowl untiJ about doubled, puneh down and add just enough flour so you 3. Serve 7. Shape the dough into a bowl, put in a bowl and cover with a cloth or put into a large oiled polythene bag 8. If using ascorbic acid lea ve for S minutes 0111y if not leave until the dough is nearJy double in size (about 1-1' / ,hoUIs at room temperature 9. Knead again (knock back) then shape 10. Pul in a warm greased bread rin 11. Brush with a glaze made by mixillg 1 egg 1 leve! tablespoon 1 sugar and 1 table spoon water 12. Cover the dough loosely with oiled polythene and allow lo \"prove\" (cise) again-about 40-45 minutes Ingredients lcup Fresh ground whole wheat flour 1 2 tsp. 2 tsp. I tsp. Method Batch Okara from soy rnilk maker Yeast Vital wheat gluten Sorghum molasses Butterrnilk powder Soybean oil (oprional) Soy milk a skillet 10 avoid overheatíng the bowl, and eover it wjth a damp towel) \\'V'hen the sponge is ready, sOr in unbleaehed wrute flour untiJ the dough can be kneaded for se,>eral minutes to ereate a good feeL knead the dough again without it being too sricky. T rus kneadllg can be a little longer than the fust to crea te a good spring 10 the bread. Fonn the dough into a block about the size o f your bread plan. SPROUTS What Are Soy Sprouts? Although they are not as popular as mW1g bean or alfalfa spreuts, soy sprouts (a1so called soybean sprouts) are an exeeUent so urce of proteins, ,.-jtamins and isoílavones. During spreutíng mos! of the undesirable carbohydrates are metabolized, the protein digesribility in1proves and the trypsin inhibitors are inaetivated. Unique is the formarion of aseorbic acid How to make your own soy sprouts? out of sunlight and at room temperature between rinses. Rinse and drrun agrun in 8-12 hours and repeat this for 5-7 days. Store the soy sprouts in a refrigerator. 1. Lower heat and cook for about 5 minutes. Add more water if necessary to get soft consistency 2. Add chopped vegetables and allow cooking for about 5 more minutes 13. Molasses Wheat Bread Let rise in the bowl untiJ about doubled, puneh down and add just enough flour so you 3. Serve (~tamin C) during sproutíng. (~tamin C) during sproutíng.  "},{"text":"PICKLED VEGETABLES -Source ofVitamins and Minerals Atchar Atchar is a hot vegetable pick1e eaten by many in Southem Africa. It is usually eaten with bread or rice. Atchar from vegetables, is made from carrots, onions and cabbage (sometimes sweet peppers and green beans) stored in vinegar and oil. The mrun flavour of atchar is usually cayenne pepper (chill), with salt and other spices being added. \"\\Iash me jars and lids and put mem inlo a large saucepan. Fill me saucepan with water so mat the jars and lids are covered and heat until the water boils.Let me water boil for about 5 minutes. S. Put a little o f the oil in a saucepan and add ro trus, me dry food s (cayenoe pepper, salt, ginger powder and curry p owder). Stir well and make sure tha! the oil does no! bum. Keep stircing. If more oil is needed, add only from me amount you have measured out for me recipe. 6. Add me onions and heat quickly until mey become 50ft (approximately 5 minutes) . 7. Add me rest of the oi! and vinegar. Stir \\VeU . You must have enough vinegar or me atchar will spoil. 8. Add me cabbage. Stir well. Heat for a furmer 5 minutes . Stir from time to rune. Clean the o utside o f the rim o f the ja! and put on the lid. Close as rightly as possible. (pickled Vegetables Intermedia te Technology Development Gro up 2) Ingredients Ingredients lngredients needed for 7-8 jars of rnild vegetable atehar (400g jars/glass bottles like mase lngredients needed for 7-8 jars of rnild vegetable atehar (400g jars/glass bottles like mase used for peanut burter) used for peanut burter) 750g Carrots 750g Carrots 600g Cabbage 600g Cabbage 450g Onions 450g Onions 7S0rnl Sunflower oi! 7S0rnl Sunflower oi! 300rnl Vinegar 300rnl Vinegar 72g Cayenne pepper 72g Cayenne pepper 15g Ginger powder 15g Ginger powder 40g Salt 40g Salt 30g Curry powder 30g Curry powder Memod Memod 1. \\\"\\Iash aU vegetables in cold water. Remove all rorten parts, skin, rops and tails, and 1. \\\"\\Iash aU vegetables in cold water. Remove all rorten parts, skin, rops and tails, and eliseard them. eliseard them. 2. G rate me carrots using Ihe large round ha les on me grater. 2. G rate me carrots using Ihe large round ha les on me grater. 3. Cut me onions and cabbage into tilln pieces, approximately 5cm long. Do not use 3. Cut me onions and cabbage into tilln pieces, approximately 5cm long. Do not use Ihe core of me cabbage. Ihe core of me cabbage. 4. \\Make sure me atchar do es not bum. 4. \\Make sure me atchar do es not bum. 9. Finally add me earrots and heat fOI a few minutes so mat me earrots are slightly 9. Finally add me earrots and heat fOI a few minutes so mat me earrots are slightly softened (about S minutes). softened (about S minutes).  "}],"sieverID":"09066270-0b98-48c5-a2bf-69e8a1257067","abstract":""}

data/part_3/01740d28dee66916c807aefc8c576d18.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01740d28dee66916c807aefc8c576d18","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8cae32c9-d58d-4a10-84f1-7b259e23ca52/retrieve"},"pageCount":6,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":151,"text":"A s we say goodbye to the 20th century, we can look back with pride and satisfaction on the revolution that our farm men and women have brought about in our agricultural history. In 1969 I wrote in the Illustrated Weekly of India about the role our farm families played in initiating the Wheat Revolution in India: \"Brimming with enthusiasm, hard-working, skilled and determined, the Punjab farmer has been the backbone of the revolution. Revolutions are usually associated with the young, but in this revolution, age has been no obstacle to participation. Farmers, young and old, educated and uneducated, have easily taken to the new agronomy. It has been heart-warming to see young college graduates, retired officials, ex-armymen, illiterate peasants and small farmers queuing up to get the new seeds. At least in the Punjab, the divorce between intellect and labour, which has been the bane of our agriculture, is vanishing.\""},{"index":2,"size":83,"text":"While we can and should rejoice about the past achievements of our farmers, scientists, extension workers, and policymakers, there is no room for complacency. We continue to face several problems: • First, increasing population leads to increased demand for food and reduced per capita availability of arable land and irrigation water. • Second, improved purchasing power and increased urbanization lead to higher per capita food grain requirements due to an increased consumption of animal products. • Third, marine fish production is becoming stagnant."},{"index":3,"size":57,"text":"• Fourth, there is increasing damage to the ecological foundations of agriculture, such as land, water, forests, biodiversity, and the atmosphere, and there are distinct possibilities for adverse changes in climate and sea level. • Finally, while dramatic new technological developments are taking place, particularly in biotechnology, environmental and social implications are yet to be fully understood."},{"index":4,"size":108,"text":"Because land and water for agriculture are diminishing resources, there is no option but to produce more food and other agricultural commodities from less arable land and irrigation water. In other words, the need for more food has to be met through higher yields per units of land, water, energy and time. We need to examine how science can be mobilized to raise further the biological productivity ceiling without associated ecological harm. Scientific progress on the farms, as an \"ever-green revolution,\" must emphasize that the productivity advance is sustainable over time since it is rooted in the principles of ecology, economics, social and gender equity, and employment generation."},{"index":5,"size":73,"text":"The dimensions of the challenges faced by those involved in developing scientific strategies and public policies for sustainable food security are best defined in some statistics on India, which now has a population of one billion. In global terms, India today has 16 percent of human population, 15 percent of farm animal population, 2 percent of the geographical area, 1 percent of rainfall, 0.5 percent of forests, and 0.5 percent of grazing land."}]},{"head":"Genetic Engineering and Food Security: Ecological and Livelihood Issues","index":2,"paragraphs":[]},{"head":"M. S. Swaminathan","index":3,"paragraphs":[{"index":1,"size":66,"text":"The Green Revolution has so far helped to keep the rate of growth in food production above the population growth rate. The Green Revolution was, however, the result of public good research, supported by public funds. The emerging gene revolution, by contrast, is spearheaded by proprietary science and can come under monopolistic control. How can we take the fruits of the gene revolution to the unreached?"}]},{"head":"Meeting the Challenges Ahead","index":4,"paragraphs":[{"index":1,"size":85,"text":"The Gene Revolution Mendel's laws of genetics were rediscovered in 1900. Mendel had published his work on inheritance patterns in pea in 1865, but it took 35 years for others to grasp their significance. Since 1900, we have witnessed steady progress in our understanding of the genetic makeup of all living organisms ranging from microbes to man. A major step in human control over genetic traits was taken in the 1920s when Muller and Stadler discovered that radiation can induce mutations in animals and plants."},{"index":2,"size":100,"text":"In the 1930s and 1940s, several new methods of chromosome and gene manipulation were discovered, such as the use of colchicine to achieve a doubling in chromosome number, commercial exploitation of hybrid vigor in maize and other crops, use of chemicals such as nitrogen mustard and ethyl methane sulphonate to induce mutations and techniques like tissue culture and embryo rescue to get viable hybrids from distantly related species. The double helix structure of DNA (deoxyribonucleic acid), the chemical substance of heredity, was discovered in 1953 by James Watson and Francis Crick. This triggered explosive progress in every field of genetics."},{"index":3,"size":82,"text":"As we approach the end of the 20 th century, we see a rapid transition from Mendelian to molecular genetic applications in agriculture, medicine, and industry. This brief capsule of genetic progress from 1900 to 1999 adequately stresses that knowledge and discovery represent a continuum, with each generation taking our understanding of the complex web of life to a higher level. It would therefore be wrong to worship or discard experimental tools or scientific innovations because they are either old or new."},{"index":4,"size":53,"text":"Just as it took 35 years for biologists to understand the significance of Mendel's work, it may take a couple of decades more to understand fully the benefits and risks associated with genetically improved foods. It would be prudent to apply scientific and precautionary principles in areas of human health and environmental safety."},{"index":5,"size":110,"text":"The 1990s have seen dramatic advances in our understanding of how biological organisms function at the molecular level, as well as in our ability to analyze, understand, and manipulate DNA molecules, the biological material from which the genes in all organisms are made. The entire process has been accelerated by the Human Genome Project, which has poured substantial resources into the development of new technologies to work with human genes. The same technologies are directly applicable to all other organisms, including plants. Thus, the new scientific discipline of genomics has arisen, which has contributed to powerful new approaches in agriculture and medicine, and has helped to promote the biotechnology industry."},{"index":6,"size":48,"text":"Several large corporations in Europe and the United States have made major investments to adapt these technologies to produce new plant varieties of agricultural importance for large-scale commercial agriculture. The same technologies have equally important potential applications to address food security and poverty of people in developing countries."},{"index":7,"size":160,"text":"Work in India has shown that genetic modification can do immense good in agriculture and food security. The 21 st century may witness changes in temperature, precipitation, sea level, and ultraviolet b radiation, as a result of global warming. These changes in climate are expected to adversely affect India and sub-Saharan Africa. All human-induced calamities affect adversely the poor nations and the poorest among all nations the most. This led us to initiate an anticipatory research program to breed salt-tolerant varieties of rice and other crop plants in coastal areas, in order to prepare for seawater intrusion into farmland as a result of an eventual rise in sea level. The donor of salt tolerance was a mangrove species belonging to the family Rhizophoraceae. Transferring genes for tolerance to salinity from mangrove tree species to rice or tobacco is an impossible task without recourse to recombinant DNA experiments. This demonstrates the immense benefits that can accrue from genomics and molecular breeding."}]},{"head":"Concerns","index":5,"paragraphs":[{"index":1,"size":98,"text":"What then are the principal concerns? In industrial countries, the major concerns relate to the impact of genetically improved organisms (GIOs) on human health and the environment. These food and environmental safety concerns have been well documented and are widely known. The food and environmental scientists of developing countries are equally concerned about the food and environmental safety aspects of GIOs. The ethical and social issues relating to GM crops were dealt with in detail in a report published by the Nuffield Council on Bioethics in May 1999. What issues concern the public and professionals in developing countries?"},{"index":2,"size":82,"text":"The first issue of concern is biosafety. Why are large biotechnology companies averse to the labeling of GM foods? In spite of over three years of intensive discussion in meetings sponsored by the Secretariat of the Convention on Biological Diversity (CBD), the negotiations broke down at Cartagena, Colombia, in February 1999. Thus, there is as yet no internationally agreed biosafety protocol, as called for under Article 19 of CBD. The absence of such a protocol will hurt the private sector the most."},{"index":3,"size":124,"text":"There are other issues of concern to the general public in India. First, India is a land of small farm holdings. There are now 106 million operational holdings in the country, and about 75 percent of them are one hectare or less. India has 25 percent of the global farming community, and farming provides a livelihood to nearly 66 percent of the population. There is concern that expansion of proprietary science and shrinking of \"public good\" research supported from public funds may lead to a situation where the technologies of the future remain in the hands of a few transnational corporations. Only resource-rich farmers may have access to them, thereby widening further the gap between the rich and poor. This could accelerate social disintegration."},{"index":4,"size":23,"text":"Second, monopolistic control over crop varieties could lead to a situation where large areas are covered by very few genetic strains or hybrids."},{"index":5,"size":150,"text":"It is well known that genetic homogeneity enhances genetic vulnerability to biotic and abiotic stresses. Biotechnology companies are therefore recommending resistance management strategies, such as growing 30-40 percent non-Bt (Bacillus thuringiensis) corn with Bt-corn (see Gould and Cohen this volume). What will happen to the livelihood of farm men and women operating smallholdings with institutional credit and with no crop insurance, if GM corn, soybean, rice, potato or other crops are affected by serious diseases as a result of the breakdown of resistance? Will the companies agree to compensate them for the loss? This problem could become even more serious if companies incorporate genetic use restriction mechanisms, known popularly as \"terminator\" genes in the new varieties. Small farmers could then experience \"genetic enslavement\" since their agricultural destiny could be in the hands of a few companies if they have to purchase new seeds each year, similar to conventional hybrid seed."},{"index":6,"size":132,"text":"A third issue relates to the potential impact of GM foods on biodiversity. This has two dimensions. The first deals with the replacement of numerous local cultivars with one or two new varieties, which could lead to genetic erosion. Modernization of agriculture has resulted in a narrowing of the base of food security, both in terms of the number of species constituting the food basket and the number of genetic strains cultivated (see NRC 1989NRC , 1996)). Local cultivars have often been the donors of many useful traits, including resistance to pests and diseases. Under small farm conditions, every farm is a genetic garden, comprising several annual and perennial crops, and several varieties of each crop. The need of the hour is to enlarge the food basket and not shrink it further."},{"index":7,"size":93,"text":"The second dimension is equity in benefit sharing between biotechnologists and the primary conservers of genetic resources and the holders of traditional knowledge. The primary conservers have so far remained poor, while those who use their knowledge (for example, the medicinal properties of plants) and material become rich. This has resulted in accusations of biopiracy. It is time that genetic engineers and others promote and find ways to implement genuine biopartnerships with the holders of indig-enous knowledge and traditional conservers of genetic variability, based on principles of ethics and equity in benefit sharing."},{"index":8,"size":74,"text":"Unless R&D efforts on GM foods are based on principles of bioethics, biosafety, biodiversity conservation, and biopartnerships, there will be serious public concern in India, as well as many other developing countries, about the ultimate nutritional, social, ecological, and economic consequences of replacing numerous local varieties with a few new genetically improved crop varieties. To derive benefits from genetic engineering without undue risks, every nation should set up a multistakeholder Commission for Genetic Modification."}]},{"head":"The Ecotechnology Revolution","index":6,"paragraphs":[{"index":1,"size":71,"text":"Knowledge is a continuum. There is much to learn from the past in terms of the ecological and social sustainability of technologies. At the same time, new developments have opened up new opportunities to develop technologies that can lead to high productivity without adverse impact on the natural resources base. Blending traditional and frontier technologies leads to the birth of ecotechnologies with combined strength in economics, ecology, equity, employment, and energy."},{"index":2,"size":159,"text":"In water harvesting and sustainable use, for example, there are many lessons to be learned from the past. In the desert area of Rajasthan, India, drinking water is available even in areas with 100 mm annual rainfall, largely because women are continuing to harvest water in simple structures called kunds. In contrast, drinking water is scarce during summer months in some parts of northeast India, with an annual rainfall of 15,000 mm. There is need therefore to conserve traditional wisdom and practices, which are tending to become extinct. The decision of the World Intellectual Property Organization (WIPO) to explore the intellectual property needs, rights, and expectations of holders of traditional knowledge, innovations, and culture is an important step in widening the concept of intellectual property rights (IPR). Principles of ethics and equity demand that this invaluable component of IPR be included when the TRIPs (Trade-related Intellectual Property Rights) agreement of the World Trade Organization (WTO) comes up for review."},{"index":3,"size":83,"text":"FAO has been a pioneer in the recognition of the contributions of farm families in genetic resources conservation and enhancement by promoting the concept of Farmers' Rights. Like WIPO, UPOV (Union for the Protection of New Varieties of Crops) should also undertake the task of preparing an integrated concept of breeders' and farmers' rights and assisting countries in developing equitable and effective sui generis systems for the protection of new plant varieties, as is required for all members of WTO (Barton, 1999;Leisinger, 1999)."}]},{"head":"Science and Basic Human Needs","index":7,"paragraphs":[{"index":1,"size":141,"text":"The 20 th century produced an impressive array of accomplishments in nearly every field of science and technology. The last part of the century was particularly rich in innovations in biotechnology, and information and space technologies. Such advances have had a beneficial impact on human food and health security. The global population was only 940 million in 1798 when Malthus expressed his apprehensions about human capacity to achieve a balance between food production and population. Human numbers reached 6 billion in 1999, and once in every12 years another billion will be added, if current growth rates continue in developing countries. Science-based technologies supported by appropriate public policies are responsible for food famines becoming rare. The famine of food at the level of an individual today is mostly due to inadequate purchasing power arising from a famine of jobs or employment opportunities."},{"index":2,"size":178,"text":"In spite of an impressive stockpile of scientific discoveries and technological innovations, poverty and social and gender inequities are increasing. According to the World Bank, 1.3 billion people lived on less than US$1 per day and another 3 billion lived on less than US$2 per day in 1993. Nearly 1.5 billion of the world population of 6 billion will live in severe poverty at the dawn of the new millennium. Illiteracy, particularly among women, is still high in many developing countries. It is not only in opportunities for education that children of many developing countries remain handicapped, but even more alarming, in opportunities for the full expression of their innate genetic potential for physical and mental development. Between 25 and 50 percent of children born in South Asian countries are characterized by low birth weight (LBW), caused by maternal and fetal undernutrition and malnutrition. The UN Commission on Nutrition in a recent report has warned about the serious consequences of LBW for both brain development in the child, as well as the level of health in later life."},{"index":3,"size":92,"text":"New technologies supported by appropriate services and public policies have helped to prove doomsday predictions wrong, and have led to the agricultural revolution (the Green Revolution) becoming one of the most significant of the scientific and socially meaningful events of the 20th century. Four thousand years of wheat cultivation led to Indian farmers producing 6 million metric tons of wheat in 1947. The Green Revolution in wheat helped to surpass in 4 years the production accomplishments of the preceding 4000 years, thus illustrating the power of synergy between science and public policy."},{"index":4,"size":139,"text":"There are uncommon opportunities now to harness the power of such synergy to address contemporary development issues such as the growing rich-poor divide, feminization of poverty, famine of jobs, human numbers exceeding the population-supporting capacity of ecosystems, climate change, and loss of forests and biodiversity. Whether in economics or in ecology, experience has shown that a trickle-down approach does not work. Fortunately, modern information technology provides opportunities to reach the unreached. Virtual colleges, computeraided and internet-connected, linking scientists and women and men living in poverty can be established at local, national, and global levels to launch a knowledge and skill revolution. This will help to create better awareness of the benefits and risks associated with genetically improved organisms, so that both farmers and consumers will get better insights into the processes leading to the creation of novel genetic combinations."},{"index":5,"size":106,"text":"The future of small farm families will depend on precision agriculture, which involves the use of the right inputs at the right time and in the right way. Biotechnology will play an important role in the major components of precision farming: integrated gene management, soil health care, efficient water management, integrated pest man-agement, integrated nutrient supply, and efficient postharvest management. Ecotechnology-based precision farming can help to cut costs, enhance marketable surplus, and eliminate ecological risks. This is the pathway to an ever-green revolution in small-farm agriculture. This is why increased public support to both the CGIAR and NARS is important for strengthening health and food security."}]},{"head":"Conclusion","index":8,"paragraphs":[{"index":1,"size":146,"text":"The industrial revolution in Europe marked the transition to a world where technology became a major causal factor in the prosperity gap between developing and industrial nations. How can we now enlist technology as an ally in the movement for social, gender and economic equity in an era of expanding proprietary science? Obviously, public good research supported from public funds must be stepped up. The following indicator of measuring the value of development efforts proposed by Mahatma Gandhi is the most meaningful yardstick for determining priorities in scientific research designed to help in meeting basic human needs: \"Recall the face of the poorest and the weakest man whom you have seen, and ask yourself, if the steps you contemplate are going to be of any use to him. Will he gain anything by it? Will it restore to him control over his own life and destiny?\""},{"index":2,"size":27,"text":"If biotechnology research can be promoted keeping in mind the guideline Gandhi gave, it will become a powerful tool in ensuring sustainable food security in the world."}]}],"figures":[],"sieverID":"56931f9e-9244-420a-802f-1aee835777fe","abstract":""}

data/part_3/027340d31bfd81c03ba0477eef9d2eb9.json

@@ -0,0 +1 @@
+{"metadata":{"id":"027340d31bfd81c03ba0477eef9d2eb9","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a8664eea-c335-435d-9cb6-b4d21b375a97/retrieve"},"pageCount":1,"title":"Study #2432 Contributing Projects: • P329 -Key leverage points for improving diets through food systems","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":" Part II: CGIAR system level reporting Links to the Strategic Results Framework: Sub-IDOs: • Increased availability of diverse nutrient-rich foods • Increased access to diverse nutrient-rich foods • Optimized consumption of diverse nutrient-rich foods Is this OICR linked to some SRF 2022/2030 target?: Too early to say Description of activity / study: This analysis was undertaken with the intention of exploring the potential future trajectory of global systems of dietary provision, and the quality and sustainability of such systems, for a globally representative set of countries. Link to internal report is provided. Publication is expected in 2020. generated on 2022-08-19 at 08:20 (GMT+0) "}],"sieverID":"f744b1b4-8e15-4395-9cb0-7f2400d5fcba","abstract":""}

data/part_3/02fdd4766ef0c40e5991bb60faa9b27c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02fdd4766ef0c40e5991bb60faa9b27c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/41a76cf9-4acf-4ec7-9f22-2565ce110587/retrieve"},"pageCount":12,"title":"Estimating lime requirements for tropical soils: Model comparison and development","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":110,"text":"Acid soils may have a high concentration of phytotoxic elements such as aluminum and manganese in the soil solution and a low availability of phosphorus, calcium, and other plant nutrients (Kamprath, 1984). Soil acidity problems can be addressed with liming, the application of materials that react as a base and are rich in calcium and/or magnesium (Coleman et al., 1959). Liming has been practiced for centuries (Johnson, 2010), and its use is still expanding, particularly in tropical areas with acid soils. For example, it played a key role in the recent expansion of agriculture in the Brazilian Cerrado region on soils considered highly problematic for crop production (Goedert, 1983;Yamada, 2005)."},{"index":2,"size":243,"text":"The amount of lime required to adjust soil acidity depends on the soil, the target crop(s), and the liming materials used. In temperate regions, lime requirements are commonly estimated with locallycalibrated quick tests using buffer solutions (Goulding and de Varennes, 2016;Metzger et al., 2020;Rossel and McBratney, 2001;Sims, 1996). These tests can be developed by comparing the buffer's response to the soil with the soil's response to lime in field or incubation studies or Abbreviations: ECEC, Effective Cation Exchange Capacity; CEC 7 , Cation Exchange Capacity at pH 7; exch.acid, Exchangeable acidity; exch.bases, Exchangeable bases; AS, Acidity saturation (%); TAS, Target acidity saturation (%); V t , Target base saturation; LR, Lime rate; sbd, soil bulk density; ld, lime incorporation depth; lf, lime factor; LiTAS, A new model to estimate the lime rate required to reach a target acidity saturation; ACID4, NuMASS, MG5, Published lime requirement models based on acidity saturation; r c , Concordance correlation coefficient. by slow titrations. Both the soil testing and the lime application may be a relatively small expense in intensively-managed commercial farms, especially when lime is relatively cheap and because liming, when needed, increases the use efficiency of other inputs (de Wit, 1992). Moreover, large lime applications are often effective for several years due to the residual effects of the most-used liming materials and the buffering capacity of acid soils that reduces the risk of harm from applying more lime than is immediately required (Li et al., 2009)."},{"index":3,"size":152,"text":"This situation differs for many smallholder farmers in sub-Saharan Africa (Crawford et al., 2008) and other tropical regions (Sanchez and Salinas, 1981), where the soil testing, lime, and its application may be relatively expensive or inaccessible, and their benefit may be relatively small if fertilizer use is low. Moreover, empirical evidence on the effect of liming is often limited in these regions. Furthermore, methods that depend on measurements with buffer solutions must first be calibrated for each soil type and cannot be assumed to work without this required calibration. In these circumstances, models to estimate lime requirements from generally available soil property data (Hengl et al., 2017;Miller et al., 2021) could help better understand the potential benefits of liming. Lime requirement models could serve as a starting point to develop locally optimal liming recommendations. They could also provide strategic information on potential benefits and demand for lime for a region of interest."},{"index":4,"size":158,"text":"Here, we provide a comprehensive review of lime requirement models for tropical acid soils that can be used with readily available soil data. The remainder of the paper is organized into seven sections. In Section 2, we introduce key concepts related to estimating lime requirements that have been a source of confusion and inconsistency. Section 3 presents the materials and methods used. In Section 4, we describe and discuss seven published lime requirement models for tropical soils and introduce a new model named LiTAS. The models are grouped by their target soil properties, and their accuracy is evaluated with experimental data from soil incubation studies. Section 5 presents a case study in which we run all models for a dataset of 303 African soil samples. We show substantial differences between models in the estimated lime requirement for acid tropical soils. In Section 6, we discuss the implications of our findings, and we conclude the paper in Section 7."}]},{"head":"Key concepts and definitions","index":2,"paragraphs":[{"index":1,"size":157,"text":"Soils are generally considered acid for crop production when they have a pH (H2O) of 5.5 or less for most of the year (FAO, 2022;Sanchez, 2019). In the remainder of this paper, pH refers to the pH measured in a soil-water solution. This is the most commonly used method to measure pH and the pH measure available across the datasets we used (e.g., Teixeira et al., 2020a). Other methods to measure the soil pH include mixing the soil with an equivalent volume of 0.01 M CaCl 2 or 1 M KCl. Soil pH (CaCl2) is more stable against the seasonal changes in the electrolyte concentration of the soil solution that can affect pH (H2O) measurements (Kissel et al., 2009). pH (KCl) is used to measure the pH while accounting for the exchangeable acidity of the soil (Thomas, 1996). In acid soils, pH (H2O) is generally higher than pH (CaCl2) and pH (KCl) (Kome et al., 2018;Sanchez, 2019)."},{"index":2,"size":159,"text":"Soils can be naturally acidic or become acidic because of agricultural practices such as the use of acidifying fertilizer and the removal of elements with harvested products. In the tropics, many soils in humid (and some subhumid) regions are inherently acid because intense weathering processes have resulted in the displacement and leaching of basic (i.e., non-acidic) exchangeable cations (Ca 2+ , Mg 2+ , K + , and Na + ) and the accumulation of exchangeable acidity (Al 3+ and H + ). The main problem with soil acidity in the tropics is not the low pH as such, but rather the associated aluminum (Al) toxicity that constrains crop growth (Sanchez, 2019). The purpose of liming should therefore be to remove Al toxicity, considering the sensitivity of the target crops, together with alleviating other possible constraints such as Ca and Mg deficiencies (Kamprath, 1984;Sanchez, 2019), but not to increase pH for its own sake (Fageria and Baligar, 2008;Harter, 2007)."}]},{"head":"Target soil chemical properties","index":3,"paragraphs":[]},{"head":"Exchangeable acidity or aluminum","index":4,"paragraphs":[{"index":1,"size":125,"text":"Acidity saturation is the fraction of the effective cation exchange capacity (ECEC) of the soil occupied by exchangeable acid cations (Al 3+ and H + , extracted with a neutral unbuffered salt solution such as 1 M KCl). In tropical soils (except in histosols), nearly all exchangeable acidity is exchangeable Al 3+ ; thus, Al saturation approximates acidity saturation (Deressa et al., 2020;Farina and Channon, 1991;Salinas, 1978). Therefore, acidity saturation is often used as a proxy for Al toxicity (Evans and Kamprath, 1970;Farina and Channon, 1991;Kamprath, 1980;Salinas, 1978;Smyth and Cravo, 1992). Many lime requirement models estimate the lime rate required to lower the acidity saturation to a target level that does not affect crop yield (Cochrane et al., 1980;Osmond et al., 2002;Yost et al., 1988)."},{"index":2,"size":74,"text":"The terms exchangeable acidity and exchangeable Al 3+ have been used interchangeably in tropical soil literature, with the term exchangeable Al 3+ more commonly used in older literature (Sanchez, 2019). Indeed, several authors of the lime requirement models reviewed here measured acidity saturation but referred to it as Al saturation (Cochrane et al., 1980;Kamprath, 1970). Consequently, some models were originally formulated for exchangeable Al 3+ (and Al saturation) but derived from exchangeable acidity measurements."}]},{"head":"Exchangeable calcium and magnesium","index":5,"paragraphs":[{"index":1,"size":95,"text":"Ca 2+ and Mg 2+ deficiencies coexist with Al toxicity problems in many acidic soils (Sanchez et al., 2019). Moreover, some highly weathered acid soils can have very low ECEC and, thus, low exchangeable Ca 2+ and Mg 2+ but low acidity saturation, resulting in Ca and Mg deficiencies without Al toxicity problems (Kamprath, 1984). Therefore, some lime requirement models based on acidity saturation also estimate the lime rate needed to cover these deficiencies (Sanchez, 2019;Teixeira et al., 2020b;van Raij, 1996). Organic or inorganic fertilizers applications can also be used to address such micronutrient deficiencies."}]},{"head":"Base saturation","index":6,"paragraphs":[{"index":1,"size":172,"text":"A higher \"base saturation\" is an alternative to a lower acidity saturation in setting a target for alleviating soil acidity problems (Quaggio, 1983;van Raij, 1996). Base saturation (V) is the sum of all exchangeable bases (Ca 2+ , Mg 2+ , K + , and Na + ) divided by the Cation Exchange Capacity at pH 7 (CEC 7 ). CEC 7 differs from ECEC, especially in acid soils, where CEC 7 ≫ ECEC. For ECEC, exchangeable acid cations (Al 3+ and H + ) are extracted with a neutral unbuffered salt solution. In contrast, a pH 7 buffer solution is used for CEC 7 , which extracts both exchangeable and non-exchangeable acidity (for example, from hydroxy-Al organic matter complexes), comprising the potential acidity. The magnitude of the potential acidity of the soil depends on the type and amount of clay and organic matter. Although there is some inverse parallelism between acidity saturation and base saturation, these terms are not complementary because they have different denominators (ECEC and CEC 7 , respectively)."},{"index":2,"size":56,"text":"Contrary to Al toxicity and acidity saturation, there is no direct relation between base saturation and crop yields. Instead, a minimum base saturation threshold is defined such that, above it, no soil acidity problems are detected (Fageria and Baligar, 2008). Therefore, target base saturation levels must be defined locally for each crop type (van Raij, 1996)."}]},{"head":"pH","index":7,"paragraphs":[{"index":1,"size":125,"text":"Most lime requirement methods used in temperate regions target soil pH by estimating the lime rate required to raise the pH to a specific level (6 to 6.5 for most crops and soils) with locally-calibrated models (Goulding and de Varennes, 2016;Sims, 1996). In acid tropical soils, the yield of many crops may not be negatively affected by a soil pH as low as F. Aramburu Merlos et al. 5.0 depending on other soil chemical properties (Abruña et al., 1969;Bell, 1996;Pearson et al., 1977) and raising the pH can result in a loss of soil structure and other problems (Harter, 2007). Therefore, a target pH level is seldom used, and if it is used, it should be defined locally (Fageria and Baligar, 2008;Teixeira et al., 2020a)."},{"index":2,"size":88,"text":"Exchangeable acidity has a negative exponential association with soil pH (Supplementary Fig. 1). Very high exchangeable acidity values are only found in soils with a pH of 5.1 or lower, but not all soils with a low pH have high exchangeable acidity. Exchangeable acidity approaches 0 at a pH of 5.5, and there is virtually no exchangeable acidity above pH 6 (Supplementary Fig. 1) (Farina and Channon, 1991;Lollato et al., 2013;Sanchez, 2019). Therefore, a target pH of 5.5 should be high enough to address most Al toxicity problems."}]},{"head":"Phosphorus availability","index":8,"paragraphs":[{"index":1,"size":109,"text":"Acid tropical soils usually have very low plant-available phosphorus because of the high P fixation capacity of Fe and Al oxides often found in these soils. Liming has the associated benefit of increasing P availability, which might result in significant yield responses, particularly when P fertilization is low (Salinas, 1978). However, liming can only temporarily relieve P deficiencies in soils with low P reserves (Smithson and Giller, 2002). Therefore, phosphorus availability is not considered a direct target of liming, and lime requirement models do not consider it. Yet, the increase in P availability can be an important reason for observing a yield increase in response to lime (Salinas, 1978)."}]},{"head":"Lime rate units","index":9,"paragraphs":[{"index":1,"size":139,"text":"Lime rates (LR) are commonly expressed in charges per soil mass (e. g., meq per 100 g of soil or cmol c per kg of soil, which are equivalent) or in the equivalent mass in tons (t, 1000 kg) of pure calcium carbonate (CaCO 3 ) per unit area in hectares (ha). To transform lime rates between charges per soil mass and calcium carbonate mass per area, soil bulk density (sbd) and liming depth (ld) are needed. Lime rates in t ha − 1 and cmol c kg − 1 are the same when sbd = 1 g cm − 3 and ld = 20 cm. Thus, LR can be converted from charges per soil mass to calcium carbonate mass per area with Eq. ( 1), where sbd is expressed in g cm − 3 and ld in cm."}]},{"head":"LR","index":10,"paragraphs":[{"index":1,"size":1,"text":"("},{"index":2,"size":1,"text":"(1)"},{"index":3,"size":110,"text":"Many lime requirement models reviewed here provide lime rates in cmol c kg − 1 . Therefore, when using these models to estimate lime rates in t ha − 1 , these must be transformed by considering the soil bulk density, lime incorporation depth, and the calcium carbonate equivalents (CCE) of the liming material to be applied. In addition, other models (Osmond et al., 2002;Yost et al., 1988) assume certain incorporation depth and soil bulk density and provide lime rates in t ha − 1 . However, these lime rates should be adjusted to account for potential differences between the assumed ld and sbd and the actual ld and sbd."}]},{"head":"Materials and methods","index":11,"paragraphs":[{"index":1,"size":188,"text":"A literature review was conducted to identify lime requirement models that only require soil properties available in soil databases to estimate lime rates for acid tropical soils. The terms \"acid*\" AND \"soil*\" AND (\"lim* requirement\" OR \"lim* recommendation\" OR \"lim* rate\") were used in the Web of Science and Google Scholar databases to screen and retrieve relevant literature and references therein. Methods that required additional soil tests to measure the soil's buffering capacity (e. g., Shoemaker et al., 1961) and methods developed for use in specific regions in temperate climates (e.g., Heckman et al., 2002, andRossel andMcBratney, 2001) were excluded. The search yielded seven models that can, in principle, be applied to a wide range of tropical soils. The identified models include five acidity saturation models, one base saturation model, and one pH model. These seven lime requirement models were reviewed and used to derive a new model based on acidity saturation. All models were implemented in an R package called \"limer\" (Aramburu Merlos, 2022) to facilitate their use and evaluation. The R package, data, and scripts used for analysis in this paper are available on GitHub (https://github.com/cropmodels/limer)."},{"index":2,"size":142,"text":"The lime requirement models were evaluated using data from four soil incubation studies that measured the effect of liming on exchangeable acidity and ECEC or acidity saturation (Ananthacumaraswamy and Baker, 1991;Cochrane et al., 1980;Kamprath, 1970;Teixeira et al., 2020a). Soil incubation studies are experiments in which soil samples are mixed with different amounts of lime and incubated under controlled conditions (~ 30 • C and soil moisture at field capacity) for about a month to ensure that all lime reacts with the soil. The liming effect is assessed by measuring chemical soil properties before and after each lime treatment. Data from soil incubation studies that only measured the effect of liming on pH were not included because six out of the seven lime requirement models reviewed here need data on the effect of liming on exchangeable acidity and exchangeable bases to be evaluated."},{"index":3,"size":289,"text":"The compiled data include strongly acidic to moderately acidic soils, four soil orders, and different tropical regions (Table 1). We included data for four Ultisols from the southeastern USA because they share features with the acidic Ultisols from humid tropical regions. The data from Kamprath (1970), Cochrane et al. (1980), andAnanthacumaraswamy andBaker (1991) were readily available. However, only the lime rate estimates were available in Teixeira et al. (2020a), while the initial and final soil properties were not. We calculated the initial soil properties by back-solving the lime requirement formulas using the reported lime rates, which allowed us to recover the exact initial values. However, the final soil properties were estimated using the regression formulas provided in Teixeira et al. (2020a) supplementary information (R 2 ≈ 0.9). Therefore, these values might not reflect all the variability in Table 1 Description of the lime incubation studies data used to evaluate the performance of the lime requirement models. Data were extracted from Kamprath (1970) (Kamp), Cochrane et al. (1980) (Coch), Ananthacumaraswamy and Baker (1991) (Anan), and Teixeira et al. (2020a) (Teix). The range of values (minimummaximum) is presented for lime rates (LR) and chemical soil properties. The number of LR treatments by soil type and the number of observations include the control treatments. ECEC: effective cation exchange capacity; AS (%): acidity saturation (exchangeable acidity divided by ECEC). CEC 7 : cation exchange capacity at pH 7. OM: organic matter. \"-\" indicates that this was not measured, while \"m-\" means it was measured but not available for each treatment (in which case we report the range of values reported in the original paper). Soil properties measured at the end of the experiments are in square brackets.  Merlos et al. the original data."},{"index":4,"size":79,"text":"We used all models to predict the lime rates required to reach the observed soil responses and compared these with the actual lime rates used in the experiments. For instance, the actual lime rate was compared with the predicted lime rate needed to reach the observed acidity saturation for models that use a target acidity saturation. The (dis) agreement between observed (y) and predicted (yˆ) lime rates was assessed with the root mean squared error (RMSE = ̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅̅ ̅"},{"index":5,"size":117,"text":"average model bias (Bias = y − ŷ), and the concordance correlation coefficient (r c ) (Lin, 1989). We repeated the accuracy assessment in three ways to account for the unbalanced number of observations between soil incubation studies and potential soil-incubation-study effects and to evaluate the models with data that was not used to calibrate them. First, we used all the available data to test each model, which might include the data used to calibrate the model. Second, we computed all accuracy metrics independently for each data set and reported their average so that all studies have the same weight on the evaluation. Third, we evaluated the models with data that was not used to calibrate them."},{"index":6,"size":223,"text":"When the data used to develop a particular model was the only data available for testing it, we used either a study-based or a six-fold crossvalidation (James et al., 2013). For the study-based cross-validation, model coefficients were recalibrated with the data from three soil incubation studies and tested with the data from the remaining study, repeating the process for each dataset. When only data from one soil incubation study was available (as for the Teixeira model), we performed a six-fold cross-validation. We reported the average accuracy across folds or studies. Lastly, we compared lime rate estimates from different models using soil data from the Africa Soil Profile Database (AfSP, Leenaars et al., 2014). The AfSP compiles georeferenced soil profile observations from many data sources. We selected soil samples with a pH between 3.5 and 6.5 that were tested for at least exchangeable acidity, ECEC, and CEC 7 , in which exchangeable acidity was extracted with 1 M KCl and CEC 7 measured in 1 M NH 4 OAc buffered at pH 7, ending with a total of 303 African soils. The origin of the selected soil samples is shown on a map in Supplementary Fig. 2, and their main properties are summarized in Supplementary Table 1. Lime requirements were estimated with the models described below for a lime incorporation depth of 20 cm."}]},{"head":"Model description and evaluation","index":12,"paragraphs":[]},{"head":"Acidity saturation models","index":13,"paragraphs":[{"index":1,"size":41,"text":"This section describes five published lime requirement models based on acidity saturation (Kamprath,Cochrane,ACID4,NuMASS,and MG5) and introduces a new model (LiTAS), which were evaluated with data from four soil incubation studies (Ananthacumaraswamy and Baker, 1991;Cochrane et al., 1980;Kamprath, 1970;Teixeira et al., 2020a)."}]},{"head":"Kamprath model","index":14,"paragraphs":[{"index":1,"size":173,"text":"Kamprath (1970) measured the effect of different lime rates in a soil incubation study with four very acid soils (pH < 5, acidity saturation > 50 %). This study showed that acidity saturation does not decrease linearly with the amount of lime applied. When lime application rates are lower than the initial exchangeable acidity, acidity saturation is sharply reduced. However, for lime rates much greater than the initial exchangeable acidity, the fraction of lime charges that neutralizes exchangeable acidity is much lower because the lime also reacts with other forms of Al (e.g., organic-Al complex). Consequently, acidity saturation can be modeled as having a decreasing exponential response to lime that approaches zero at high lime rates (Fig. 1). Kamprath (1970) concluded that a lime rate (cmol c kg − 1 ) of 1.5 times the initial exchangeable acidity (cmol c kg − 1 ) was enough to reduce the acidity saturation to at most 15%, which was considered to be a threshold below which most crops are not affected by acidity (Fig. 1)."},{"index":2,"size":41,"text":"The suggested lime rate for sensitive crops needing an acidity saturation lower than 15%, such as beans (Abruña et al., 1969;Fageria et al., 2011;Kamprath, 1980), was twice the exchangeable acidity. Thus, Kamprath's (1970) lime requirement model can be written as follows:"},{"index":3,"size":193,"text":"where exch. acid i is the initial exchangeable acidity of the soil, and lf is the lime factor, which is 1.5 for most staple crops (e.g., cereals) and 2 for beans and other crops sensitive to acidity, including many vegetable and fruit crops (Alvarez and Ribeiro, 1999). This simple model worked well for almost all the experimental data available from the four studies (Fig. 1). Out of 21 very acid soils (acidity saturation, AS, between 30% and 97%) that received a lime rate of exactly 1.5 times the initial exchangeable acidity, only one ended with an acidity saturation >15%, but it was very close to that value (18%). Furthermore, all soil samples with a lime rate of at least twice the initial exchangeable acidity had a final acidity saturation of 6% or less. Hence, when the goal of liming is to reduce the acidity saturation to a level that does not affect crop growth, liming is only needed when the acidity saturation is above 15% (or 5% for sensitive crops). In such cases, lime rates of 1.5 (or two for sensitive crops) times the initial exchangeable acidity would suffice for most tropical soils."},{"index":4,"size":143,"text":"Modifications of the Kamprath (1970) model were used in different regions of Brazil (Lopes et al., 1991) and Ethiopia (Alemu et al., 2022). For instance, in Minas Gerais, Brazil, a lf of 2 was recommended for most soil types, except for sandy soils (lf = 1) and clay soils (lf = 3; Lopes et al., 1991). These adjustments may account for differences in soil bulk density, as the modified formulas gave lime requirements in tons per ). The solid line is a negative exponential regression line AS f (%) = 95.7e − 1.4LR/exch.acidi and the dot-dash line is a 95% negative exponential quantile regression line fitted with all the observations. Soil samples with LR > 4 × exch. acid i had AS f values ranging from 0 to 3.1%, with quartiles equal to 0, 0.2%, and 0.4% (these extreme values are not shown)."},{"index":5,"size":30,"text":"hectare. Furthermore, all these modified models added a second term to account for possible Ca and Mg deficiencies, as was done in the Minas Gerais 5 model (MG5, Section 4.1.5)."}]},{"head":"Cochrane model","index":15,"paragraphs":[{"index":1,"size":68,"text":"Cochrane et al. (1980) introduced the concept of target acidity saturation (TAS) to estimate lime rates (originally called required percentage Al saturation, see Section 2.1.1). Considering the great variability in acidity saturation tolerance among and within crops (Kamprath, 1980;Lollato et al., 2019), Cochrane et al. (1980) developed a model to estimate the lime rate needed to reduce the acidity saturation to a specific target for a particular crop."},{"index":2,"size":115,"text":"To derive their formula, Cochrane et al. (1980) started with a hypothetical situation where all lime reacts with the exchangeable acidity; thus, the ECEC itself does not change as the decrease in exchangeable acidity was assumed to equal the increase in exchangeable bases. In this scenario, the required lime rate to reach a given acidity saturation would be LR = exch.acid i − exch.acid f = exch.acid i − (TAS/100) × ECEC. The target acidity saturation (TAS, %) is divided by 100 to change it to a fraction, and the subscript i indicates the initial and f the final values. The unit of LR, exch. acid, and ECEC is cmol c kg − 1 ."},{"index":3,"size":142,"text":"The original formula uses the sum of exchangeable acidity (H + and Al 3+ ), Ca 2+ , and Mg 2+ instead of ECEC because these were the cations measured by Kamprath (1970). The concentration of other bases, such as K + and Na + , was considered negligible, as these are normally very low in acid soils. Thus, the sum of exchangeable acidity, Ca 2+ , and Mg 2+ was considered equivalent to the ECEC. We present the formula using ECEC, noting that ECEC might not always include all cations but should always include the exchangeable Al 3+ , Ca 2+ , and Mg 2+ , as these are the most abundant cations in acid soils. If data on exchangeable K + and Na + are available, they might be included depending on which exchangeable cations were considered for the TAS."},{"index":4,"size":69,"text":"Since not all the applied lime reacts with the exchangeable acidity, the formula is multiplied by a lime factor (lf) that equals 1.5 or depending on the relation between initial exchangeable acidity, TAS, and ECEC. The authors defined the following rule: \"factor 1.5 is replaced by 2 when the estimated liming requirement using the factor 1.5 is greater than the chemical lime equivalent of the exchangeable Al (acidity).\" Thus:"},{"index":5,"size":58,"text":"Where AS i is the initial acidity saturation. In other words, when the target acidity saturation is less than one-third of the initial saturation, the lime factor is 2; otherwise, it is 1.5. For example, for soils with an initial acidity saturation of 60%, lf = 1.5 when TAS ≥ 20% and lf = when TAS < 20%."},{"index":6,"size":344,"text":"Notably, when TAS = 0%, the required lime rate according to the Cochrane et al. (1980) model is twice the initial exchangeable acidy, just like the Kamprath (1970) model for sensitive crops. For that reason, Fig. 2. Observed and predicted lime rates (LR, cmol c kg − 1 ) to reach the exchangeable acidity saturation obtained with the observed lime rates for five lime requirement estimation models based on a target acidity saturation (Cochrane,ACID4,NuMaSS,MG5 and LiTAS). Observed data were extracted from Kamprath (1970), Cochrane et al. (1980), Ananthacumaraswamy and Baker (1991), and Teixeira et al. (2020a). Samples with a final acidity saturation of < 5% were excluded. In the Cochrane et al. (1980) model, thick points are values computed with Eq. ( 3) that are different from the values reported in Cochrane et al. (1980), and asterisks are values reported by Cochrane et al. (1980) that did not follow their model (incorrect lime factor). In the Minas Gerais 5th approximation model (MG5), filled circles were predicted using the complete formula, and empty circles by only considering its first term (acidity saturation requirements). Teixeira et al. (2020a) and Ananthacumaraswamy and Baker (1991) did not report soil texture; therefore, these data were not used with MG5. The gray dashed line is the identity function (Predicted LR = Observed LR). Cochrane et al. (1980) suggested that their formula should not be evaluated for lime rates greater than twice the initial exchangeable acidity. Such lime rates result in about 5% acidity saturation or less (Fig. 1). Therefore, we recommend restricting the use of the Cochrane et al. (1980) model (and any other acidity saturation model) to a TAS ≥ 5%. Accordingly, we only evaluated models based on TAS for cases in which liming led to a final AS ≥ 5%, as lower AS values should not be the target of these models (Fig. 2). A model with a target pH of 6 might be more appropriate for extremely sensitive crops requiring an acidity saturation of < 5%, as exchangeable acidity is negligible at this pH (Supplementary Fig. 1)."},{"index":7,"size":282,"text":"We found several instances in the literature where the rule of changing the lime factor at low TAS in Eq. ( 3) was misused or ignored. First, Cochrane et al. (1980) inconsistently applied this rule when testing the performance of their model, perhaps to improve its apparent accuracy (Fig. 2). Second, later modifications and references to this model did not include the rule (Alvarez and Ribeiro, 1999;Osmond et al., 2002;Yost et al., 1988). For instance, Sanchez (2019) and Fageria and Baligar (2008) described the formula with a unique lf = 1.8, which results from multiplying the original lf of 1.5 by 1.2 to express the LR in tons per hectare by assuming a soil bulk density (sbd) of 1.2 g cm − 3 and a lime incorporation depth (ld) of 20 cm (Eq. ( 1)). Despite these inconsistencies, the Cochrane et al. (1980) model has high accuracy, even when evaluated with independent data (Table 2), and it represented a breakthrough in computing lime requirements. All subsequent models based on TAS derive from it. Yost et al. (1988) developed the ACID4 expert system to estimate lime requirement in the humid tropics. They used the Cochrane et al. (1980) formula with a fixed lime factor (lf) and a unit conversion from cmol c kg − 1 to t ha − 1 . Based on preliminary data from Sitiung, Indonesia, Yost et al. (1988) estimated that 0.53 cmol c of exchangeable acidity was neutralized per cmol c of CaCO 3 and computed the lf as the inverse of that fraction (1/0.53 = 1.9). The accuracy of their model was slightly lower than that of the Cochrane et al. (1980) model (Fig. 2 and Table 2)."}]},{"head":"ACID4 model","index":16,"paragraphs":[{"index":1,"size":135,"text":"To convert the results from cmol c kg − 1 to tons of CaCO 3 per ha, Yost et al. (1988) changed the lf to 1.4, assuming sbd = 1 g cm − 3 and ld = 15 cm (Eq. ( 1)). Several authors have used such arbitrary sbd and a fixed ld to estimate the lime requirement in tons per ha (Osmond et al., 2002;Sanchez, 2019;Yost et al., 1988). However, this practice should be avoided because it greatly affects the results. For example, a soil with sbd = 1.2 g cm − 3 requires 20% more lime than one with the same chemical properties and sbd = 1 g cm − 3 , and the amount of lime required with ld = 15 cm is 25% less than with a ld = 20 cm."}]},{"head":"NuMaSS model","index":17,"paragraphs":[{"index":1,"size":125,"text":"The Integrated Soil Nutrient Management Decision Support System (NuMaSS) was developed to provide fertilizer (N and P) and liming recommendations for acid soils with nutrient problems (Osmond et al., 2002;Walker et al., 2009). In NuMaSS, soil N, P, and acidity constraints are computed individually. Then, the final management recommendation is computed by considering the costs and benefits of different nutrient management strategies. The acidity module considers Al toxicity and deficiencies of Ca and Mg, although the main focus was on Al toxicity. Al toxicity is computed based on crop critical acidity saturation, exchangeable acidity, and ECEC. Default crop critical acidity saturation values for many crops and varieties were included. The lime rate was calculated with another modified Cochrane et al. (1980) formula (Eq. ( 4))."},{"index":2,"size":125,"text":"where clay is the clay content in the soil. This model uses different lime factors depending on the soil's clay activity (effective cation exchange capacity of the soil's clay fraction). According to its authors, soils with low clay activity (i.e., low ECEC per unit of clay) require almost twice the lime amount of soils with high clay activity (i.e., high ECEC per unit of clay) to neutralize the same amount of exchangeable acidity charges. In addition, they considered that reducing the acidity saturation below 19% requires an additional amount of lime equivalent to 10% of the ECEC per percentage point. The NuMaSS model predicts lime rates in tons per hectare by assuming ld = 15 cm and sbd = 1 g cm − 3 ."},{"index":3,"size":69,"text":"To test the NuMaSS model with the soil incubation studies data, the predicted LR was transformed from t ha − 1 to cmol c kg − 1 (Eq. ( 1)). Moreover, to take advantage of all the data while being conservative in the lime requirement prediction, high clay activity (lowest lf and lower LR) was assumed when data on soil clay content were not available (Table 1, Fig. 2)."},{"index":4,"size":105,"text":"The NuMaSS formula adds much complexity to the formula of Cochrane et al. (1980). It considers that the acidity saturation response to increasing lime rates is not linear and that the response depends on a soil's clay activity. However, in our analysis, NuMaSS consistently overpredicted the lime rates required to reach a certain level of acidity saturation (Fig. 2), particularly for low TAS (<10%), indicating that the second term of the formula for TAS < 19% should be revised or omitted. Unfortunately, the software is no longer available, and the data used to derive the formula are unavailable, so the model cannot be further scrutinized."}]},{"head":"Table 2","index":18,"paragraphs":[{"index":1,"size":141,"text":"Accuracy metrics of lime requirement models. The models were evaluated in their capacity to predict the lime rate used to reach a given soil response. Accuracy metrics were computed with all data and with independent data (i.e., data not used to calibrate the model). Study-based cross-validation was used to evaluate the new model (LiTAS) and six-fold cross-validation for the Teixeira et al. (2020b) model. The accuracy metrics were the concordance correlation coefficient (r c ), the average model bias (observed minus predicted), the root mean square error (RMSE), and the average RSME across datasets (RMSE avg ). The closer the r c is to 1, the better, and the closer the Bias, RMSE, and RMSE avg are to 0, the better. The accuracy metrics of the Quaggio model are also reported for a final base saturation equal to or below 50%. "}]},{"head":"Minas Gerais 5th approximation model","index":19,"paragraphs":[{"index":1,"size":71,"text":"This Minas Gerais 5th approximation (MG5) model developed for the state of Minas Gerais, Brazil (Alvarez and Ribeiro, 1999) also has two terms, one of them deriving from the model of Cochrane et al. (1980). It considers the lime rate needed to lower the acidity saturation of the soil to a target level, as well as possible Ca and Mg deficiencies for the crop. The formula can be written as follows:"},{"index":2,"size":110,"text":"where X is the sum of the minimum quantity of exchangeable Ca and Mg required by the crop (estimated as 2 cmol c kg − 1 for most cereals and legumes and 3 cmol c kg − 1 for most fruits and vegetables, Alvarez and Ribeiro, 1999). Note that the second term of the formula becomes zero when the initial exchangeable Ca 2+ and Mg 2+ meet crop demands, while the first term is equal to the model of Cochrane et al. (1980) but with a different lime factor that depends on soil texture. The lf can take any value between 0 and 4, with higher values in clay soils."},{"index":3,"size":116,"text":"The Kamprath (1970) and Cochrane et al. (1980) soil incubation studies data show very little support for such a drastic change in lf (Fig. 2 and Table 2). Furthermore, the addition of the second term in (Eq. ( 5)) has no theoretical justification because, while the carbonate of the CaCO 3 precipitates the exchangeable aluminum (forming aluminum hydroxide), the Ca 2+ stays in the cation exchange complex and becomes available for the crop (Sanchez, 2019). Therefore, adjusting for possible Ca and Mg deficiencies would be more appropriate when the sum of the initial exchangeable Ca 2+ and Mg 2+ and the Ca 2+ or Mg 2+ supplied by the liming material does not meet crop demand."}]},{"head":"LiTAS: A new model to estimate lime requirements","index":20,"paragraphs":[{"index":1,"size":106,"text":"Defining a target acidity saturation and estimating lime rates as a function of that target is a useful concept. Presumably, new models were derived from the Cochrane et al. (1980) model because of perceived shortcomings (e.g., fixed lf of 1.5 or 2). However, while more complicated, the derived models did not improve the prediction accuracy (Fig. 2 and Table 2). Below we introduce LiTAS, a new lime requirement model based on TAS obtained from a formal mathematical derivation of the concept of acidity saturation. Our goal is to provide a model based on strong empirical relations that can be easily updated as more data become available."},{"index":2,"size":33,"text":"First, let us decompose the numerator and denominator of final acidity saturation (AS f (%) = exch.acid f ECEC f × 100%) into their initial values and degree of change (Eq. ( 6))."},{"index":3,"size":67,"text":"Δexch. acid is the exchangeable acidity neutralized by liming (cmol c kg − 1 ), and ΔECEC is the change in the effective cation exchange capacity, which equals the difference between the increase in exchangeable bases (Δexch. bases) minus the neutralized exchangeable acidity (Δexch. acid). ΔECEC is usually positive (Δexch. bases > Δexch. acid) because ECEC increases at higher pH; thus, it increases with liming (Edmeades, 1982)."},{"index":4,"size":55,"text":"Considering that our goal is to make the final acidity saturation equal to the target acidity saturation (AS f = TAS), AS f can be replaced with TAS in Eq. ( 7). Then, TAS becomes a function of the initial soil properties (ECEC i and exch. acid i ), the increase in exchangeable bases (Δexch."},{"index":5,"size":106,"text":"bases), and the exchangeable acidity neutralized (Δexch. acid). Therefore, to estimate the required LR to reach a given TAS, we need to find the association of Δexch. acid and Δexch. bases with LR so that the two former variables can be replaced for some function of LR in Eq. ( 7). For soils with AS f ≥ 5%, these two associations can be modeled with a linear regression without intercept (Fig. 3), despite slight but significant differences between studies. In Fig. 3B, the exchangeable bases increase per unit of applied lime is higher for Teixeira et al. (2020a) observations than for Kamprath (1970) (P < 0.001)."},{"index":6,"size":6,"text":"Based on this assumption, we have:"},{"index":7,"size":18,"text":"We replace the deltas in Eq. ( 7) with Eq. ( 8) and Eq. ( 9) to obtain:"},{"index":8,"size":7,"text":"And we solve for LR to get"},{"index":9,"size":135,"text":"Based on the soil incubation studies data and the regression lines shown in Fig. 3, the parameter estimates for a and b were 0.60 and 0.92, respectively. These unit-less parameters were estimated using the square root of the values to reduce the leverage of very high LR values and then back-transformed. Note that a, which is the cmol c of exchangeable acidity neutralized per cmol c of CaCO 3 , is similar to the value reported by Yost et al. (1988), which was 0.53. These values can be updated or calibrated for a particular region. Moreover, if new evidence refutes the assumption of a linear association between LR and the change in exchangeable bases and acidity, all formulas from Eq. ( 7) onwards would need to be updated, but the framework would remain the same."},{"index":10,"size":121,"text":"Notably, the numerator in Eq. ( 11) is the same subtraction term found in the model of Cochrane et al. (1980) and all other models derived from it. Hence, if Eq. ( 11) is rewritten by splitting the numerator and denominator, the inverse of the denominator can be interpreted as a new lime factor (lf), which is an inverse function of TAS (Eq. ( 12)). Although the lf derived in Eq. ( 12) is very different conceptually from the lf introduced by Cochrane et al. (1980;Eq. ( 3)), its possible values are similar to those used by previous models. Given our estimates of parameters a and b, the value of the lf would be between 1.5 and 1.6 for most crops."}]},{"head":"LR","index":21,"paragraphs":[{"index":1,"size":1,"text":"("},{"index":2,"size":85,"text":"The LiTAS model has greater accuracy than the Cochrane model and all other models derived from it (Fig. 2 and Table 2). The accuracy improvement was also evident when the model was evaluated with independent data, that is when calibrating and testing the models with data from different studies (Table 2). Therefore, the LiTAS model has improved accuracy and general validity because there was no accuracy loss when fitting the model with data from one region and then making predictions for soils from another region."}]},{"head":"Base saturation model","index":22,"paragraphs":[{"index":1,"size":45,"text":"A \"base saturation\" model originally proposed by Quaggio (1983) is widely used in São Paulo state, Brazil (Sanchez, 2019;van Raij, 1996). Base saturation (V) is the sum of exchangeable bases over CEC 7 , expressed as a percentage (see section 2.1.3). The model's formula is"},{"index":2,"size":119,"text":"V t is the target, and V i is the initial base saturation. Like TAS, V t is cropspecific and expresses a crop's sensitivity to soil acidity. In São Paulo, Brazil, V t is 50% for most cereals and legumes, including maize, wheat, rice, sorghum, soybeans, and beans, while it is between 60% and 80% for most fruits and vegetables (Alvarez and Ribeiro, 1999;Sanchez, 2019). Since CEC 7 is, in principle, not affected by liming (contrary to ECEC), CEC 7 can be distributed to V t and V i in Eq. ( 13) and canceled out. Thus, the lime requirement estimated by this model is equal to the difference between the target and the initial sum of exchangeable bases:"},{"index":3,"size":267,"text":"The base saturation model implicitly assumes that all Ca 2+ (and Mg 2+ ) positive charges from the lime become part of the exchangeable complex (Quaggio, 1983). Fig. 3B shows the association between observed LR and Δexch. bases for soil samples with AS f ≥ 5%. Fig. 4 expands that association to all soil samples with LR equal to or lower than the initial potential acidity (pot. acid i = CEC 7 -exch. bases i ). It excludes soil samples with LR > pot. acid i because the increase in exchangeable bases cannot be greater than what the cation exchange complex can take. When LR ≤ 50% pot. acid i , there is almost a one-to-one association between the lime rate and the increase in exchangeable bases charges (Δexch. bases = LR × 0.95(±0.05) ∀ LR < 0.5 × pot. acid i , Fig. 4), supporting the base saturation model assumption. However, as the lime rate approaches the potential acidity, that association becomes weaker (Δexch. bases = LR × 0.8(±0.03) ∀ 0.5 × pot acid i < LR < pot acid i , Fig. 4). Thus, this model yields a final base saturation close to the target when V t ≤ 50%, but it does not perform well at higher base saturation targets (Table 2). Consequently, in the future, a liming correction factor (lf) that depends on V t could be considered for the model. For example, the lf could be 1.05 when V t ≤ 50% (i.e., 1/0.95) and then slightly increase as V t approaches 100%, with a maximum V t of 1.25 (i.e., 1/0.8)."}]},{"head":"Target pH model","index":23,"paragraphs":[]},{"head":"Teixeira model","index":24,"paragraphs":[{"index":1,"size":336,"text":"Teixeira et al. (2020b) developed a lime requirement model that targets raising the soil pH to a level considered optimal for crop production. The model is based on four nonlinear models that relate the difference between the initial pH and two target pHs (5.8 and 6) with either organic matter content (OM, g kg − 1 ) or potential acidity (Eq. ( 15)). It also considers that the lime rate must be greater than the Ca and Mg requirement of the crop (X) and lower than the potential acidity of the soil (pot. acid i ). Thus, the estimated lime requirement results from a series of rules such that it selects the lowest LR from the four nonlinear models that is higher than X and lower than pot. acid i . When no model returns a lime rate higher than X, the estimated LR is X. If the selected LR (either from the models or X) is greater than the initial potential acidity of the soil, the estimated LR equals pot. acid i . This model always recommends liming because the Ca and Mg available in the soil are ignored when computing crop requirements, and it thus assumes that all Ca and Fig. 3. (A) Exchangeable acidity neutralized (Δexch. acid, cmol c kg − 1 ) and (B) exchangeable bases increase (Δexch. bases, cmol c kg − 1 ) as a function of the lime rate (LR, cmol c kg − 1 ), for soil samples with a final acidity saturation ≥ 5%. The lines are regression lines forced through the origin (equations shown in the plot). To avoid the high leverage of soil samples with the highest LR, LR and Δs were transformed with the square root before linear regression fitting, and then the coefficients estimates were back-transformed. The coefficient of determination was computed as the square of Pearson's correlation coefficient between observed and linear regression-predicted values. Data extracted from Kamprath (1970)   (1991). Soil samples with lime rates higher than the potential acidity were omitted."},{"index":2,"size":9,"text":"F. Aramburu Merlos et al. Geoderma 432 (2023) 116421"},{"index":3,"size":33,"text":"Mg must be provided by liming. Therefore, the minimum lime rate is X (Ca and Mg crop requirements), except when X is higher than pot. acid, in which case LR = pot. acid."},{"index":4,"size":112,"text":"The model parameters were calibrated with the same soil incubation study data from Teixeira et al. (2020a). However, these authors excluded data from five soils from the calibration because they considered that these observations deviated too much from the nonlinear regression models compared to the data from other soils. We tested the model with six-fold cross-validation using data from Teixeira et al. (2020a), including the observations excluded in the original calibration by Teixeira et al. (2020b;Fig. 5). The target pH model has much lower accuracy than all other models above (Table 2). Furthermore, as the model selects the minimum LR from the nonlinear models instead of the average, it often underpredicts LR."},{"index":5,"size":138,"text":"The Teixeira et al. (2020b) model is the most recent of a large number of regression models based on a target pH developed for acid soils in Brazil (see, for example, Combatt Caballero et al., 2019). These models use linear or nonlinear regression with variables such as ΔpH, organic matter, potential acidity, and base saturation to predict lime rates for a particular region. However, when tested with an independent dataset, these models have low accuracy (Teixeira et al., 2020a), which might be related to the many factors affecting soil pH. Most likely, no simple model can predict soil pH responses to liming for different soil types with regular soil testing data. Incorporating additional soil properties that measure the soil acid-base buffering capacity into routine soil tests could help develop better predictive liming-soil pH models (Yang et al., 2020)."}]},{"head":"Buffer capacity models","index":25,"paragraphs":[{"index":1,"size":232,"text":"One of the most straightforward and oldest methods to determine the lime required to raise the pH to a specific level is to take a soil sample and measure the quantity of base required to produce that pH change by a slow titration in the lab (Pierre and Worley, 1928). The amount of lime required to be added to the soil per unit of pH increase is known as the lime-based buffer capacity of the soil, which is calculated from the slowtitration curve, adjusting for soil bulk density and lime incorporation depth (Strawn et al., 2019). However, this method is time-consuming and requires great experimental precision, which makes it impractical for soil-testing purposes across large areas (Strawn et al., 2019). Therefore, the calibration curves from the titration of a few soils are commonly used to estimate the lime requirements of similar soils from the same geographic region, and buffer capacity information is not available in spatial databases of soil properties that cover the tropics (Hengl et al., 2017;Leenaars et al., 2014;Miller et al., 2021). As we only focused on lime requirement models based on soil properties for which estimates are available in spatial databases for any location, we did not assess the accuracy of the buffer capacity method, but we still mentioned it because of its widespread use and relevance (Jansen van Rensburg et al., 2009;Nelson et al., 2010;Taye et al., 2020)."}]},{"head":"Case study","index":26,"paragraphs":[{"index":1,"size":213,"text":"We computed lime requirements for 303 African soils of pH between 3.5 and 6.5 (Supplementary Fig. 2 and Supplementary Table 1) with the models reviewed in Section 4 for two representative crops with different acidity tolerance. We selected maize as the more tolerant crop and groundnut as the more sensitive crop and defined the target soil properties based on the values suggested by Alvarez and Ribeiro (1999). A 15% target acidity saturation (TAS) and a 50% target base saturation (V t ) were defined for maize, and a 5% TAS and 70% V t for groundnut. Although we refer to two specific crops, these are common critical acidity values of many other cereal and legume crops. Models targeting pH were not included because these models are location-specific and have low accuracy when extrapolated to other regions (Fig. 5 and Table 2). Lime rates were computed in cmol c kg − 1 because only 27% of these soil profiles had soil bulk density data. We used these lime rate estimates to illustrate the magnitude of variation in lime requirements between the different models. We first compared models with the same target soil chemical property (i.e., acidity saturation models) and second two models with different targets (i.e., one acidity saturation vs. one base saturation model)."},{"index":2,"size":123,"text":"Of the acidity saturation models, Kamprath, Cochrane, ACID4, and LiTAS estimated very similar lime rates, while the NuMaSS and Minas Gerais 5th approximation predicted larger lime rates (Supplementary Figs. 3 and 4). Despite the high correlation and similarities between the first group of models mentioned above, there were some consistent differences. For instance, the Kamprath model estimated higher lime rates than the other three models in all soil samples for the sensitive crop and in most soils for the tolerant crop, with differences up to 3.9 cmol c kg − 1 . In contrast, the LiTAS model estimated lower lime rates than other models on average and for most soils, with larger differences for the more sensitive crop (Supplementary Figs. 3 and 4)."},{"index":3,"size":161,"text":"We also contrasted the lime rates estimated by the LiTAS model and Quaggio's (1983) base saturation model for the two crop examples and the 303 African soils. The most striking difference was that the base saturation model recommended liming for many soils that did not require liming according to the acidity saturation model (Fig. 6). For instance, both models agreed that no lime was needed for maize in 18.5% of the soils. However, 31% of the soils required liming according to the base saturation model but did not need to be limed according to the acidity saturation model. In contrast, only 1.7% of the soils required liming based on acidity saturation but did not require lime based on their base saturation (Fig. 6A). The disagreement on the soils requiring liming based on the different target soil properties resulted from the large proportion of soils with an acidity saturation lower than 15% but a base saturation lower than 50% (Supplementary Fig. 5)."},{"index":4,"size":153,"text":"Moreover, the base saturation model predicted lime rates as high as 12 cmol c kg − 1 for soils with a pH higher than 6, indicating that even these soils can have a low base saturation, while virtually no soil with such a pH required liming based on acidity saturation (Supplementary Fig. 6). For soils that required liming based on both their acidity and base saturation, the estimated lime rates by the two models were weakly correlated (r = 0.43) but comparable in magnitude (mean difference = 0.47 cmol c kg − 1 ). The acidity saturation model predicted higher lime rates in soils with very low pH for the more tolerant crop (Fig. 6A), but the rates were more similar for the more sensitive crop (Fig. 6B). Conversely, the base saturation model predicted higher lime rates for most soils with a pH above 5, particularly for the more sensitive crop (Fig. 6B)."}]},{"head":"Discussion","index":27,"paragraphs":[]},{"head":"Model comparison","index":28,"paragraphs":[{"index":1,"size":142,"text":"We showed important differences between models in the accuracy of the required lime rates. When the target is to reduce the Al toxicity by neutralizing its acidity saturation to a certain level, both Kamprath (1970) and Cochrane et al. (1980) models were reasonably accurate. Nevertheless, our new model (LiTAS) offers improved accuracy and the advantage of being based on a formal mathematical derivation that can be expanded. Similarly, the base saturation model also had high prediction accuracy, particularly for target base saturation levels of around 50%. In contrast, models based on a target pH can only deliver accurate results when coupled with additional soil tests, such as slow titrations that estimate the soil buffer capacity. These tests need to be developed locally, and the calibrated model is only useful for similar soils of the same geographic region (Sims, 1996;Strawn et al., 2019)."},{"index":2,"size":192,"text":"LiTAS was the only model based on a target acidity saturation (TAS) with greater accuracy than the original Cochrane et al. (1980) model. The authors of the ACID4, NuMaSS, and MG5 models claimed that they modified the Cochrane et al. (1980) model to improve the accuracy for their target region. Unfortunately, we did not have access to the data used by these authors, but we suspect that these more complex models suffer from overfitting the datasets used to develop them. In other words, they may have performed better for particular datasets from particular regions, but this has come at the expense of general validity. Conversely, the LiTAS model was robust to changes in the data used to calibrate it, being more accurate than previous models even when evaluated with an independent dataset, that is, data from a study that was not used to calibrate it. The general validity we observed in the new and other acidity saturation models might be related to the strong association between lime rates and the increase or decrease in exchangeable acidity and bases, which were consistent for all soils from the different regions included in the analysis."},{"index":3,"size":171,"text":"We observed a small incubation study effect in our model accuracy assessment. This might be a consequence of the soil region (parental material) or, more likely, because of the incubation study per se (differences in the liming material or soil incubation method). Experimental results have an error component, including systematic errors that are consistent within one experiment but differ between experiments, introducing statistical bias. This bias can be reduced with standardized procedures. However, lime incubation studies are not fully standardized and differ in the incubation time and temperature, liming materials, and water additions, among other variables (Salinas, 1978). For instance, we excluded data from an incubation study in which control treatments had significantly more exchangeable Ca 2+ and less exchangeable acidity than the initial conditions, likely a consequence of using tap water rather than distilled water to keep the soil samples moist during the incubation (Deressa et al., 2020). A more thorough standardization of experimental procedures for measuring liming effects would help the development of general models for lime requirement estimation."},{"index":4,"size":187,"text":"A novel feature of the LiTAS model is that the lime factor (lf) is a continuous function of TAS. The Cochrane et al. (1980) model modifies the lf depending on TAS and the initial acidity saturation, using a discontinuous rule with two fixed levels of lf. However, the proposed rule did not always improve accuracy, not even for Cochrane et al.'s own data. In the MG5 and NuMaSS methods, the lf depends on clay content or activity. Our review does not show evidence for a need to adjust the lf as a function of clay, despite the wide range of clay content and soils included in the four soil incubation studies used here. Adjusting the lf and lime rates by clay content might be a workaround to account for differences in soil bulk density when the method returns lime rates in tons per ha without directly including the soil bulk density in the formulas. Nevertheless, clay type and content could be considered in future corrections of the TAS method, particularly if there are high deviations in the association between lime rate and Δexch. acid and Δexch. bases."}]},{"head":"LR (V T = 50) LR (TAS = 15)","index":29,"paragraphs":[{"index":1,"size":166,"text":"LR (V T = 70) LR (TAS = 05) Fig. 6. Estimated lime rates (LR, cmol c kg − 1 ) for 303 African soils with pH between 3.5 and 6.5, two target soil chemical properties: a target base saturation (V t , xaxis) and a target acidity saturation (TAS, y-axis), and two representative crops: (A) maize (TAS = 15% and V t = 50%) and (B) groundnut (TAS = 5% and V t = 70%). The red dashed line is the identity function (LR (TAS) = LR (Vt) ). The values inside the plot indicate the fraction of soils in a specific scatter plot position: the origin (0;0), the x-axis (x;0), between the x-axis and the identity function (x > y, lower triangle), between the identity function and the y-axis (x < y, upper triangle), and the yaxis (0;y). Lime rates based on TAS were predicted with the acidity saturation model presented in Eq. ( 12), and LR based on V t with Quaggio (1983)."},{"index":2,"size":246,"text":"It seems counterintuitive that while both the acidity saturation and base saturation models were highly accurate for their target, the lime requirements they predicted were sharply different. These differences highlight the importance of identifying the soil chemical property most associated with the crop yield response to liming. Tropical soils can have several acidity problems affecting crop growth (Kamprath, 1984;Sanchez, 2019). It might be that reaching a given level for some property, such as a base saturation of 50% or a pH of 5.5, guarantees that all soil acidity problems are solved without leading to overliming problems. However, this approach can also result in lime requirement estimates that are much too high (Farina and Channon, 1991;Smyth and Cravo, 1992), which might be particularly problematic when lime is expensive and its manipulation cumbersome. The alternative is to target the most limiting factor for crop yield, which is frequently Al toxicity in acid tropical soils (Sanchez, 2019). However, this approach can underpredict lime requirements when Al toxicity is the only target but not the acidity problem most limiting crop yields. A comprehensive approach would predict the lime rate needed to tackle every acidity problem while considering other management alternatives. However, crop responses to other acidity problems, such as Ca and Mg deficiencies, are unclear, and their liming requirements have not been defined. Thus, more research on crop responses to lime in soils with these specific acidity problems is needed to develop a lime requirement method that tackles them all."}]},{"head":"Model applications","index":30,"paragraphs":[{"index":1,"size":195,"text":"Lime requirement models can be useful for strategic research on potential lime use in tropical regions where liming is still rare and experimental evidence is scarce (Crawford et al., 2008). These models estimate the lime rate needed to reach a target soil condition based on readily available standard soil data (Hengl et al., 2017;Miller et al., 2021). Such information could be used with the crop response to that soil condition to estimate the effect of liming on crop yield. For instance, there is ample evidence of the association between acidity saturation and crop yields (Abruña et al., 1969;Farina and Channon, 1991;Lollato et al., 2019;Smyth and Cravo, 1992). Therefore, the expected yield response to lime can be predicted by estimating what fraction of the maximum yield is observed at the current acidity saturation level while assuming that the final yield after liming is the inverse of that fraction. If data on lime and grain prices are available, such functions can be used to get a first approximation of the profitability of liming (Bonilla-Cedrez et al., 2021). Such analysis can help identify regions where liming investments might be more successful, pinpointing national governments and private sector efforts."},{"index":2,"size":211,"text":"However, this does not mean that the quality of the readily available soil data used by the models reviewed here is sufficient for farm-level recommendations (Vanlauwe et al., 2019). Soil pH is the most commonly measured soil property related to soil acidity, and it is, therefore, likely that estimates of pH in spatial databases of soil properties are relatively accurate. However, soil pH alone cannot be used to estimate lime requirements (Sanchez, 2019;Sims, 1996). Soil pH can be used only to detect potential soil acidity problems because not all tropical soils with low pH (pH < 5.5) might require lime. Measuring and mapping other key soil chemical properties, such as exchangeable acidity and ECEC, could help the development of site-specific lime recommendations. In the meantime, farm-level lime requirement estimates need to be informed by locally measured soil properties and could also consider additional local soil-quality indicators, such as soil color, soil texture, or the presence of specific plant species (Mairura et al., 2007). The soil properties used by the lime requirement models reviewed here are wet-lab measurements, which are costly and may be inaccessible for farmers in the tropics. Therefore, farmers in the tropics could benefit from cost-effective, quick tests for lime requirement prediction, but these need to be developed locally."}]},{"head":"Conclusions","index":31,"paragraphs":[{"index":1,"size":146,"text":"Liming can increase crop productivity in acid soils, but the lime rate required to achieve this is unknown for many tropical regions. While lime requirement models could be very useful, the proliferation of models introduces uncertainty about which model to use. We discussed the strengths and weaknesses of various lime requirement models that can be used with data readily available in spatial soil databases. We showed important differences in the amount of lime required according to these models, especially when considering different target soil chemical properties. LiTAS, the new acidity saturation model introduced here, is more accurate than all prior models across many acid tropical soils from different regions and can effectively estimate the lime rate required to lower the acidity saturation to a specific target. This model could be incorporated into more comprehensive models once lime rates needed for other acidity problems are well established."}]}],"figures":[{"text":"Fig. 1 . Fig. 1. Acidity saturation after liming (AS f , %) as a function of the lime rate (LR, cmol c kg − 1 ) divided by the initial exchangeable acidity of the soil (exch. acid i , cmol c kg − 1 ) for soils with an initial acidity saturation >30%. Data were extracted from Kamprath (1970) (Kamp.), Cochrane et al. (1980) (Coch.), Ananthacumaraswamy and Baker (1991) (Anan.), and Teixeira et al. (2020a) (Teix.). The solid line is a negative exponential regression line AS f (%) = "},{"text":"Fig. 4 . Fig. 3. (A)Exchangeable acidity neutralized (Δexch. acid, cmol c kg − 1 ) and (B) exchangeable bases increase (Δexch. bases, cmol c kg − 1 ) as a function of the lime rate (LR, cmol c kg − 1 ), for soil samples with a final acidity saturation ≥ 5%. The lines are regression lines forced through the origin (equations shown in the plot). To avoid the high leverage of soil samples with the highest LR, LR and Δs were transformed with the square root before linear regression fitting, and then the coefficients estimates were back-transformed. The coefficient of determination was computed as the square of Pearson's correlation coefficient between observed and linear regression-predicted values. Data extracted fromKamprath (1970) (Kamp.), Cochrane et al. (1980) (Coch.), Ananthacumaraswamy and Baker (1991) (Anan.), and Teixeira et al. (2020) (Teix.). "},{"text":"Fig. 5 . Fig. 5. Predicted lime rate (LR) to reach a pH of 5.8 by Teixeira et al. (2020b) as a function of the observed LR that resulted in such a pH. The gray dashed line is the identity function (Predicted LR = Observed LR). "}],"sieverID":"ea300840-907e-4f56-bdc6-258a6eb08ebc","abstract":"Acid tropical soils may become more productive when treated with agricultural lime, but optimal lime rates have yet to be determined in many tropical regions. In these regions, lime rates can be estimated with lime requirement models based on widely available soil data. We reviewed seven of these models and introduced a new model (LiTAS). We evaluated the models' ability to predict the amount of lime needed to reach a target change in soil chemical properties with data from four soil incubation studies covering 31 soil types. Two foundational models, one targeting acidity saturation and the other targeting base saturation, were more accurate than the five models that were derived from them, while the LiTAS model was the most accurate. The models were used to estimate lime requirements for 303 African soil samples. We found large differences in the estimated lime rates depending on the target soil chemical property of the model. Therefore, an important first step in formulating liming recommendations is to clearly identify the soil property of interest and the target value that needs to be reached. While the LiTAS model can be useful for strategic research, more information on acidity-related problems other than aluminum toxicity is needed to comprehensively assess the benefits of liming."}

data/part_3/0346321e6153651dac6ccadf7e571823.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0346321e6153651dac6ccadf7e571823","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7447687a-efde-44bc-94f9-abc7c8bbec80/retrieve"},"pageCount":64,"title":"The synthesis was provided by Dr. Agnes Rola of UPLB. For more information on the background of the speakers, please refer to Annex 2. Time Activity Person Responsible 1:30-1:35 Welcome and Introductions Moderators Dr. Samarendu Mohanty and Dr. Sampriti Baruah 1:35-1:45 Keynote address Dr. William Dar Secretary, Department of Agriculture 1:45-2:25 Presentation from panelist (10 minutes each)","keywords":[],"chapters":[{"head":"BACKGROUND","index":1,"paragraphs":[{"index":1,"size":48,"text":"The Philippines is considered one of the most vulnerable countries in the region with rising sea level, rising temperature and more frequent occurrence of extreme weather events including flood and drought. Agriculture is one of the most affected sectors to climate change especially due to extreme weather events."},{"index":2,"size":49,"text":"Farmers identify rising rainfall variability and frequent occurrence of drought as the two most important climate change induced challenges faced by them. Crop diversification, often touted as a key strategy to achieve climate resilience, haven't made headway because of non-availability of high-quality climate resilient seeds and weak market linkages."},{"index":3,"size":52,"text":"The current administration, led by Secretary Dr. William Dar, recently announced the establishment of a National Seed Technology Park in an effort to bring all key players in the seed industry together to ensure that good quality and certified seeds are available to farmers in a timely fashion and at affordable price."},{"index":4,"size":46,"text":"The growing importance of women in the Philippine agriculture makes it imperative that the gender perspectives are integrated in crafting a climate Smart seed system. The webinar provided a platform for discussing the role of women in developing a climate smart seed system in the Philippines."},{"index":5,"size":5,"text":"The webinar specific objectives included:"},{"index":6,"size":40,"text":"1. The use a gender lens on farmers access to and control of seed; 2. The participation of women in commercial seed production; and 3. The climate smart seed system development on the reach, benefit and empowerment of women farmers."},{"index":7,"size":67,"text":"The target output was developing a policy environment in the Philippines where gender equality drives transformation towards equitable, sustainable, productive and climate resilient seed systems. This is the first webinar series organized by the International Potato Center (CIP) and Climate Change, Agriculture and Food Security (CCAFS) in partnership with the Department of Science and Technology -Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (DOST-PCAARRD)."}]},{"head":"Program","index":2,"paragraphs":[{"index":1,"size":100,"text":"The program of activities during the webinar is shown below. Please refer to Annex 1 for a copy of the concept note and program. The webinar was moderated by Dr. Samarendu Mohanty, Regional Director for CIP Asia, and Dr. Sampriti Baruah, Project Coordinator for CIP Asia. The keynote address was given by the honorable secretary of the Department of Agriculture of the Philippines, Dr. William Dolente Dar. The invited resource persons came from government agencies (Dr. Ernesto Brown from DOST-PCAARRD and Dr. Rosana Mula from the DA-ATI), non-government organization (Ms. Emilita Oro of IIRR), and industry (Dr. Mary Ann Sayoc)."}]},{"head":"Participants","index":3,"paragraphs":[{"index":1,"size":43,"text":"A total of 428 people from 11 countries participated in the webinar. This is out of the 632 people that registered in the event. Please refer to Annex 3 for the directory of participants. The breakdown of participants per country is listed below. "}]},{"head":"Countries Number of participants Percentage of participation","index":4,"paragraphs":[]},{"head":"HIGHLIGHTS OF THE MEETING","index":5,"paragraphs":[]},{"head":"Welcome and introductions","index":6,"paragraphs":[{"index":1,"size":202,"text":"The webinar was formally opened by a welcome address from Dr. Samarendu Mohanty. Dr. Mohanty thanked the audience from various countries for joining the webinar and welcomed them on behalf of the organizers -CIP, PCAARRD, and CCAFS to this first series of webinars. He also emphasized the timely importance of the topic, the role of women in developing climate-smart seed systems in the country. To provide background on the topic, he shared some facts on gender equality and women empowerment. He mentioned if gender equality and women empowerment is considered, there will be an additional 12 to 28 trillion US$ to global annual GDP. Women empowerment and gender equality can improve productivity and household food security. In the Philippines, female involvement in agriculture is declining with only 13% being employed in agriculture but global data shows that the female share in agriculture labor accounts for 40-50 % in southeast Asia. He shared that in the Philippines, gender equality and women empowerment is very different compared to other countries. Filipino women have equal access to and control of resources, have better decision-making contributions and have an active role in agriculture and seed system. Please see Annex 4 for the presentation of Dr. Mohanty."},{"index":2,"size":21,"text":"After the welcome message, Dr. Mohanty shared the housekeeping rules. Attendees were asked to write their questions in the chat box."}]},{"head":"Keynote address","index":7,"paragraphs":[{"index":1,"size":11,"text":"Dr. Sampriti Baruah introduced Dr. William Dar for his keynote address."},{"index":2,"size":171,"text":"Dr. Rosana Mula and Dr. Jojo Badiola (Executive Director of Agricultural Credit Policy Council) presented the keynote address on behalf of Dr. Dar. The keynote address focused on the Department of Agriculture credit program. They shared about the Agricultural Credit Policy Council lending program for women, specifically the \"Innovative Lending for Agribusiness for Women (ILAW) or Sure Women Loan Program to address the loss of income of the vulnerable sector in the time of COVID pandemic. The majority of the borrowers are women (almost 50%) with good repayment rates. The ILAW program is in recognition of the important role of women in the countryside. The program aims to amplify gender equality in agribusiness and promote women empowerment in agriculture and fisheries. Dr. Badiola shared the requirements for application, loanable amount, and the number of years for repayment. The loan can be used to finance the capital requirement of start-up or existing agrifishery-based income-generating activities (production, processing, marketing, and other on-farm/off-farm activities). Please see Annex 4 for the copy of the presentation."},{"index":3,"size":132,"text":"After the presentation, questions were taken. A participant raised a question on the basic requirements of the loan needed. Dr. Badiola responded that this includes one valid government identification card, the need to do the RSBSA registration, and the submission of a simple business plan. Succeeding questions raised were can a group of women avail the loan, can a wife of a fisherman also avail, does ACPC provide assistance in developing a business plan. Dr. Badiola answered all these questions with a yes. One participant asked what are the most common business in which one can apply for this loan. Dr. Badiola replied that these are any business that includes agricultural production, processing to marketing, including food products. The amount of the loan is up to 100,000 pesos (or 2000 US dollars)."},{"index":4,"size":27,"text":"It was fortunate that Dr. Dar was able to join the webinar for a short time to take some questions from the audience. Some questions raised were:"},{"index":5,"size":153,"text":"1. Is the credit program of ACPC available to the provincial agriculture technology coordinating office? He responded that the credit program is available to farmers and fisherfolks included women and those in micro and small agribusinesses nationwide. 2. Most of those registered in the RSBSA are men. How can women avail when they are not landowners? Dr. Dar answered that if they are women-farmers they should be registered in the RSBSA and they still have time to list up and work with the municipal agriculture officers so they can be listed in the farmer's registry. 3. If the client has no Pay Maya account, are there any other alternatives to receive the loan? He replied that ACPC is already looking to tap other lending institutions. 4. Can universities avail of the credit program for urban agriculture? Dr. Dar replied that urban agriculture is good for everyone and encourages universities to partner with DA."}]},{"head":"Presentation from panelists","index":8,"paragraphs":[{"index":1,"size":11,"text":"Dr. Sampriti Baruah introduced each of the panelists before their presentation."}]},{"head":"Dr. Ernesto Brown","index":9,"paragraphs":[{"index":1,"size":156,"text":"Director, SERD, PCAARRD Dr. Brown talked about the reasons for examining the role of women in developing climate-smart seed systems. The seed system is an important pillar of agriculture and is vulnerable to climate change. He mentioned that enhancing the role of women in developing a climate-smart seed system as a strategy is gaining much traction in underdeveloped and developing agricultural economic. He emphasized that where there is gender inequality there is food insecurity. He also provided a brief background of the seed system in the country in terms of its components which consist of the informal seed sector(farmers), formal seed sector (private companies), and integrated seed system (elements of both informal and formal seed sector). He mentioned the different challenges of the Philippine seed system amidst climate change which includes reduced seed yield and quality, potential loss of seed diversity, increased postharvest losses of seeds, and unpredictable weather conditions affect the planting system and calendar."},{"index":2,"size":185,"text":"After presenting the actors/processes in the seed value chain, he highlighted the role of women in the seed value chain and gender roles in agriculture (i.e. management of varietal diversity, pre-germination test, seed selection for self-saving and household consumption, seed marketing, etc.). Due to the lack of specific study on the current state of women in the seed system, Dr. Brown instead shared a regional study examining gender roles in agriculture using the women empowerment index. Based on this study, he concluded that women in Philippine agriculture are already empowered, and enhancing the role of women in the development of climate-smart seed system should no longer be about empowerment, but on capitalizing on their present role. He also mentioned the roles of women in agriculture in the midst of climate change. He enumerated the DOST-PCAARRD's initiatives towards gender-equitable agricultural development as well as their R&D and policy initiatives towards enhancing the role of women in developing climate-smart seed system. He also listed PCAARRD's involvement as part of the technical working group on the amendments to the Seed Industry Development Act. To end his presentation, Dr."},{"index":3,"size":91,"text":"Brown provided recommendations on R&D initiatives which include (1) integrating extensive research with a gender dimension, (2) addressing barriers in technology adoption, (3) gender-sensitive business models, (4) support greater women participation in all aspects of the seed value chain, and based of varietal options. The recommendations for policy and institutional initiatives, he proposed promoting a gender-sensitive approach in R&D and extension services, revisiting and/improving agrarian-related laws and credit policies, and their implementation, and putting more gender lens to the seed law. Please see Annex 4 for the copy of the presentation."}]},{"head":"Dr. Rosana Mula Assistant Director, DA-ATI","index":10,"paragraphs":[{"index":1,"size":30,"text":"Dr. Mula focused her talk on gender initiative of the DA-Agricultural Training Institute. The DA-ATI adhere to fully support gender inclusiveness by developing programs and projects on gender and development."},{"index":2,"size":225,"text":"Particularly, she mentioned about the explicit policy of ATI that they allot 40 to 50% recipients for women participation. It is a deliberate effort to support women for capacity building. The next topic she presented is on the National Seed Technology Park (NSTP) which is a recent initiative of the DA that aims to advance the seed industry by ensuring the use of high-quality seeds, modern technology processing, and facilitate market linkages. This is a collaborative initiative of different government institutions and the private sector. She also shared that women have key roles in the management of the NSTP with a start-up funding of 200 million pesos. Dr. Mula concluded by emphasizing the role of women in the seed system. She specifically mentioned that women are curators of community seed banks, handlers and processors of small grains, and a vital source of knowledge on seeds. She also shared on the role of women in widening the genetic base through innovative cropping systems. She expounded this by sharing her study on women growing patches of sweetpotato varieties for different purposes (i.e. food, animal feed, wine processing). She further stressed that women play a role in resource enhancement through their knowledge of seed selection, production, and exchange. She concluded that women are indispensable in ensuring food security. Please see Annex 4 for the copy of the presentation."}]},{"head":"Ms. Emilita Oro Country Director, IIRR","index":11,"paragraphs":[{"index":1,"size":119,"text":"Ms. Oro started by introducing her office, IIRR is a research and development organization with headquarters in the Philippines and operating in 8 countries in Asia and Africa. The Philippine program focus on food and nutrition security for resilient livelihoods and food systems addressing the needs of smallholder farmers, women, and youth. And with food and nutrition security, the concept of seed system through the crop museum is very important. She shared about the crop museum which is a decentralized facility for genetic resources conservation for local adaptation in communities, especially for crops that are important for food culture (loss or threatened to be lost), special because of its nutritional relevance, and climate-hardy varieties to address climate change impacts."},{"index":2,"size":307,"text":"Crop museum is not just a conservation site but also a propagation center of nutritionally relevant vegetables (i.e. amaranth, sweetpotato). This is also a living-learning site of genetic resources where women are very much interested. Seed banks are an important part of crop museum for seed saving practices and exchanges. Crop museums in school are one of the mature programs of IIRR. In the Philippines, the Department of Education has a program on school gardening for schools but sustainability is a problem because of limited/lack of seeds. Crop museum provides planting materials to address the issue of seeds, and have also provided for families during this pandemic for food and/or materials for their kitchen gardens. Ms. Oro said that \"we need more crop museums to be established in communities\". They have piloted a crop museum in one climate-smart village in Guinyangan, Quezon where farmers utilized as a learning laboratory and provided access to seeds to diversify their farms to reduce climate risks. In another community in Cavite, the women have strong roles in seed saving, management, and conservation. The crop museum is implemented within the context of the first 1000 days to improve access to nutritional crops (rich in vitamins and minerals) of pregnant/lactating mothers and children (2-5 years old). The role of women in this program is preparing and innovating preparations of vegetables and nutritional food coming from the crop museum. Crop museum aims to have nutrition outcomes and livelihood opportunities (selling seeds), especially for women. She concluded that IIRR is in partnership with local governments and schools in the country to have more crop museums, in fact, they have a distribution of diversity kits of local varieties in more schools and communities in the hope to contribute to better local seed and food systems nationwide. Please see Annex 4 for the copy of the presentation."}]},{"head":"Dr. Mary Ann Sayoc Public Affairs Lead, East-West Seed International","index":12,"paragraphs":[{"index":1,"size":331,"text":"Dr. Sayoc started her presentation by highlighting the key role of women in food production. She mentioned that women produce 50% of the world's food, and they comprise about 43% of the agricultural labor force. A seed is the starting point of the food system and women hold the potential of playing a crucial role in developing a climate-smart seed system. She also shared information on her company, the East West Seed which is a pioneer in introducing market-oriented plant breeding in South East Asia, they are a market leader in tropical vegetable seeds and facilitate business model centers focus on smallholder farmers. She highlighted that at East West Seed they support the social development to achieve gender equality and empower all women and girls thus, 1 out of 3 employees is a woman. A climate-smart seed system starts with plant breeding, at East West Seed in the Philippines, 83% of the plant breeders are women. Most key functions in the company are headed by women. Women farmers participate in participatory plant breeding, by providing feedback to plant breeders on the commercial selection of vegetable varieties. Women also participate in high breed seed production as pollinators (70%), where their production team prefers to hire women as pollinators as they have observed that women have tender hands, more patient, and persevering in finding female flowers and reliable on work attendance. Women also participate in knowledge transfer, not only as participants but also as farmer leaders and roving agents managing community-based agro shops. Dr. Sayoc concluded that the role of women in developing a climate-smart seed system needs to be recognized, where their role in agriculture is not merely complementary to men. She further stressed that there should be gender mainstreaming perspectives in the design of climate-smart seed system and all agricultural projects, and to provide institutional support to women farmers. In East West Seed, they have the power of women and resilience. Please see Annex 4 for the copy of the presentation."}]},{"head":"Question and answer","index":13,"paragraphs":[{"index":1,"size":180,"text":"Due to time constraints, the moderators have only selected questions to ask the panelist. However, Dr. Mohanty encouraged the panelists to check the chat box and answer questions directly. Question 3 for Dr. Mula: When do you expect the NSTP to be operational? Does NSTP cover all aspects of seed systems from breeding, product development, seed commercial production, seed health, quality assurance, marketing, and distribution? Can start-up companies avail of its business incubation function? How to avail NSTP's services? Answer: Several meetings are going on. We have just rolled out the simple survey and data are coming soon. When we say seed system, that includes all that was mentioned in the query. We are looking forward that the initial activities that will happen this year. We want to make sure that the planning part is very much in place, that why we are doing surveys, site visits to ensure that all stakeholders are represented int this project. Two hundred million has already been earmarked on this project, and this is only part of a big project at Clark Development Area."},{"index":2,"size":165,"text":"Question 4 for Dr. Brown: As you shared women are comparatively empowered in the Philippines that South Asia or Africa. Do you think there can be some challenges that can be barriers to capitalize on their existing strengths? Answer: Yes, while relatively women in the Philippines are more empowered than counterparts in South Asia and Africa, there are still works to be done. One is in the area of technology because our innovation system before does not have a gender lens so a lot of technologies missed this, so we are crafting a proposal to examine different technology systems and identify in what areas in agriculture production and seed system women need technology intervention to help them. Another thing in the study presented, in the Philippines, drudgery is a concern. If you examine women empowerment, there are still areas that need to be addressed. In agricultural businesses, we need to examine models to see the system, and the requirement of entering business would be gender-neutral."},{"index":3,"size":94,"text":"Question 5 for Ms. Oro: In school gardens, are they taught how to save and produce seeds from their harvest? Answer: Yes, definitely. This is one of the skills that we want the students to acquire. We want to simplify things for students, and crop museums play a role as a learning laboratory. In East West, we do not have a difference between men and women, so we give them both the same benefits for all government-mandated benefits, maternity leave, medical insurance, and in some areas, we provide facilities for child care and breastfeeding."},{"index":4,"size":62,"text":"Question 10 for anyone in the panelist: It seems that women have many roles in the seed value chain, however, aren't they being burdened as when they back home they still do house chores? Answer: I think, we should not stereotype household work to women. Household chores should be shared with the family members, husband so women can also do productive roles."}]},{"head":"Synthesis","index":14,"paragraphs":[{"index":1,"size":7,"text":"Dr. Sampriti Baruah introduced Dr. Agnes Rola."},{"index":2,"size":174,"text":"Dr. Agnes Rola, Professor Emeritus at UPLB, started by providing a context of agriculture and seeds. She said there is no agriculture to speak of if there are no seeds, and seeds are always underrated. She further added that history will bear that the lack of seeds and planting materials for agriculture led to the collapse of civilizations. Dr. Rola also mentioned the CGIAR centers, where CIP is a part of, takes pride in their gene banks. And, in the Philippines, we need to protect varieties that are endemic in the country so the cropresilient that IIRR is promoting through the crop museum, and the Department of Agriculture's establishment of a national seed technology park is very refreshing. She also said that the webinar highlighted the role of women in the development of climate-smart seed system by way of understanding the use of gender lens on farmer access to and control of seeds, the participation of women in commercial seed production, and which benefits and empowerment of women farmers towards climate-smart seed system development."},{"index":3,"size":14,"text":"Dr. Rola, then, shared three points on what she has learned from the webinar."},{"index":4,"size":47,"text":"1. Women in South East Asia particularly in the Philippines are already empowered in their role in agriculture activities, especially in the seed value chain. The issue for southeast Asia should not really be about empowerment but about how to capitalize on the strengths that they have."},{"index":5,"size":89,"text":"2. The role of women is vital in agrobiodiversity management. They are curators of community seed banks, handlers, and processors, sources of indigenous knowledge for that matter. It's good that we recognize these particular roles. The crop museum is one way to conserve our agrobiodiversity and is also one way to help communities access seeds and ultimately to provide for healthy diets. It is important, hopefully, that crop museum should be recognized, scaled up, and replicated in other areas and not only in schools but particularly in more communities."},{"index":6,"size":68,"text":"3. The role of women in commercial seed production as presented by Dr. Sayoc. This is the first time to learn about women pollinators, so hopefully, there will be more scientific data to prove that women indeed have more tender hands, are patient, and are persevering. These are very difficult things to measure but it's nice to see them and I think as a woman I also agree."},{"index":7,"size":7,"text":"Dr. Rola provided her top three recommendations."},{"index":8,"size":51,"text":"One, policies are very important. There was a mention of the amendment of the national seed industry development act by Dr. Brown. I hope we can more or less investigate the content of this act and how to really emphasize to put in the gender lens, as we finalize the act."},{"index":9,"size":35,"text":"Two, crop museum. This is not very expensive, participatory, inclusive, community-based, it's very ideal, especially for our endemic varieties, so I hope the government will have some funds to put the project for more replicates."},{"index":10,"size":80,"text":"Three, continue to provide institutional support for women as they participate in the climate-smart seed system. Earlier there was a mentioned by ATI, by Ma'am Ana on the inclusion of women on the formal credit system. This is not very normal and regular in the Philippines, so she thinks that the ACPC program is a good vehicle for women's involvement in the formal credit system and hopefully to recognize as well the roles of women in the seed value chain."},{"index":11,"size":11,"text":"Please see annex 5 for the full transcript of the synthesis."}]},{"head":"Closing","index":15,"paragraphs":[{"index":1,"size":128,"text":"To close the webinar, Dr. Mohanty thanked Dr. Dar for his time to answer questions and all the panelists for their excellent presentations. He also sincerely thanked DOST-PCAARRD, Dr. Ebora -who cannot join due to urgent concerns, and Dr. Brown for filling in and doing a good job in presenting. Special thanks to Dr. Rola for her very clear, focused, and excellent synthesis. Finally, he thanked the participants for their active participation and contribution to this webinar. He also mentioned that this is the first series of webinars, and requested the audience to tune in for the next webinar to be done in partnership with PCAARRD. Finally, he mentioned that he hoped the webinar provided useful information on the role of women in developing a climate-smart seed system."},{"index":2,"size":15,"text":"Dr. Mohanty also asked the participants to answer the evaluation and request for a certificate."},{"index":3,"size":10,"text":"The full webinar can be viewed in this link. https://cipotato.org/event/webinar-role-women-developing-climate-smart-seed-systems-philippines/"}]},{"head":"EVALUATION","index":16,"paragraphs":[{"index":1,"size":125,"text":"The evaluation of the webinar is very encouraging. Ninety-seven percent (97.8 %) of the participants rated the webinar had met their expectations, and the subject matter effectively presented. With their participation, 99.2 percent of them said they gained new knowledge applicable to work. Participants listed the things they like the most which included the topic on women and climate-smart seed system, women empowerment in agriculture, and the presentations of the panelist/speakers. While the least liked in the webinar is the technical difficulties and glitches, connectivity and internet issues, and time allotment and management. The participants also provided useful comments for improvement of the next webinars are well as topics that organizers can consider. The overall rating was excellent (46.3), very good (44.4), and good (8.3)."},{"index":2,"size":9,"text":"The summary of the evaluation results are as follows:  "}]},{"head":"BACKGROUND","index":17,"paragraphs":[{"index":1,"size":48,"text":"The Philippines is considered one of the most vulnerable countries in the region with rising sea level, rising temperature and more frequent occurrence of extreme weather events including flood and drought. Agriculture is one of the most affected sectors to climate change especially due to extreme weather events."},{"index":2,"size":49,"text":"Farmers identify rising rainfall variability and frequent occurrence of drought as the two most important climate change induced challenges faced by them. Crop diversification, often touted as a key strategy to achieve climate resilience, haven't made headway because of non-availability of high-quality climate resilient seeds and weak market linkages."},{"index":3,"size":52,"text":"The current administration, led by Secretary Dr. William Dar, recently announced the establishment of a National Seed Technology Park in an effort to bring all key players in the seed industry together to ensure that good quality and certified seeds are available to farmers in a timely fashion and at affordable price."},{"index":4,"size":108,"text":"The growing importance of women in the Philippine agriculture makes it imperative that the gender perspectives are integrated in crafting a climate Smart seed system. This webinar provides a platform for discussing the role of women in developing a climate smart seed system in the Philippines. Specific objectives will include -The use a gender lens on farmers access to and control of seed -The participation of women in commercial seed production -The climate smart seed system development on the reach, benefit and empowerment of women farmers.   At ICRISAT, he practiced transformational and servant leadership for 15 years as ICRISAT worked in developing countries around Asia and Africa."}]},{"head":"PROGRAMME Time","index":18,"paragraphs":[{"index":1,"size":40,"text":" A firm believer in the total systems approach towards inclusive growth and development, he founded the InangLupa Movement in 2014 to advocate for a modern and industrialized Philippine agriculture guided by an inclusive, science-based, resilient, and market-oriented development strategy."},{"index":2,"size":56,"text":" In August 2019, he was once again tapped by no less than President Rodrigo Roa Duterte to serve the Department and elevate the Philippine agriculture with his \"New Thinking\" approach and establish a food-secure Philippines with prosperous farmers and fisherfolk via agri-fishery modernization and industrialization-to attaining food security, building up global competitiveness and reducing poverty.     "}]},{"head":"-Directory of Participants","index":19,"paragraphs":[]},{"head":"-Presentation of speakers","index":20,"paragraphs":[{"index":1,"size":10,"text":"Please see the link for the copies of the presentations."},{"index":2,"size":1,"text":"https://www.dropbox.com/sh/916z63lkuweqe7i/AABem9Z9kpya407wuPNIYxcQa?dl=0"}]},{"head":"5-Synthesis","index":21,"paragraphs":[]},{"head":"Synthesis by Dr. Agnes C. Rola","index":22,"paragraphs":[{"index":1,"size":114,"text":"First of all, I would like to thank the organizers for this kind invitation and I would like to congratulate panelists for the productive discussions. As usual, I have learned a lot. My role now is to synthesize the discussions by way of teasing out the role of women in seed systems in particular, and providing suggestions on how to go forward. But before that, let me explain the context as was also challenged by Dr Sampriti. There is no agriculture to speak of, if there are no seeds. However, seeds are always under rated. The history will bear that the lack of seeds and planting materials for agriculture led to collapse of civilizations."},{"index":2,"size":114,"text":"Globally the CGIAR centers, where CIP is a part of, place much pride in their gene banks, their crowning glory. Nationally, here in the Philippines, we need to protect varieties that are endemic in the country. And, I was very pleased to learned about the crop-resilient that IIRR is promoting. It is also refreshing to note that the Department of Agriculture under Secretary Dar is pursing the establishment of a national seed technology park the efforts of which is to bring all key players in seed industry to ensure that good quality certified seeds are available to farmers in a timely fashion and at an affordable price. So, this is a very important project."},{"index":3,"size":58,"text":"This webinar is important because it highlighted the role of women in the development of climate smart seed system by way of understanding the use of gender lens on farmer access to and control of seeds, the participation of women in commercial seed production, and which benefits and empowerment of women farmers towards climate smart seed system development."},{"index":4,"size":23,"text":"What we have learned so far. I have a time constraint, so I will just look about three items that top my list."},{"index":5,"size":50,"text":"First, women in South East Asia particularly in the Philippines are already empowered in its role in agriculture activities especially in the seed value chain. The issue for South East Asia, as was mentioned, should not really be about empowerment but about how to capitalize the strengths that they have."},{"index":6,"size":93,"text":"Second, the role of women is vital in agrobiodiversity management. It was also mentioned women are curators of community seed banks, handlers and processors, sources of indigenous knowledge for that matter, so it very good that we recognize these particular roles. The crop museum is one way to conserve our agrobiodiversity and is also one way to help communities access seeds and ultimately to provide for healthy diets. It is important, hopefully, that crop museum should be recognized, scaled up, and replicated in other areas and not only in schools but particularly communities."},{"index":7,"size":73,"text":"Thirdly, I also really like the presentation of Ma'am Sayoc about the role of women in commercial seed production. This is the first time and I hope that there will be more scientific data to prove that women pollinators indeed have more tender hands, are patient and are persevering. This are very difficult things to measure but it's nice to see them and I think as a woman I also agree with you."},{"index":8,"size":11,"text":"What are the recommendations, and again the three top my lists."},{"index":9,"size":53,"text":"First, it's about policy. Policies very important. There was a mention about the amendment of the national seed industry development act by Dr. Ernie. I hope we can more or less investigate the content of this act and how to really emphasize to put in the gender lens, as we finalize the act."},{"index":10,"size":43,"text":"Second, again crop museum. I love crop museums, Emmie. It is not very expensive, participatory, inclusive, community-based, it's very ideal, especially for our endemic varieties, so I hope government will have some funds to put into Emily's project in order for more replicates."},{"index":11,"size":99,"text":"Thirdly, very importantly, is to continue to provide institutional support for women as they participate in climate-smart seed system. Earlier there was a mentioned by ATI, by Ma'am Ana on the inclusion of women on the formal credit system. This are not very normal, regular in the Philippines, so that particular ACPC program, I think, is a good vehicle for women to be involved in formal credit system and hopefully to recognize as well the roles of women in seed value chain and thus financing those roles of women in the seed value chain through that the ACPC program."},{"index":12,"size":8,"text":"I think that's all. Thank you very much."},{"index":13,"size":21,"text":"What did you like MOST about the webinar?325 responses Topics discussed during the webinar: women and climatesmart seed system (42 responses)"},{"index":14,"size":11,"text":"1. Mostly all topics presented 2. Topic's relevance and timely today."},{"index":15,"size":184,"text":"3. Educational topic 4. Topics presented especially on the loan programs and the development of NSTP 5. All topics are very informative but the most I like is about crop museum the topics 6. Women empowerment topic 7. Topic was very interesting and I hope we can make more study about this. 8. Topic of Ms. Oro and Dr. Sayoc 9. Topics discussed were short but informative. 10. All topics are interesting and useful 11. Topic of Dr. Mula and Dr. Mary Ann of Eastwest on the role of women in seed systems 12. Valuable topic and insightful webinar 13. Topic discussed by Dr. Brown and Dr. Mula which covered researches and financial matters relating to empowering women in the seed value chain. 14. Relevance of the topic to the country's crop sector's problematic supply of quality seeds. 15. Topics were explained brief and concise. Speakers were knowledgeable. 16. Comprehensive topic/content 17. The topics discussed been very helpful specially us from Department of Agriculture on the roles of women in the seed system 18. The substance of every topic. The presentation of every presenter."}]},{"head":"Applicable today and very informative topics","index":23,"paragraphs":[]},{"head":"Flow and method of the webinar (10 responses)","index":24,"paragraphs":[{"index":1,"size":75,"text":"1. Very engaging 2. Overall discussion 3. I like that it is conversational in its approach. 4. That both public and private sectors were represented 5. The webinar is well-paced and the invited speaker are knowledgeable about their respective topics. 6. The webinar discussed the presentations clear even though there are some technical difficulties 7. The question and answer (Q&A) 8. The language or terms used are simple Women empowerment and in agriculture (69 responses)"},{"index":2,"size":109,"text":"1. Strategies for women in agriculture 2. How effectively women empowerment was promoted 3. Participation of women in knowledge transfer 4. Engagement of women to most activities and yes to gender equality. 5. That it empowers women even more 6. All about how women power can change the label of society 7. As a women we can do things especially in this pandemic, we can help other. 8. Empowering women in the field of agriculture. 9. Giving advantages of having a female farmer 10. Focusing on the role of women in agriculture and empowering it 11. Emphasizing the Role of Women in all aspects, not just in the household."},{"index":3,"size":696,"text":"Opportunities that can be avail in the DA Program. 12. The webinar informed us of the ways by which women can gain access to more support for their important role in the seed system. Recent government programs intended to support women were discussed during the webinar. 13. About how women is significantly important in the agriculture sector and contribution to economy 14. It's about recognizing the role of women in agriculture for food security and providing them access to health safety on climate change, in particular. 15. Opportunities for women engaged in agriculture 16. I liked the part about the IIRR activities and the information regarding the participation of women in agriculture 17. The importance of women in agri business. 18. It emphasized the role of Women and how it can help the agriculture industry 19. Highlighting women's role in agriculture and addressing all concerns about agriculture 20. The various roles of women in the different facets of agriculture were presented well. 21. I love how I am given the overview of the contribution of women in Agriculture. It is very inspiring and I truthfully hope more have heard about it. 22. Clarifying the role of women in the agriculture sector which is very much a male dominated area. 23. The discussions portion. I have learned a lot from this webinar like women equality and empowerment and many more. 24. How the different programs presented the role of the women 25. Involving the women to agriculture 26. Role of Men and Women in Agriculture 27. They really appreciate the role of women in the industry of agriculture. 28. The role of women to agriculture 29. Gender roles of women in Agriculture in Southeast Asia. Women are already empowered, capitalizing on them is needed. 30. Updates about the role of women in the agri sector. 31. I was enlightened to the GREAT ROLES of women in Agriculture. I learned about different essential strategies to help farmer for food security. 32. Emphasize the role/importance of women; Giving opportunities to women 33. There is a high percentage of women in production process. 34. The importance and role of women in agricultural sector as actively participating in various program 35. Using concrete examples showing the role of women 36. Highlighting the important role women played in agriculture 37. I like how topic about gender equality is discussed along side the advances of the field of agriculture. 38. The role of women power in field of agriculture. The information was related and update. 39. It really helps the farmer especially women 40. The presentation where women dominates the decision making in the fields, where mostly is true even here in our place 41. The whole webinar discussion about empowering women for the Agricultural sector 42. That women in agriculture sector have the same privilege as with the men. 43. Roles and challenges of women in Agriculture in the midst of climate change 44. The whole webinar discussion about empowering women for the agricultural sector 45. I liked how the speakers comprehensively discussed the role of women in agriculture. 46. The data around global reality on gender 47. Contributions of women was highlighted 48. Integrating gender issue in climate agriculture 49. Substantial information on role of women, the projects presented, and proper time management 50. Women play a key role in the production of food 51. Gender and development awareness 52. I liked most when I have gained many insights as a woman. 53. Knowing the role of women. 54. Empowering women amidst this great battle on crisis on health and food security 55. I was enlightened about the role of women in the field of agriculture. Women were stereotyped as of little helpful in agriculture industry however, I have learned from the webinar that women can and may take a big part in it if given the chance. 56. Gender roles in Agriculture in Southeast Asia 57. Recognizing the strength and opportunity that the other half of the human population has to offer. 58. Many women are becoming leaders in their field of specialization. 59. Emphasis on women's role, especially in the community/household Role of women in seed system (31 responses)"},{"index":4,"size":737,"text":"1. Role of women in seed system in the Philippines 2. Focus on role of women in developing a climate smart seed system in the Philippines 3. Significant roles that women play in seed production 4. The role of women in commercial seed production, role of women in seed value chain 5. The role of a women in improving the seed system in the Philippines 6. It's the possible roles of women in the seed value chain. 7. Different aspects of women's role as well as the opportunities for women were presented 8. Emphasis/recognition of the importance of including seed collection/seed banking in the whole process of the farming/agricultural production system wherein women could very well contribute into 9. We acknowledge the role of women ang girls in seed production value chain 10. The role of women in developing climate-smart seed system. Seed system is one of the pillars of agricultural development and food security. Enhancing the role of women in developing climate smart seed system as a strategy in gaining much traction in under-developed and developing agricultural economics 11. The insightful information on the role of women in agriculture/seed sector. The interesting observation that the Philippines do well compared to other Asian and African countries 12. Role of women in the seed value chain and seed conservation 13. The idea that women are now the custodian of knowledge of seed quality 14. Sharing of information about the existing programs/projects on women participation in seed system 15. Giving importance to women's role in seed cultivation and farming 16. The role of woman in East West Weed company 17. The webinar gave me an insight as to what women can do for our seed system and impart for our conservation. 18. I like all the topics discussed by the panelists and resource speakers. But I was strucked the most on the discussion on seed value chain and the role of women on seed value chain. 19. Role of women in commercial seed production, role of women in seed value chain, inclusion of women in credit system 20. The topic on the Role of Women and Conservation of Seeds 21. By attending this webinar i am able to understand how me, my family and colleagues will grow quality seed production. 22. I like the most in this webinar is what is the woman do in our country about the seed system 23. Discussion of smart seed system in the Philippines 24. The possible benefit of smart seed system 25. Thank you for the webinar. I like the topic about the roles of women in improving the seed systems attaining the food security. 1. The presentations were concise and insightful. 2. The presentation about the ACPC help for women 3. All the presentations and the synthesis of Dr. Rola. 4. Actually, I liked all the presentations prepared by the panel list but what I liked the most during the webinar was the presentation of Dr. Emily about the Crop Museum 5. What I like the most about the webinar was the clear presentation on the role of women in the Philippine agriculture sector. Inclusivity for women was presented which was a very good point. It was nice to know data or studies showing that women were really involved and given equal opportunities like men. 6. The data presented and projects to be implemented 7. It was presented the Filipino women experience. 8. Keynote and Plenary Speakers' presentation. I was amazed of how involved women are in agriculture and promotion of related fields. 9. The presentation of the results of the study/research 10. the presentation from IIRR 11. The presentation about seed bank and its goal to help rural women working in agriculture 12. About what Dr. Brown presentation/talk 13. The presentations are clear enough. It is indeed informative and helpful, especially now that we will be more exposed to the new transition of learning. Kudos to the speakers/lecturers, as well as the moderator for patiently replying the answers of the attendees. Thank you. 14. All the presentations are good but i appreciate most that presentation on Seed Museum. That inspired me a lot to establish one in our university. 15. Presentation of Dr. Mary Ann Sayoc. 16. The presentation of each panelist. It enlightens everyone about the role of women in developing climate smart seed system as strategy. 17. All the presentations, the panelists and how the webinar was facilitated"}]},{"head":"Panelist and speakers (41 responses)","index":25,"paragraphs":[{"index":1,"size":554,"text":"1. How the panelists talked about a topic that is very relevant to everyone 2. Speakers showed mastery and shared very relevant topic on the roles of women, programs and project on seed production were clearly discussed 3. The knowledge of the different speakers on agriculture 4. Reliable speaker 5. It is very informative and well explained. 6. Intelligent speakers 7. The different speakers and it's various contributions in their field of specialization 8. I think the webinar provided a substantial and informative presentation from the panelists. 9. Outstanding speakers 10. I like the most is the sharing of knowledge of the panelists regarding the importance of role of women in climate smart seed system. Also about the crop museum. 11. There were a several resource speakers who gave more than enough knowledge to the participants. 12. The panelists were engaging and interactive 13. the content itself and how the speaker presented. business, it will really help them to be empowered. 6. The highlights knowledge I've got to this webinar were the following: 1.Role of women in the seed value chain; 2. Agricultural Credit Programs; 3. Women as catalyst for the better crop researches and 4. Women involvement in plant breeding activities. 7. about the discussion on ILAW and NSTP. Only today i knew about it which is very helpful to women farmers as well as to their family 8. Information of the progress reports of the government programs. 9. Current policies, programs and projects towards genuine and sustainable efforts in the gender roles in the agriculture system 10. Seed system and project of Sec. Dar to provide loans to farmers and fisherfolks 11. New insights on programs and opportunities for women farmers in the Philippines 12. The efforts of the Department of Agriculture to offer loans to those individuals interested on joining the seed value chain, particularly women. 13. I like the initiatives of the agencies in promoting and recognizing the role of women in agricultural related activities, disregarding the common stereotypes labelled on them. They too can also actively participate in productive work. 14. The credit program planned to be extended to women farmers. 15. I like how the governor and its partners maximize women in addressing food security at home and in community 16. Policies on gender and development like magna carta for women 17. The initiative on the National Seed Technology Park, ensuring the use of highquality modern seeds, technology processing, and market linkages highlighting the roles of women thereby attaining food security. 3. That the organizers could have invited more experts, rather than bureaucrats on discussing the topic. Gender in agriculture has many intersectionalities, and it cannot be discussed alone from the view point of the government and few other actors. 4. Speakers/facilitators speak all at once 5. Some did not prepare well their presentation 6. The cohesion between the speakers was not strong. Ideally first the insights in the role of women, and the more practical tools like the loan system at the end of the session. I had to rush off at the planned end time so I sadly missed the discussion (if there was any?) 7. I wish to hear Dr Dar deliver his message. But I truly understand... 8. The presentation/ discussions on the topic of Dr. Dar 9. The lengthiness of Dr. Brown's presentation"}]},{"head":"Technical difficulties and glitches (44 responses)","index":26,"paragraphs":[{"index":1,"size":74,"text":"1. There were some technical difficulties from some of the presentors' side that hindered an effective delivery of their presentations. 2. Technical problem, being unprepared by some speakers 3. For being unprepared to technical problems 17. Internet connectivity problem -a lot of time was wasted as we can't hear the presentations of some of the assigned speakers. 18. Technical problems that shows the country need to improve our internet connections, connectivity. Not organizer's fault"}]},{"head":"Audio and video quality (6 responses)","index":27,"paragraphs":[{"index":1,"size":24,"text":"1. How the audio and video would sometimes not be synchronized 2. Time and audio which went on and off during presentations and Q&A."},{"index":2,"size":25,"text":"3. The audio was not clear in some parts of the webinar 4. Reception is not clear. 5. Reception keeps on breaking 6. Video Quality"}]},{"head":"Others (15 responses)","index":28,"paragraphs":[{"index":1,"size":105,"text":"1. It's on knowing that men in the Philippines tend not to prefer joining seminars and training. 2. All topics are interesting it contributes continuous learning and updates 3. Need some case studies 4. None but I would like to have success stories of some women and how they can be helped out during the COVID-19 pandemic 5. About how to provide seed in our country 6. Everything has been said/delivered well 7. Organized well 8. I liked webinar discussions 9. The topic itself that women portrays a vital role not also in family but also work related filed. 10. Everything to me was interesting."}]},{"head":"Learning the lesson","index":29,"paragraphs":[]},{"head":"Registration, organization and evaluation (5 responses)","index":30,"paragraphs":[{"index":1,"size":37,"text":"1. Registration Process 2. The small text in their power point presentation 3. Organization 4. CIP is still at the learning curve in terms of organizing webinars. 5. The evaluation form was drastically vanished after the webinar. "}]},{"head":"Role of Women in","index":31,"paragraphs":[]},{"head":"Ways to improve (42 responses)","index":32,"paragraphs":[{"index":1,"size":587,"text":"1. More informative webinar topic 2. Given some of the technical glitch earlier, maybe you could also try google meet. 3. Improve the connections and make it livelier and engaging 4. To improve the future webinars, it would be nice if there would be a dry run among the moderator and speakers prior to the webinar schedule so that the speakers will be familiarized on the technicalities of zoom app (or app being used) and thus, less time will be consumed in troubleshooting during the webinar. 5. I think, everyone who will have a great part on the webinar should be ready, for the time flow purposes. 6. Keep it up! :) 7. I suggest to pre-record presentations of the resource speakers. In this way, I think, can minimize time for presenting and more time for question and answer. 8. \"i think the problem is our slow internet connections. 9. Is there a recording of the video where we can review it? 10. Fewer facilitators and ensure their mics are off when the speaker is discussing. Avoid cutting in. 11. All speakers/panelists must be in the Webinar 15 minutes before the start of the Webinar and ensure everyone is connected. 12. Internet connectivity to avoid technical problem 13. Organizers to get a copy of the presentations and flash it from their end instead of waiting for the resource person to set up, to reduce waste of time (and internet data) 14. Check the internet connectivity of the speakers before the start of the webinar in order to avoid dead air. 15. Ensure a smooth flow of the program and pre-empt possible difficulties 16. Improvement in the zoom audio. 17. More webinars... 18. Live Webinars is really tough due to some unforeseen technical problems (internet connection, etc.), but maybe it would help if some \"back up plans\" can be arranged ahead (i.e. assigning of co-hosts; co-presentors, etc. just in case the main host or main presenter encounters problem during the session). 19. Improve the selection of moderators/hosts. If possible, someone with a neutral accent. 20. 30minute testing for presenters before start of event 21. Very good webinar 22. Enough time allotted to every topic so that a more complete and detailed information will be presented 23. CIP efforts in layman's term/presentation to have a wider spectrum of audience for the webinar 24. Limit to 2-3 speakers at a time and control the time to manage the attention span of participants 25. Infographics or video graphics can be shown while resolving connectivity issues of speakers. 26. Technical difficulties could have been avoided if the team conducted a dry run or could have requested pre-recorded presentation of speakers. Questions should have been reserved after all the presentations. 27. Looking for your future Webinar 28. I hope webinars like these can be credited for a CPD units in Agriculture and other related disciplines that requires CPD units. 29. More Webinars to come. Product development. 30. Pls if it is possible to provide us with a link to watch again the webinar because there are portions missed due to internet connectivity issues. 31. The Webinar 32. Audio/sounds 33. On time 34. Perhaps there should be some sort of rehearsal or practice before the actual webinar so that the technical issues encountered could be minimized. 35. Include some videos related to the topics 36. The invited speakers/panelists internet connectivity will be ready prior to their schedule to maximize the time allotted for the presentation. 37. Fast troubleshooting of technical problems during the webinar"}]}],"figures":[{"text":"ANNEXES: 1 - Concept note and program of the webinar Webinar: Role of Women in Developing a Climate Smart Seed System in the Philippines 19 August 2020: 1.30pm -3.00pm Manila Time "},{"text":" Born to a farming family from Sta. Maria, Ilocos Sur, Dr. William D. Dar worked his way up from being a budding researcher at then Mountain State Agricultural College or MSAC in La Trinidad, Benguet, to becoming a globally-recognized expert and steward in agriculture and rural development.  He brings with him four decades of exemplary record as a public servant and a professional with extensive research for development and professional experience in the field of science and agricultural research. He is someone whose heart and passion belong to the countryside, championing the causes of small farmers and fisherfolk.  Dr. Dar completed his doctorate in Horticulture from UP Los Baños and his masters in Agronomy and BS Agricultural Education from MSAC, now known as Benguet State University.  He was named by then President Joseph Estrada as DA acting secretary, from July 1998 to May 1999. During his eleven-month stint, the agriculture sector registered an unprecedented growth of 9.8 percent, despite the harsh El Niño, a feat that remains unmatched up to this day.  This was because he strongly implemented the Agriculture and Fisheries Modernization Act, and carried out policies and programs to start the modernization and industrialization of the agriculture and fishery sectors. He was appointed the first director of the Bureau of Agricultural Research upon the reorganization of DA in 1987. He then served as executive director of Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development or PCAARRD, from 1994 to 1998.  An awardee of various local and international awards, including honoris causa honors in various field by well-known universities, Dr. Dar also holds the distinction of being the first and only Filipino to lead a global agriculture research institution -as Director General of the India-based International Crops Research Institute for the Semi-Arid Tropics (ICRISAT). "},{"text":" Dr. William Dollente Dar: A man of science, a servant-leader of the agri-fishery sector, and a global Filipino from Ilocos Sur whose heart and passion belongs to the countryside. ### 2.2 Dr. Ernesto Brown Dr. Ernesto O. Brown holds a Ph.D. in Agricultural Economics from the University of the Philippines, Los Banos and the Director of the Socio-Economics Research Division (SERD) of the Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (PCAARRD). His expertise includes agricultural policy, agricultural marketing and R&D management, among others. Under his leadership, SERD is effectively pursuing important programs on policy analysis and advocacy in agriculture, aquatic and natural resources (AANR), socio-economic evaluation (both exante and ex-post) of programs and projects funded by PCAARRD and DOST, value chain/supply chain development of major AANR commodities and other key R&D areas in socio-economics. The division is also the focal unit of PCAARRD on Gender and Development in AANR. 2.3 Dr. Rosana Mula Current Position: Assistant Director of the DA-Agricultural Training Institute, Quezon City, Philippines Dr. ROSANA P. MULA graduated PhD in Household Development Studies from Wageningen Agricultural University, The Netherlands. She did her Post Doc Fellowship at the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) in 2005 and moved on to become a Special Project Scientist and at the same time the Coordinator of the Learning Systems Unit of the Knowledge Sharing and Innovation of ICRISAT. Her role as a Coordinator has been deemed important in the field of Research for Development (R4D). She has written and published various scientific research papers, hence contributing to R4D to a great extent. She is a recipient of several awards and honors such as the Most Outstanding Researcher for 2004 -Social Science Category at Benguet State University and part of the team award for Doreen Mashler Award, ICRISAT. "},{"text":"2. 4 Ms. Emilita Monville OroEmilita Monville Oro is the Acting Asia Director and concurrent Country Director of IIRR in the Philippines. She provides strategic directions of the country program and oversees implementation of its flagship program, Food Security and Resilient Livelihoods, where women empowerment is a critical component. She is a primary investigator of a two-phased IDRC supported, action research on Integrated School Nutrition Model, which intended to demonstrate schools as effective platforms for delivering nutrition interventions, specifically supplementary feeding, supported by bio-intensive vegetable gardens with strong agrobiodiversity component and nutrition education. As a staunch advocate of rural development, she is actively engaged in global networks, such as PROLINNOVA (PROmoting Local INNOVAtion in ecologically oriented agriculture and NRM), and the Scaling Up Nutrition Movement (SUN). Emily has 30 years of work experience mostly in Asia, focusing on research and development, public health i.e. nutrition and clinical nursing, Community Resilience building, Community-managed Disaster Risk Reduction (CMDRR), Monitoring and Evaluation, Capacity development and Documentation through Writeshops. She has a Master's in Public Health under a full scholarship from James P. Grant School of Public Health at BRAC University in Bangladesh. "},{"text":"2. 5 Dr. Mary Ann SayocDr. Mary Ann P. Sayoc is the Public Affairs Lead of East-West Seed International. She has 20 years of professional experience in the seed industry. She was former General Manager of East-West Seed Philippines, a Dutch company engaged in research, development, production and distribution of vegetable seeds. East-West Seed is market leader for tropical vegetable seeds in Asia and developing markets in Africa and Latin-America.Dr. Sayoc is active in the local and international seed sector. She is currently the President of the Philippine Seed Industry Association. She is past president of the Asia & Pacific Seed Alliance (APSA). She has been re-elected to the Board of the International Seed Federation (ISF) and is a member of the Breeders Committee, Sustainable Agriculture Committee and Vegetable and Ornamental Board of ISF. She was a member of the Executive Board of the Global Crop Diversity Trust for six years, an international organization working to safeguard crop diversity, forever. Dr. Sayoc is a member of the National Seed Industry Council and the Plant Variety Protection Board.Prior to her stint in the private sector, Mary Ann had a long career in government. She held key positions in the Department of Agriculture as Regional Director and Executive Director of the Agricultural Training Institute.Dr. Sayoc have a Doctor of Veterinary Medicine degree from the University of the Philippines. "},{"text":"2. 6 Dr. Agnes C. Rola Dr. Agnes C. Rola is Professor Emeritus at the University of the Philippines Los Banos, since 2019. She specializes in natural resource economics and policy and social science research and has more than 35 years' experience in the field of sustainable agriculture and natural resource management research and development. Her body of work includes the economics of integrated pest management, economics of soil conservation measures, water governance, gender and agriculture, role of institutions in rural development, and policy issues in the convergence of water, food security, and climate risk management. She has authored more than 130 scientific publications on the economics, policy and institutional aspects of agricultural sustainability. She has degrees in Statistics (BS) and Agricultural Economics (MS) from the UP; and PhD in Agricultural Economics (Major in Natural Resource Economics) from the University of Wisconsin Madison, USA. She attended the month-long Summer Certificate on Environmental Leadership Program at the University of California-Berkeley. As agricultural economist, she has served as consultant in various international organizations, including the CGIAR. Currently, she is member of the Board of Trustees of the Alliance of Bioversity and CIAT. She was in the board of the ILRI and other national organizations, including the CARD-MRI Development Institute. She has served as editor-in-chief and member of the editorial board of various journal publications, including the International Journal of Agricultural Sustainability. She was elected member of the National Academy of Science and Technology-Philippines (NAST PHIL) in 2011. Currently, she mentors graduate students and younger faculty and research staff at the CPAf, UPLB and other state colleges and universities and government agencies in policy and data analysis; and research studies in development and governance. "},{"text":"  "},{"text":"  "},{"text":"Question 1 for Dr. Jo Badiola/Dr. Mula: What are the requirements or qualifications to be included in the Registry System for Basic Sector in Agriculture? Answer: It is very easy. Forms can be downloaded. If this cannot be accessed, you can get in touch with the municipalities/provincial agriculture offices. They can fill up the application and the agriculture office will help register online. What we are doing in DA, for example in urban agriculture, we are distributing not only hybrid seeds but also open-pollinated varieties. We also have community gardens, in fact, one of the oldest gardens is located in the Holy Spirit and this was established before when Dr. Dar was the first DA secretary. We are supporting urban gardens because we want to sustain the supply of planting materials including local and hybrid varieties. Question 2 for Dr. Mula: Does the Department of Agriculture have this advocacy on empowering farming Question 2 for Dr. Mula: Does the Department of Agriculture have this advocacy on empowering farming communities on seed saving? communities on seed saving? Answer: Answer:  "},{"text":"Question 6 for Ms. Oro: Do communities share seeds from each crop museum in various locations? Answer: Yes, I would say we did a lot for schools on seed exchange. But for communities, we are starting. But the idea is to exchange innovative practices.  "},{"text":"Question 7 for Ms. Oro: Can we avail of a diversity or seed kit? Answer: Yes, the reason why we established crop museums is for seed exchange. We have 300 crop museums in schools. But more is needed in communities. What we can do is to connect you to the nearest crop museum in your area or email us at IIRR. Question 8 for Dr. Sayoc: In some parts of the Philippines, the indigenous peoples assigned women as Question 8 for Dr. Sayoc: In some parts of the Philippines, the indigenous peoples assigned women as seed keepers. What are the initiatives of DA, IIRR, and East West Seed to ensure this cultural tradition will seed keepers. What are the initiatives of DA, IIRR, and East West Seed to ensure this cultural tradition will be preserved? be preserved? Answer: At the moment, we do not have a specific program for indigenous peoples on seed saving but we Answer: At the moment, we do not have a specific program for indigenous peoples on seed saving but we encourage them for genetic resource management. I think it is very important to maintain and conserve encourage them for genetic resource management. I think it is very important to maintain and conserve their species. their species.  "},{"text":"Question 9 for Dr. Sayoc: What benefits do you provide for women working in your company? Answer:  "},{"text":" The crop museum in communities and schools and the women's participation in commercial seed production and knowledge transfer and in the seed value chain. 26. Different strategies to support women to empower them in Developing a Climate-Smart Seed System 1. The presentation about Crop Museum/Plant Museum/Seed Museum 2. Seedling Museum and gender role (women) 3. It's my first time to encounter the word Crop Museum and I think the idea goes to a wider scale which could be applied not only to school or community but in a bigger environment with more people's participation. 4. DA-ILAW project and Crop museum 5. Crop museum in school 6. The Crop Museum which is very helpful in the conservation of crops. 7. Crop Museums in Communities 8. Topics that dealt with Crop Museum and National Seed Technology Park 9. Community-based seed system; crop museum 10. Crop Museum easy access 11. Community gardens 12. Seed saving system learned in school 13. Seed bank. Conservation of genetic material related study 14. About the crop museum and the role of women in conservation and saving of seeds 15. Seed museum topic 16. crop museum and gender policies in Philippines 17. Crop Museum -not only as a learning venue but also it becomes a tourist destination. 18. Gardening 1. Sharing of Updates 2. Different initiatives in making the project gender sensitive 3. Sharing on the best practices. 4. I got interested because with most of my students in horticulture were female 5. My role as a woman 6. I learned a lot from all the talks 7. I love the overall discussion 8. It is the state of art technologies /online platform for effective interactive learning 9. Very informative webinar. 10. Climate smart session 11. A fruitful webinar! Timely not only to Multi Grade teachers, but to all who engage in educating our learners, including the parents. 12. Attention 13. Webinar topics and speakers, social media promotion graphics/design 19. Others (14 Crop museum (34) responses) Presentations of speakers (21 responses) 26. Different strategies to support women to empower them in Developing a Climate-Smart Seed System 1. The presentation about Crop Museum/Plant Museum/Seed Museum 2. Seedling Museum and gender role (women) 3. It's my first time to encounter the word Crop Museum and I think the idea goes to a wider scale which could be applied not only to school or community but in a bigger environment with more people's participation. 4. DA-ILAW project and Crop museum 5. Crop museum in school 6. The Crop Museum which is very helpful in the conservation of crops. 7. Crop Museums in Communities 8. Topics that dealt with Crop Museum and National Seed Technology Park 9. Community-based seed system; crop museum 10. Crop Museum easy access 11. Community gardens 12. Seed saving system learned in school 13. Seed bank. Conservation of genetic material related study 14. About the crop museum and the role of women in conservation and saving of seeds 15. Seed museum topic 16. crop museum and gender policies in Philippines 17. Crop Museum -not only as a learning venue but also it becomes a tourist destination. 18. Gardening 1. Sharing of Updates 2. Different initiatives in making the project gender sensitive 3. Sharing on the best practices. 4. I got interested because with most of my students in horticulture were female 5. My role as a woman 6. I learned a lot from all the talks 7. I love the overall discussion 8. It is the state of art technologies /online platform for effective interactive learning 9. Very informative webinar. 10. Climate smart session 11. A fruitful webinar! Timely not only to Multi Grade teachers, but to all who engage in educating our learners, including the parents. 12. Attention 13. Webinar topics and speakers, social media promotion graphics/design 19. Others (14 Crop museum (34) responses) Presentations of speakers (21 responses)  "},{"text":" 14. Being patient of the speakers to other speaker 15. The speakers were able to effectively deliver their message in concisely and I really like that. 16. All presenters/resource persons, including Sec Dar are very much engaged in their presentations and in answering questions 17. The speaker actually well deliver the topic and it really meet my expectations 18. The key takeaways from the speakers 19. Very good speaker 20. I liked the topic presented by Dr. Ernesto O. Brown, especially on the topic on the Role of Women in the Seed Value Chain. 21. The presenter. They were all so prepared. I learned a lot from them. 22. The speaker's expertise on the subject on the role of women in Developing a climate smart seed system in the Philippines 23. Knowledgeable resource speakers 24. The selection of speakers 25. Dynamic speakers plus topics were presented well. I am most interested to know more about Crop Museum. 26. The host of the webinar invited many speakers that are well versed and very knowledgeable about the topic 27. They are all educational and informative. Worth emulating. 28. The generosity of the speakers to share their knowledge 29. Sharing of experiences of different agencies/organizations working on seed system with a clear synthesis from Dr. Rola 30. Discussed by experts and base on research output and actual practice 31. The role of women in the Philippines by Dr. Brown 32. Plenty of knowledge shared. Quite impressed with Dr Sayoc's presentation. About the Loan program of DAR for the livelihood of women 3. The initiative of the Dept. of Agriculture on the dissemination to the community in relation to COVID-19 pandemic 4. The initiatives of private and government agency towards role of women in productive aspects. 5. Topics about offered programs for women like loans with no interest for  4. Many 4. Many  5. All of its content 5. All of its content  6. Everything 6. Everything  7. I like them all 7. I like them all  8. All of them 8. All of them  9. Almost all of it. Women being respected in such different ways. 9. Almost all of it. Women being respected in such different ways.  10. Too many 10. Too many  11. All the discussion 11. All the discussion Government 1. Credit program for women Government1. Credit program for women program and 2. program and2. policies on  policies on women/gender  women/gender and credit (33)  and credit (33) All (22 responses) 1. All of it All (22 responses)1. All of it  2. Everything 2. Everything  3. Most of it. 3. Most of it.  "},{"text":" 18. I was introduced to programs spearheaded by women (esp. NSTP) which I wouldn't have known if not for this webinar 19. The things agencies are doing to help women; The data they shared to give a picture of what women contribute in agriculture 20. That the webinar was able to show what exactly the government is doing in relation to gender and climate-smart agriculture.21. There are many good practices that were discussed, especially on the assistance programs to women in agriculture 22. Sharing of the learning and experiences from the field of the participating agencies/organizations that were sources of insights for the furtherance of the services extended to our stakeholders/clienteles. 23. Importance of right credit to right stakeholders of project. None (3 1. Na None (31. Na responses) 2. None responses)2. None What did you like LEAST about the webinar?304 responses What did you like LEAST about the webinar?304 responses Time allotment 1. Too little time for the Q&A Time allotment1. Too little time for the Q&A and management 2. Lack/limited of time for more discussions and sharing and management2. Lack/limited of time for more discussions and sharing (13 responses) 3. Very short presentation (13 responses)3. Very short presentation  4. Limited discussion about the subject matter. 4. Limited discussion about the subject matter.  5. limited time for each presentation 5. limited time for each presentation  6. Limitation of time. Wishes was a bit longer with more information. 6. Limitation of time. Wishes was a bit longer with more information.  7. Short time of expounding the subject matter 7. Short time of expounding the subject matter  8. Short time for inquiries 8. Short time for inquiries  9. More time for the presentors 9. More time for the presentors  10. Too short time allowed for the resource persons 10. Too short time allowed for the resource persons  11. The allotted time was short. I think some of the questions were not yet 11. The allotted time was short. I think some of the questions were not yet  answered. answered. Speakers (9 1. Topic presented from the private sector delivered by Dr. Mary Ann P. Sayoc. I Speakers (91. Topic presented from the private sector delivered by Dr. Mary Ann P. Sayoc. I responses) expected to hear, the reasons why majority of East-West Seed International are responses)expected to hear, the reasons why majority of East-West Seed International are  women. women.  2. Substitution of speakers should be avoided. 2. Substitution of speakers should be avoided.  "},{"text":" Agricultural Value Chains; learn from a successful women leader in agriculture 28. The Role of Agriculture in addressing Current Issues we faced nowadays 29. Role of women in Agriculture 30. Any topic will do. 31. Agriculture is the Future -Encouraging the Youth to Pursue a Degree in Agriculture 32. Ways on how to measure project impact on farmer's income, productivity and competitiveness 33. Smart farming 34. A future topic can be on making agricultural activities more convenient and flexible during the Covid-19 35. pandemic. 36. Seed conservation, Plant Breeding, Medicinal plants in the Philippines, 37. About Animal Science 38. Conservation and Protection of Valuable Natural Environment/Resources 39. Aquaculture to new normal 40. Depression and anxiety during the pandemic 41. Women in Agriculture in this time of pandemic 42. Mainstreaming climate change adaptation and mitigation in agricultural initiatives and projects 43. Any related in agriculture practices 44. Like literally expound more on the roles of women in developing a climatesmart seed system in the Philippines so that the end-reader will know basically their roles in this system. 45. Role of Women in Agriculture 46. Community Based on Farm Management of Agro-Biodiversity 47. Women in agriculture extension service 48. Ways to empower financially challenged women. 49. seed system on sweetpotato/taro or yam. 50. Impact of the quarantine to the farmers in remote areas 51. Agriculture in new normal 52. Updates on Climate Change Initiatives 53. More livelihood project ideas that our extension program could adapt. Our university is both agricultural and fisheries industry. I wish to help farmers and fisher folks around our community. 54. Food System 55. Organic Agriculture 56. How to engage youth to venture agriculture 57. Types of Mulching 58. Elimination of women discrimination in rural areas 59. Programs from Agro Fisheries 60. Genetic resource conservation 61. Just about agriculture 62. The role of youth in Agriculture. 63. Pls discuss also the part of ornamental woman gardener. They are also big contributors on plants market today 64. Role of nation in SDG 149. Gender and wetlands (especially those converted to agriculture land/use) 150. Future topics might include 1. issues surrounding insignificant growth and development in the agricultural sector of the country. 2. Success stories from other countries. To improve -make sure presenters are available on time and with stable internet connection. 151. Sustainable rural development in south Asia 152. role of women in international community in the field of education 153. Another shot at seeds: crop varietal improvement and supply of quality seeds for rice and vegetables in the era of climate change and pandemic-accomplishments and challenges. 154. Effective Extension Workers under New Normal Situation 155. Managing community-based agro shops 156. New technologies in agriculture for Philippine production 157. Techniques in agricultural marketing 158. women in agricultural extension delivery system 159. Gender-responsive/transformative strategies on climate change mitigation and adaptation. 160. Future topic more about Crop Museum. 161. More on STEM Teaching 162. Topic on Hydroponics 163. How to prevent degeneration of seeds e.g. affordable technique in virus prevention/eradication 164. What is women's role in the coffee supply chain in Asia? 165. More on STEM teaching 166. Topic on Enhancing the role of women in attaining food sufficiency during CoVid-19 pandemic 167. The topic encompasses broad sector. Concise and focused program of activity need to be adapted and ensure relevance to the Philippine setting and other regions.  "}],"sieverID":"0ea10688-fefd-4ce3-ae95-a08fe6794d24","abstract":""}

data/part_3/037e7a3299b9268aa7cafbd97ad7d4b3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"037e7a3299b9268aa7cafbd97ad7d4b3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/023094b7-e79c-46c3-a05d-a1fd5b8db44f/retrieve"},"pageCount":73,"title":"","keywords":["Arend Kortenhorst Traduction : Lineke van Dongen Imprimé par : Digigrafi","Wageningen","Pays-Bas"],"chapters":[{"head":"Pourquoi le compostage","index":1,"paragraphs":[{"index":1,"size":51,"text":"Compost est un engrais organique qu'on peut faire à la ferme à peu de frais. L'input le plus important est le travail des paysans. Compost est du matériel organique décomposé, comme des restes de plantes et/ou du fumier animal. La plupart de ces ingrédients sont facilement trouvés autour de la ferme."},{"index":2,"size":56,"text":"Le service Questions et Réponses d'Agromisa reçoit souvent des questions posées par des paysans qui doivent faire face à une baisse de la fertilité des sols. Dus aux problèmes de fertilité du sol, les rendements baissent souvent et les cultures sont plus susceptibles aux pestes et aux maladies du fait de leur mauvais état de santé."},{"index":3,"size":54,"text":"Afin d'augmenter la fertilité du sol à court terme, il faut ajouter des substances nutritives au sol. Souvent, on y arrive en appliquant des engrais artificiels. Cependant, ces engrais artificiels sont très chers ce qui constitue un problème pour la plupart des petits paysans. La fabrication et l'utilisation de compost peuvent résoudre ce problème."},{"index":4,"size":104,"text":"Pour améliorer la fertilité du sol effectivement à long terme, il faut améliorer la structure du sol et accroître le niveau de matière organique dans le sol. Le compost est un bon engrais du fait qu'il contient des substances nutritives ainsi que de matière organique. Le rôle de la matière organique est expliqué de manière plus détaillée au chapitre 2. L'utilisation de compost comme seul moyen d'entretenir la fertilité de sol est possible, mais dans ce cas vous aurez besoin d'une très grande quantité de compost. Nous vous conseillons d'appliquer plusieurs pratiques à même temps, afin d'entretenir la fertilité du sol à long terme."},{"index":5,"size":24,"text":"Quelques méthodes pour améliorer la fertilité du sol sont : ? Techniques culturales, telles que : paillage, engrais vert, agroforesterie et la jachère améliorée."},{"index":6,"size":15,"text":"? L'application des engrais organiques tels que le compost, l'engrais liquide et le fumier animal."},{"index":7,"size":91,"text":"Si l'on applique du fumier animal il faut qu'il mûrisse quelque temps, sinon il pourrait abîmer les plantes. Par le processus de compostage la qualité du fumier comme engrais s'améliore. Ces méthodes pour améliorer la fertilité du sol et d'autres méthodes sont amplement décrites dans l'Agrodok nº 2 : La fertilité du sol et Agrodok nº. 16 : L'Agroforesterie. Cet Agrodok a été écrit pour des agents qui travaillent avec des petits paysans dans les pays en voie de développement et pour tous ceux qui s'intéressent au compostage et engrais organiques."},{"index":8,"size":7,"text":"2 Fertilisation : matière organique et compost"},{"index":9,"size":42,"text":"La présence de matière organique dans le sol est primordiale pour maintenir la fertilité du sol et pour réduire les pertes de substances nutritives. Le compost est un engrais organique, qui ajoute de la matière organique et des substances nutritives au sol."},{"index":10,"size":56,"text":"Afin de fournir rapidement aux cultures les substances nutritives requises, un engrais artificiel pourra être nécessaire. Contrairement aux engrais organiques, des engrais chimiques profitent immédiatement aux plantes ; il faut que les engrais organiques soient transformés d'abord en substances nutritives (par l'action des organismes du sol) avant que les plantes soient en mesure de les utiliser."},{"index":11,"size":108,"text":"vres, etc. La matière organique fraîche est transformée en matière organique fine et humus par l'action des micro-organismes. ? elle améliore la structure du sol ; ? elle améliore la résistance du sol à l'action érosive des pluies ou du vent ; ? elle peut retenir l'eau et la libérer lentement aux plantes (capacité d'emmagasinement de l'eau) pendant une période plus longue ; ? elle peut retenir des substances nutritives du sol et les libérer lentement aux plantes pendant une période plus longue ; ? elle contient les substances nutritives importantes : azote (N), phosphore (P) et potassium (K), qui viendront à la disposition des plantes après décomposition."},{"index":12,"size":46,"text":"Ce sont principalement des micro-organismes qui décomposent directement une partie de l'humus en dioxyde de carbone, en eau et en substances nutritives pour la plante. Ce processus s'appelle la minéralisation. La minéralisation libère des substances nutritives qui peuvent être directement assimilées par les racines des plantes."},{"index":13,"size":70,"text":"La vitesse de formation de l'humus et de la minéralisation dans le sol dépend d'un certain nombre de facteurs. Sous un climat chaud, les micro-organismes sont plus actifs et la matière organique se décompo-sera plus rapidement que sous un climat froid. Le degré d'acidité du sol ainsi que la composition de la matière organique, l'humidité et la disponibilité de l'oxygène ont également une grande influence sur la vitesse de décomposition."}]},{"head":"Compost","index":2,"paragraphs":[{"index":1,"size":92,"text":"Le processus naturel de décomposition dans le sol peut être régularisé et accéléré par l'homme. La matière organique peut être rassemblée, de préférence sur un tas. Le processus de décomposition dans le tas se déroule de façon plus intense et les conditions sont optimales du fait que le tas se compose presque uniquement de matière organique. Le produit final est une matière organique bien décomposée contenant de l'humus et des substances nutritives. C'est ceci que nous appelons compost. Le compost est utilisé comme engrais organique, qui peut être incorporé dans le sol."},{"index":2,"size":26,"text":"Utiliser le compost comme engrais permet, outre de fertiliser les plantes, de profiter des bonnes caractéristiques de la matière organique, comme indiqué dans le paragraphe ci-dessus."},{"index":3,"size":37,"text":"L'apport de compost aux sols sableux peut en augmenter la capacité de rétention de l'eau. C'est-à-dire que l'eau est retenue plus longtemps dans le sol et reste donc plus longtemps disponible aux plantes en périodes de sécheresse."},{"index":4,"size":59,"text":"Pour la fabrication de compost, on peut utiliser toutes sortes de matériaux organiques, pourvu qu'ils ne soient pas toxiques. De cette façon, on réutilise souvent des déchets ou des excédents. Mais il faut d'abord s'assurer que les matériaux appropriés à la fabrication du compost ne sont pas plus utiles pour autre chose, par exemple pour le fourrage du bétail."}]},{"head":"Le processus de compostage","index":3,"paragraphs":[{"index":1,"size":53,"text":"Comme décrit dans le paragraphe sur la matière organique dans les processus ayant lieu dans le sol, le processus de compostage se produit dû à l'activité des micro-organismes (bactéries) et d'autres organismes plus grands tels que des vers et des insectes. Ceux-ci nécessitent certaines conditions pour pouvoir vivre. Elles comprennent l'humidité et l'air."},{"index":2,"size":80,"text":"Pour faire du compost de la façon la plus efficace, il faut que les micro-organismes soient en mesure de travailler le mieux possible. C'est à dire que les quatre facteurs suivants doivent être combinés d'une façon optimale : ? type de matière organique ? air ? humidité ? température Le taux de l'acidité (pH) est souvent mentionné aussi comme facteur déterminant. L'acidité dépend de l'apport d'air et d'humidité. Un tas de compost qui est bien construit deviendra rarement trop acide."},{"index":3,"size":58,"text":"Le processus de compostage sera optimal lorsque : ? de matériaux variés qui ont différentes vitesses de décomposition sont associés ? les différents matériaux sont bien mélangés ; ? la taille du tas varie entre 1 mètre sur 1 et 3 mètres sur 3. Ceci permet de maintenir la température à un niveau constant à l'intérieur du tas."},{"index":4,"size":28,"text":"Un bon processus de décomposition passe par 3 phases consécutives : ? une phase d'échauffement (fermentation) ; ? une phase de refroidissement ; ? une phase de maturation."},{"index":5,"size":39,"text":"Ces différentes phases sont difficiles à discerner les unes des autres parce que le processus se déroule très progressivement. Plusieurs sortes de micro-organismes assurent au cours de chacune de ces phases la transformation de la matière organique en compost."}]},{"head":"Phase d'échauffement","index":4,"paragraphs":[{"index":1,"size":73,"text":"Au cours de la première phase du compostage, on assiste à une production de chaleur dans le tas de compost. Au cours de la fermentation, les micro-organismes se multiplient et se transforment rapidement, ce qui augmente la production de chaleur. C'est ainsi que commence un processus qui s'accélère de lui-même. La phase de fermentation débute le plus souvent au bout de 4 à 5 jours et peut durer de 1 à 2 semaines."},{"index":2,"size":42,"text":"La fermentation est maximale lorsque la température dans le tas de compost est de 60-70°C. Des températures trop élevées peuvent détruire les micro-organismes utiles et stopper le processus de décomposition. La fermentation a, grâce à sa température élevée, également une action purifiante."},{"index":3,"size":86,"text":"Un certain nombre de germes pathogènes (pour l'homme, les animaux ou les plantes) qui se trouvent dans la matière organique sont détruits. On entend souvent dire que le processus de fermentation détruit les graines et les racines de mauvaises herbes. Cependant, dans la pratique ceci ne se passe guère. Beaucoup de graines de mauvaises herbes ne sont pas détruites dans un tas de compost normal, parce que la température n'y est pas assez élevée. Il existe même certaines mauvaises herbes dont le pouvoir germinatif est augmenté."}]},{"head":"Test de température","index":5,"paragraphs":[{"index":1,"size":94,"text":"Voici une façon simple de savoir si le processus de fermentation a commencé : environ cinq jours après avoir achevé le tas de compost ou après l'avoir retourné pour la dernière fois, y enfoncer un bâton jusqu'au centre. L'y laisser de 5 à 10 minutes. Le tâter dès qu'il est retiré du tas. Il doit être nettement plus chaud que la température de votre corps (de 60 à 70°C). S'il est moins chaud que votre température, c'est que la phase d'échauffement n'a pas commencé. Cela peut être dû aux matériaux utilisés ou à l'aération."}]},{"head":"Phase de refroidissement","index":6,"paragraphs":[{"index":1,"size":31,"text":"La phase de fermentation se transforme progressivement en phase de refroidissement. La décomposition a lieu sans dégagement de chaleur important, si bien que la température du tas de compost baisse lentement."},{"index":2,"size":77,"text":"Au cours de cette phase, de nouvelles sortes de micro-organismes transforment les composants organiques en humus. Le tas reste moite et chaud en son centre, et la température baisse de 50°C à environ 30°C. En régularisant la température ainsi que l'apport d'air et d'eau, on peut accélérer ou ralentir le processus. La durée de la phase de refroidissement dépend de la manière dont le tas est construit, des matériaux utilisés, de l'entretien du tas, du climat, etc."},{"index":3,"size":20,"text":"Le plus souvent, elle dure quelques mois, mais dans les conditions les plus défavorables, elle peut durer jusqu'à un an."}]},{"head":"Phase de maturation","index":7,"paragraphs":[{"index":1,"size":26,"text":"Dans cette phase finale du processus de décomposition, la température baisse jusqu'à atteindre la même température que le sol, selon le climat entre 15 et 25°C."},{"index":2,"size":51,"text":"En plus des micro-organismes déjà cités, on voit intervenir au cours de cette phase des animaux un peu plus gros qui vivent dans le sol. Dans les régions tempérées, ce sont surtout les vers de terre qui se nourrissent de matières organiques fortement décomposées, et contribuent ainsi au processus de décomposition."},{"index":3,"size":68,"text":"Des régions tropicales aux régions semi-arides, ce sont surtout les termites qui jouent un rôle important, bien qu'elles puissent causer aussi beaucoup de problèmes. On ne peut jamais vraiment dire que cette phase est terminée ; le processus de décomposition peut continuer indéfiniment à un rythme très lent. Le compost est prêt à l'utilisation quand il est meuble et quand il a l'aspect d'une belle terre organique brune/noire."}]},{"head":"La pratique du compostage","index":8,"paragraphs":[{"index":1,"size":37,"text":"Dans ce chapitre, les aspects importants de la fabrication de compost sont expliqués. Il faut prêter attention à la composition du matériau organique et l'emplacement du tas. Les dimensions et la construction du tas sont décrites séparément."},{"index":2,"size":17,"text":"Dans le chapitre suivant, différentes méthodes de compostage sont présentées. C / N = 25-30 / 1"}]},{"head":"Matière organique","index":9,"paragraphs":[{"index":1,"size":23,"text":"Exemples des matériaux riches en azote : Des feuilles jeunes, toute sorte de fumier, farine de poisson, vidures de poisson, urine, plantes légumineuses."}]},{"head":"Exemples de matériaux riches en carbone :","index":10,"paragraphs":[{"index":1,"size":20,"text":"Feuilles mortes, résidus végétaux de mais, de canne à sucre, de riz, etc., rameaux, sciure, pulpe de café, carton, etc"},{"index":2,"size":16,"text":"Voir Annexe 1 pour la composition des matériaux de compostage les plus importants. (Source : KIOF)."},{"index":3,"size":72,"text":"Tableau 1 : Exemple du rapport C/N pour quelques matériaux. Faire attention aux matériaux toxiques. L'utilisation de matière organique provenant de plantes traitées avec des pesticides chimiques en est un exemple : elle peut avoir des effets négatifs sur le processus de décomposition et sur la qualité du compost. De plus, il vaut mieux que le matériau organique contienne le moins de germes pathogènes possible, tels que la rouille ou des virus."},{"index":4,"size":30,"text":"Beaucoup de germes pathogènes ne peuvent pas être détruits au cours de la phase de fermentation, et le cycle continuerait si on répandait ce compost sur les terres comme fumier."},{"index":5,"size":54,"text":"Le plus souvent, c'est un manque de matériau facilement décomposable qui est la cause d'une transformation lente dans le tas de compost. Il peut même arriver que le tas devienne inactif. Cela se remarque à la baisse de la température au cours de la phase de fermentation, par exemple au bout de deux jours."},{"index":6,"size":77,"text":"Un tas de compost dans lequel on a mis trop de fragments de plantes jeunes (qui se décomposent facilement) se met en route lentement et s'acidifie rapidement. Un tas de compost acidifié pourrira et sentira mauvais. Le processus de décomposition se déroule alors très lentement, et le compost sera de qualité inférieure. C'est l'association de feuilles jeunes ou de fumier (facilement décomposables) aux fragments de plantes ligneuses (difficilement décomposables) qui donne le plus rapidement un bon compost."},{"index":7,"size":20,"text":"En Annexe, vous trouverez une liste qui présente la composition des nombreuses sortes de matière organique utilisables pour le compostage."}]},{"head":"Micro-organismes","index":11,"paragraphs":[{"index":1,"size":29,"text":"Le processus de compostage est l'effet de l'activité des microorganismes et d'autres organismes plus grands tels que les vers et des insectes. Voir figure 2 dans le paragraphe 2.1."},{"index":2,"size":62,"text":"La première condition du processus de compostage est la présence des organismes qui sont capables du compostage. On peut ajouter ces organismes au tas en mélangeant du compost déjà prêt avec des matériaux organiques. S'il n'y a pas de compost, de la terre peut être ajoutée. Ramasser cette terre de préférence d'un endroit ombragé et humide, par exemple en dessous des arbres."},{"index":3,"size":27,"text":"De la terre qui contient de l'humidité, contient aussi des microorganismes. En général, de la terre qui est séchée au soleil ne contient plus beaucoup d'organismes vivants. "}]},{"head":"Air","index":12,"paragraphs":[]},{"head":"Emplacement du tas de compost","index":13,"paragraphs":[{"index":1,"size":19,"text":"Le choix de l'emplacement du tas de compost est très important. Il faut prêter attention aux aspects suivants :"}]},{"head":"Climat","index":14,"paragraphs":[{"index":1,"size":18,"text":"Si les conditions climatiques sont essentiellement sèches, il est important de protéger le tas de compost du dessèchement. "}]},{"head":"Dimensions et construction d'un tas de compost Dimensions","index":15,"paragraphs":[{"index":1,"size":128,"text":"Les dimensions d'un tas de compost ne sont pas choisies au hasard. Un tas trop large ou trop haut, par exemple, sera mal ventilé. Au départ, sa largeur de base idéale est de 2 à 2,5 m, et sa hauteur de 1,5 à 2 m. Sa longueur dépend de la quantité de matériau organique disponible, mais il est préférable de construire rapidement un petit tas que d'en construire un grand beaucoup plus lentement. Il est fortement conseillé de faire en sorte que le volume initial du tas soit supérieur à 1 m 3 , sinon la température interne restera trop basse et le processus de décomposition se déroulera trop lentement et incomplètement. Dans la phase de maturation, le volume du tas diminuera ; il s'affaissera, pour ainsi dire."}]},{"head":"Construction du tas de compost","index":16,"paragraphs":[{"index":1,"size":43,"text":"Un tas de compost se fait soit à la surface du sol soit dans une fosse ou dans une rigole. Au Chapitre 5, différentes méthodes sont décrites. Quelle que soit la méthode utilisée, le tas de matériau organique se construit d'une manière spéciale."},{"index":2,"size":28,"text":"Le processus de décomposition se déroule plus facilement lorsque le matériau est coupé en petits fragments et si le matériau facilement décomposable est mélangé au matériau difficilement décomposable."},{"index":3,"size":140,"text":"Une bonne suggestion est de construire le tas en commençant par une base de matériau végétal grossier (rameaux ou cannes de canne à sucre). L'air extérieur circule alors plus facilement sous le tas, et un excès d'eau peut être rapidement évacué. Si le tas est fait en couches, il vaut mieux que chacune des couches de matériau végétal ne dépasse pas 10 cm d'épaisseur, et que chacune des couches de fumier ne dépasse pas 2 cm d'épaisseur. La meilleure succession des couches dépend également beaucoup, en plus de la disponibilité de matériau organique, des expériences et réussites personnelles. Une protection de la face supérieure par les matériaux nommés cidessus peut aussi être utile dans les régions à climat très sec : elle empêche une trop grande évaporation de l'humidité du tas. De cette façon le tas se dessèche moins rapidement."}]},{"head":"Conduits d'aération","index":17,"paragraphs":[{"index":1,"size":37,"text":"Il est conseillé de pourvoir le tas de conduits d'aération. Le mieux est de placer, au cours de la construction, des piquets ou des fagots, des bottes de paille ou d'autre matériau solide, verticalement dans le tas."},{"index":2,"size":30,"text":"Les fagots peuvent rester dans le tas parce qu'ils permettent une venti-lation suffisante du tas. Par contre, les piquets doivent en être retirés une fois que la construction est terminée."},{"index":3,"size":60,"text":"Il convient de s'assurer que les conduits d'aération ont toujours un diamètre de 12 cm environ et qu'ils sont à environ 1 m les uns des autres. Au bout de 4 à 5 jours, les conduits d'aération doivent être rebouchés. Une ventilation trop forte peut avoir pour conséquence néfaste de transformer le processus de fermentation en un processus de combustion."}]},{"head":"Méthodes de compostage","index":18,"paragraphs":[{"index":1,"size":44,"text":"Plusieurs méthodes sont employées pour la fabrication du compost. Dans ce chapitre, différentes méthodes sont traitées. Nous sommes très reconnaissants d'avoir pu utiliser les informations de HDRA et KIOF qui nous ont permis de présenter beaucoup de méthodes différentes de compostage dans ce Chapitre."},{"index":2,"size":22,"text":"En fonction des facteurs nommés plus haut, tels que les matériaux disponibles et les conditions climatiques, on peut choisir l'une ou l'autre."},{"index":3,"size":56,"text":"A la longue, il faut que chacun développe une méthode qui lui convient le mieux. Nous vous conseillons d'expérimenter pour trouver la méthode la mieux adaptée à votre situation. Evidemment, il vous est toujours possible de prendre contact avec Agromisa, HDRA ou KIOF pour des informations spécifiques. Vous trouverez leurs adresses en la section 'Adresses Utiles'."}]},{"head":"Méthode indore","index":19,"paragraphs":[{"index":1,"size":13,"text":"La Méthode Indore est beaucoup utilisée pour la préparation du compost en couches."}]},{"head":"Construction du tas","index":20,"paragraphs":[{"index":1,"size":99,"text":"Le tas est construit sur une base de branches et de cannes. Puis on y ajoute successivement : ? une couche de matériel organique difficilement décomposable d'environ 10 cm. ? une couche de matériel organique facilement décomposable de 10 cm. ? une couche de 2 cm de fumier animal, de compost ou de purin provenant d'un réservoir de bio-gaz ; ? une mince couche de terre, qui doit provenir de la couche superficielle (de 10 cm environ) de terre propre (moite) (par exemple en dessous des arbres). Elle apporte au tas les micro-organismes nécessaires à la fabrication du compost."},{"index":2,"size":122,"text":"Il faut répéter cette opération de placement en couches successives jusqu'à ce que le tas ait une hauteur de 1,5 à 2 m. On a ainsi bâti un tas « en couches ». Toute cette opération doit se faire dans une durée limitée, de préférence en une semaine. Voir la figure à la page suivante. Mais on commence cette fois aussi avec une couche de matériel végétal grossier. Ensuite, les matériaux les plus secs et les moins décomposés qui étaient à l'extérieur du tas sont placés au centre du nouveau tas. Ces matériaux secs doivent être humidifiés avant de construire le nouveau tas. Le centre est alors recouvert des matériaux restants. Il ne reste plus rien de la construction initiale en couches."},{"index":3,"size":45,"text":"Au bout de trois semaines, on retourne encore une fois le tas. Il est parfois utile de le retourner une troisième fois. Chaque fois qu'on a retourné le tas, il faut répéter, au bout de quelques jours, un test d'humidité et un test de température."}]},{"head":"Temps nécessaire pour la décomposition","index":21,"paragraphs":[{"index":1,"size":70,"text":"Le processus de décomposition dans le tas est achevé quand les matériaux végétaux sont transformés de façon méconnaissable en une masse sombre et émiettée. Les branchages et les cannes ne seront peut-être pas tout à fait décomposés et donc encore reconnaissables. Dans des circonstances favorables, le processus de décomposition de la méthode Indore se déroule en 3 mois. Dans des conditions moins favorables, il peut durer plus de 6 mois."},{"index":2,"size":101,"text":"Certains matériaux favorisent le développement des microorganismes. Ce sont par exemple l'urine humaine et les cendres de bois. Un peu de ces matériaux dans le tas suffit pour accélérer le développement des micro-organismes. Si une accélération du processus est souhaitée, répandre sur les minces couches de terre un peu d'urine ou de cendres de bois. Mais attention, trop de cendres freine l'activité des micro-organismes ; n'utiliser donc que de petites quantités. L'urine doit être délayée dans 4 fois son volume d'eau, et répandue sur le tas, par exemple avec un arrosoir. La méthode Indore donne le plus souvent de bons résultats."},{"index":3,"size":40,"text":"Les avantages de cette méthode sont les suivants : ? le processus est facile à régulariser et a un déroulement régulier, du fait que le tas est retourné plusieurs fois ; ? on obtient du compost en peu de temps."},{"index":4,"size":19,"text":"Inconvénients de la méthode Indore : ? elle exige beaucoup d'eau. ? elle exige beaucoup de temps de travail."}]},{"head":"Méthode bangalore","index":22,"paragraphs":[{"index":1,"size":42,"text":"La méthode Bangalore est une autre méthode de fabrication de compost également très utilisée. La construction du tas est la même que pour la méthode Indore : on le construit également en une semaine, et il est fait de plusieurs couches successives."},{"index":2,"size":99,"text":"La différence avec la méthode Indore est la suivante. Quelques jours après l'achèvement de la construction, on recouvre complètement le tas à l'aide de boue ou de mottes d'herbe. De cette façon, il est hermétiquement protégé de l'air ambiant. Le processus de décomposition des matières organiques continue, mais ce sont d'autres sortes de micro-organismes qui le provoquent. Ces micro-organismes travaillent plus lentement. C'est pour cela qu'on doit attendre plus longtemps que par rapport à la méthode Indore pour obtenir du compost. La qualité du compost est à peu près identique à celle du compost obtenu par la méthode Indore."},{"index":3,"size":33,"text":"Les principaux avantages de la méthode Bangalore sont : ? l'économie d'eau ; ? l'économie de temps de travail, puisqu'on n'a pas besoin de retourner le tas au cours du processus de décomposition."},{"index":4,"size":79,"text":"Inconvénients de la méthode Bangalore : ? un plus grand nombre de germes pathogènes et de graines de mauvaises herbes survivent au processus de décomposition, parce que la température au cours de ce processus est plus basse ; ? il est plus difficile de régulariser le processus de décomposition, parce que le tas doit continuellement rester couvert ; ? la méthode Bangalore est moins adaptée aux personnes qui n'ont pas ou trop peu d'expérience dans la fabrication de compost."}]},{"head":"Méthode du processus d'échauffement ou méthode de blocs","index":23,"paragraphs":[{"index":1,"size":22,"text":"Cette méthode ressemble à la méthode Bangalore, mais comporte un traitement spécial qui permet de transformer de grandes quantités de matière organique."}]},{"head":"Système continu de blocs","index":24,"paragraphs":[{"index":1,"size":39,"text":"Dans la méthode du processus d'échauffement, on travaille avec des blocs, en système continu. C'est-à-dire qu'on fabrique toujours de nouveaux blocs de matière organique, qui seront entassés et traités de la façon expliquée ci-dessous (Voir aussi figure 6) :"},{"index":2,"size":39,"text":"Le premier jour, on fabrique un bloc avec les matériaux disponibles. Un bloc a une surface au sol de 1 mètre sur 1 au minimum et de 3 mètres sur 3 au maximum, et une hauteur d'environ 1 m."},{"index":3,"size":68,"text":"On laisse reposer le bloc deux jours. Au centre du bloc, le processus de décomposition démarre de lui-même. Au bout de ces deux jours (Figure 6 ; jour 3), on écrase le tas en marchant dessus pour en expulser tout l'air. Le tas a alors si peu d'air qu'il se trouve dans une situation comparable à celle du tas recouvert dont nous avons parlé dans la méthode Bangalore."},{"index":4,"size":24,"text":"Au jour 4, on construit un deuxième bloc sur le premier. Ce nouveau bloc empêche définitivement l'air extérieur de pénétrer dans le premier bloc."},{"index":5,"size":86,"text":"La méthode du processus d'échauffement est en fait la construction d'un bloc chaque jour. La description ci-dessus n'a été faite que pour un bloc, mais en réalité, le deuxième et le troisième jour on construit un nouveau bloc à côté du premier. Ce n'est donc que le quatrième jour que l'on pourra mettre un nouveau bloc sur le premier. Au cinquième jour, un nouveau bloc pourra être construit sur le deuxième, et ainsi de suite. Pour mieux comprendre la méthode de travail, consulter la figure 6."}]},{"head":"Avantages :","index":25,"paragraphs":[{"index":1,"size":22,"text":"? c'est une méthode simple pour transformer de grandes quantités de matériaux organiques ; ? c'est une méthode de construction en continu."}]},{"head":"Inconvénients :","index":26,"paragraphs":[{"index":1,"size":74,"text":"? elle ne peut être appliquée que si l'on dispose de grandes quantités de matériaux ; ? elle exige beaucoup de temps de travail et de matériel ; ? du fait de températures relativement basses, il y a plus de risques que des germes pathogènes ou des graines de mauvaises herbes ne soient pas détruits ; ? il est difficile de régulariser le processus; ? il faut beaucoup d'expérience et de connaissance du compostage."}]},{"head":"Compostage dans des fosses","index":27,"paragraphs":[{"index":1,"size":89,"text":"Dans cette méthode, le compost est fabriqué dans des fosses ayant été creusées dans le sol. La profondeur optimale d'une fosse varie selon les conditions locales du sol et la nappe phréatique. Une fosse modèle devrait mesurer 1,5 à 2 m de largeur, 50 cm de profondeur et peut avoir une longueur variable. Afin de réduire la perte d'eau, il convient de revêtir la fosse d'une mince couche d'argile. Souvent, on creuse plusieurs fosses l'une à côté de l'autre, pour permettre de verser le contenu d'une fosse dans l'autre."},{"index":2,"size":137,"text":"Les matériaux sont mis par couches dans la fosse selon la méthode décrite ci-dessous. Quand on a une fosse plus grande, d'une largeur de 2 m, d'une longueur de 2 m et d'une profondeur de 1 m, il faut verser 1 à 1,5 l d'eau là-dessus avant d'appliquer la couche de sol qui ferme hermétiquement la fosse. 1 10 cm de matériel difficilement décomposable (branchage, tiges) 2 10 cm de matériel facilement décomposable (vert et frais) 3 cm de fumier animal (s'il est disponible) 4 Afin d'obtenir les micro-organismes qui permettent le processus de compostage, une mince couche de terre de la surface de terre cultivable 5 Répéter ces couches jusqu'une hauteur de tas de 1 à 1,5 m 6 Recouvrir avec de l'herbe ou des feuilles (telles que les feuilles de bananiers) pour empêcher l'eau d'évaporer."},{"index":3,"size":79,"text":"Au bout de 2 à 3 semaines, tout le contenu de la fosse doit être versé dans la deuxième fosse. Au bout de 2 à 3 semaines encore, il faut le verser dans la troisième fosse. Après avoir versé le matériel qui est en pleine décomposition de la fosse 1 à la fosse 2, de nouveau matériel prêt à être transformé peut être mis dans la fosse 1. Ainsi, on crée un processus de fabrication de compost en continu."}]},{"head":"Avantages :","index":28,"paragraphs":[{"index":1,"size":38,"text":"Le compostage dans des fosses est une méthode rapide, facile et moins chère du fait qu'on n'a pas d'investissements à faire dans des matériaux. Le besoin en eau étant plus bas, la méthode convient dans des régions sèches."}]},{"head":"Inconvénients :","index":29,"paragraphs":[{"index":1,"size":142,"text":"Le suivi du processus de décomposition est plus difficile que pour un tas qui est construit au-dessus du sol. 1 10 cm de matériel difficilement décomposable (tiges ou résidus végétaux) 2 10 cm de matériel facilement décomposable (des restes des fruits et des légumes) 3 Ajouter 2 cm de fumier animal (s'il est disponible) 4 Afin d'avoir les micro-organismes pour le processus de compostage, il faut mettre une mince couche de terre de la surface du sol cultivable 5 Répéter ces couches jusque le tas ait atteint une hauteur de 50 cm au-dessus de la surface du sol 6 Pour empêcher l'eau d'évaporer et les substances nutritives d'être perdues, recouvrir de terre, de l'herbe ou des feuilles (telles que des feuilles de bananiers). Avant de planter, laisser le rigole de compost et n'y toucher plus pendant un mois pour permettre sa stabilisation."}]},{"head":"Compostage dans des rigoles","index":30,"paragraphs":[]},{"head":"Avantages :","index":31,"paragraphs":[{"index":1,"size":49,"text":"Le compostage dans des rigoles est particulièrement utile contre les atteintes de termites du fait que la plupart d'espèces vivent au-dessus du niveau du sol. On peut semer des graines ou planter des plants autour de la structure de corbeille. Les plantes utiliseront les substances nutritives dans le compost."}]},{"head":"Compostage dans des enclos de vannerie","index":32,"paragraphs":[{"index":1,"size":27,"text":"Pour que le jardin entier devienne plus fertile, il vous faut construire davantage d'enclos de vannerie dans votre jardin et chaque fois les placer à différents endroits."}]},{"head":"Avantages :","index":33,"paragraphs":[{"index":1,"size":31,"text":"Par la méthode de compostage dans des enclos de vannerie, les substances nutritives sont bien utilisées dans un petit potager. Cette méthode convient aussi à l'utilisation des petites quantités de déchets."}]},{"head":"Compostage boma","index":34,"paragraphs":[{"index":1,"size":42,"text":"En général, un éleveur d'animaux dispose d'un boma ( un enclos où on garde les animaux tout le temps ou seulement pendant la nuit) à la ferme. Pour que les animaux gardent un état propre, une litière est mise dans le boma."},{"index":2,"size":46,"text":"Il convient de poser suffisamment de litière nouvelle chaque semaine, pour que toute l'urine soit absorbée. N'importe quel matériel organique séché convient à la construction de la litière. Par exemple, les tiges de maïs, les mauvaises herbes, l'herbe sèche ou les feuilles sèches, la sciure, etc."},{"index":3,"size":52,"text":"La meilleure chose est de mélanger différents matériaux. La litière absorbe l'urine et les crottes, lesquels constituent une nutrition très riche pour les plantes et empêchent les pertes par le lessivage ou le séchage du fumier. Le paysan qui met régulièrement une litière aura une grande quantité de compost de meilleure qualité."},{"index":4,"size":60,"text":"Du fumier bien mélangé peut être sorti du Boma et porté vers l'extérieur, quotidiennement ou bien une fois par semaine. Si l'on enlève chaque jour, il faut le mettre en tas et chaque jour étaler une petite quantité de terre là-dessus. On peut continuer cette procédure jusqu'à ce qu'il y ait suffisamment de matériel pour construire un boma de compostage."},{"index":5,"size":12,"text":"KIOF a décrit la méthode suivante pour fabriquer du compost boma :"},{"index":6,"size":30,"text":"Chaque fois qu'on enlève le fumier du boma, il faut immédiatement le composter. Les fumiers de chèvres, de moutons, de lapins et de poules sont tous riches en substances nutritives."},{"index":7,"size":58,"text":"La litière étant composée de matériel végétal, on n'a pas besoin d'ajouter plus de matériaux verts. Pour éviter l'effort du transport du fumier et de la litière utilisée, il est pratique de fabriquer le compost à côté du boma. 2 Ensuite, une couche de fumier d'environ 10 cm et de litière est jetée du boma dans la rigole."},{"index":8,"size":10,"text":"3 Ce mélange est recouvert de 5 cm de terre."},{"index":9,"size":32,"text":"4 Une autre couche de fumier d'environ 10 cm est ajoutée et recouverte encore par de la terre. Il faut continuer cette procédure jusqu'à ce que le tas de compost soit achevé.  "}]},{"head":"Le compostage des matériaux spécifiques","index":35,"paragraphs":[{"index":1,"size":61,"text":"Quand on transforme un mélange de déchets organiques, la décomposition devient plus facile et de ce fait le produit final est mieux équilibré. Des fois, on a une grande quantité de matériel provenant d'une seule sorte de matériau et d'autres matériaux ne sont guère disponibles pour faire un mélange. Cependant, si l'on traite correctement ces matériaux, ils constitueront un bon compost."}]},{"head":"Composter des plantes aquatiques","index":36,"paragraphs":[{"index":1,"size":56,"text":"Le problème des mauvaises herbes aquatiques dans les lacs et les eaux navigables, qui deviennent de plus en plus mal équilibrés et perturbés, peut prendre beaucoup d'importance. De tels problèmes apparaissent en général à cause de l'eutrophisation de l'eau de surface et à cause de l'introduction de plantes exotiques telles que la jacinthe d'eau, Eichnornia crassipes."},{"index":2,"size":37,"text":"Lutter contre les mauvaises herbes aquatiques en utilisant des herbicides est nuisible à l'environnement, coûteux et du gaspillage ! En effet, elles peuvent constituer une amélioration valable du sol si elles sont compostées de manière suivante :"},{"index":3,"size":27,"text":"1 Les mauvaises herbes aquatiques sont récoltées et étalées pendant quelques jours, le long des berges, pour sécher, jusqu'à ce que le poids soit réduit de moitié."},{"index":4,"size":61,"text":"2 Ensuite, on fait un tas de compost des plantes fanées, de la terre, des cendres, de fumier animal et d'ordures ménagères (restes de repas).  Les algues marines constituent un engrais potentiel et l'on n'a littéralement qu'à se baisser pour les ramasser. Elles contiennent des nom-breux oligo-éléments et des substances qui régularisent la croissance, qui sont très avantageux pour les cultures."}]},{"head":"Composter des algues marines","index":37,"paragraphs":[]},{"head":"Elimination du sel","index":38,"paragraphs":[{"index":1,"size":49,"text":"Pour le compostage des algues marines le besoin le plus important est d'éliminer la plus grande partie du sel. Ceci s'effectue très facilement : En saison de pluies, les algues sont ramassées et étalées ou dispersées en petits tas. Au bout d'un certain temps, la pluie emporte le sel."}]},{"head":"Utilisation directe d'algues marines comme engrais","index":39,"paragraphs":[{"index":1,"size":28,"text":"La première utilisation simple des algues marines comme engrais commence par le séchage des algues. Ensuite, elles sont moulues. La poudre ainsi obtenue est directement utilisable comme engrais."}]},{"head":"Compostage","index":40,"paragraphs":[{"index":1,"size":56,"text":"La deuxième utilisation est le compostage des algues marines. Si on compose des algues encore humides, il faut veiller à ajouter bien des matériaux secs, de la paille par exemple. Les algues séchées peuvent être utilisées dans un tas de compost ordinaire. En général, le processus de compostage des algues marines semble se dérouler très rapidement."},{"index":2,"size":56,"text":"En résumé, les algues marines sont une source potentielle d'engrais pour les paysans des côtes. Elles doivent d'abord être dessalées. Elles peuvent provoquer une certaine hausse du rendement, mais ne sont pas un remède miracle. L'action des substances régulatrices de la croissance dépend également beaucoup de la nature du sol auquel on ajoute les algues marines."}]},{"head":"Composter la pulpe de café","index":41,"paragraphs":[{"index":1,"size":36,"text":"Dans les régions productrices du café, les grandes quantités de pulpe de café constituent un problème. Les tas en pleine fermentation produisent une mauvaise odeur ; des mouches se multiplient et les eaux navigables sont polluées."},{"index":2,"size":55,"text":"La pulpe de café constitue un bon engrais, étant riche en matière organique, azote et potassium. Certains cultivateurs étalent la pulpe humide et lourde sur leurs plantations de café. Mais le transport et l'étalement de la pulpe peuvent poser des problèmes ce qui peut entraîner des mauvaises odeurs et des problèmes de croissance des plantes."},{"index":3,"size":59,"text":"Il vaut beaucoup mieux de composter d'abord le matériel pour permettre une utilisation plus efficace. Pour empêcher une grande quantité de l'eau de pénétrer dans le tas de compost, il faut construire un toit au-dessus de ces tas élevés ou les recouvrir. Le plancher élevé peut être construit de cannes de bambou montées sur des briques ou des pierres."},{"index":4,"size":52,"text":"Avant de la composter, il faut drainer la pulpe et la charger dans des trous jusqu'une hauteur d'environ un mètre. Si disponible, les déchets de légumes peuvent être mélangés ainsi qu'un peu de terre ou de compost. Ceci permet aux micro-organismes, qui sont nécessaires pour la décomposition des déchets, de se développer."},{"index":5,"size":21,"text":"Le tas doit être retourné toutes les 4 à 6 semaines. Le compost doit être prêt en 4 à 6 mois."}]},{"head":"Composter les ordures ménagères","index":42,"paragraphs":[{"index":1,"size":30,"text":"Par ordures ménagères, on entend les matériaux en excédent et inutiles qui proviennent du ménage, par exemple les restes de repas, des papiers, les balayures ou des cendres de bois. "}]},{"head":"Composter en tas","index":43,"paragraphs":[{"index":1,"size":50,"text":"Les déchet organiques sont généralement produits en quantités faibles, mais fréquemment. Il est conseillé de ne pas ajouter un peu de déchets chaque jour sur le tas, mais plutôt de les accumuler d'abord, et de ne les mettre sur le tas que quand on en a déjà une bonne quantité."},{"index":2,"size":63,"text":"Pour avoir un ordre de grandeur : n'ajouter une couche supplémentaire que quand elle a environ 30 cm d'épaisseur. Une autre manière de régulariser la disponibilité de déchets est de ramasser du matériel organique supplémentaire, mais cela demande du temps et de l'énergie. Du fait que les quantités de déchets organiques sont souvent faibles, on ne peut construire qu'un petit tas de compost."},{"index":3,"size":60,"text":"Du fait que la plupart des ordures ménagères ont peu de structure (comme les restes de repas et la cendre de bois), la ventilation risque d'être mauvaise. Par conséquent, il faut particulièrement faire attention à la ventilation du tas de compost quand on le construit principalement à partir d'ordures ménagères. Voir les paragraphes 4.3 et 4.6sous-paragraphe sur les conduits d'aération."}]},{"head":"Composter dans une barrique","index":44,"paragraphs":[{"index":1,"size":29,"text":"Au Mali, l'institution IPR/IFRA (dont les adresses sont données en Annexe 2), une méthode a été développée pour faire du compost dans une barrique à partir des ordures ménagères."},{"index":2,"size":35,"text":"L'utilisation de barriques permet de réaliser le compostage près de la maison d'une manière plus hygiénique et plus facile. La barrique permet aussi de régulariser l'aération, l'humidité et la température pendant le processus de compostage."},{"index":3,"size":15,"text":"? Préparer la barrique Pour empêcher la barrique de rouiller, il faut peindre son intérieur."},{"index":4,"size":26,"text":"Percer trois trous (1 cm de diamètre) autour de la troisième partie supérieure et la troisième partie inférieure de la barrique, 52 cm l'un de l'autre."},{"index":5,"size":55,"text":"Faire un autre trou de 1 cm dans la base de la barrique. Le trou basal permet le liquide de filtrer de la matière organique qui est en pleine décomposition. Si le liquide reste dans la barrique, le matériel qui se trouve au fond pourrira, entraînant une mauvaise odeur et une mauvaise qualité du compost."},{"index":6,"size":39,"text":"Enlever le dessus ; il est utilisé en tant que couvercle régularisant le processus de compostage quand la barrique est remplie. Quand les ma-tériaux organiques décomposent, le volume diminue et le couvercle descendra en glissant et fermera la barrique."},{"index":7,"size":35,"text":"Faire une ouverture de 65 cm hauteur et 20 cm largeur, environ 20 cm au-dessus de la base de la barrique, qui permet de suivre le processus de compostage. Normalement cette ouverture devrait être couverte."},{"index":8,"size":30,"text":"Placer la barrique sur un support trépied d'une hauteur de 25 cm, de sorte que vous soyez en mesure de poser un récipient en bas pour recueillir toute liquide fermentée."},{"index":9,"size":70,"text":"? Méthode de fabrication de compost Il convient de travailler avec deux ou trois barriques : la première peut être utilisée pour faire un compost initial, qui est passé à la passoire et mis dans la seconde barrique pour continuer le processus de compostage. La troisième barrique est utilisée pour conserver du compost prêt à l'emploi. On n'a pas besoin de percer des trous dans la seconde ou troisième barrique."},{"index":10,"size":57,"text":"N'importe quelle matière organique peut servir à faire du compost dans les barriques, spécialement des ordures ménagères. Couper la matière organique en petits fragments, avant de les verser dans la barrique et mélanger les différents matériaux. Si vous disposez de suffisamment de matériel, vous pouvez remplir la barrique en une seule fois sinon vous la remplissez lentement."},{"index":11,"size":125,"text":"Pour améliorer le processus, on peut recueillir le liquide qui filtre de la barrique par le trou inférieur pour l'ajouter à la matière organique décomposant qui se trouve dans la barrique. Ainsi, on réduit au minimum la perte des substances nutritives. ? Remplir la barrique d'un seul coup Si vous remplissez la barrique d'un seul coup, l'humidité du mélange dans la barrique sera plus ou moins maintenue. De l'air entrera dans la barrique par les trous. Au bout de 4 ou 5 jours, vous pouvez retourner le mélange dans la seconde barrique et il y restera pendant 8 à 10 jours. Au bout de cette période, le compost sera probablement prêt. Il est évident que la durée du processus de compostage dépend du climat (température)."},{"index":12,"size":10,"text":"L'IPR/IFRA a développé une recette utilisant la méthode décrite ci-dessus."},{"index":13,"size":116,"text":"Composter les matériaux suivants : 52 kg de la sciure 1,7 kg de fumure de poules 2,5 kg de Phosphate Tilemsi naturel 800 ml d'urine Au bout de 45 jours le processus du compostage devrait avoir bien avancé ? Remplir lentement la barrique Si vous remplissez lentement la barrique, il faut que vous comptiez le nombre de jours pour le processus à partir du moment où la barrique est entièrement remplie. Ensuite, au bout de 4 à 5 jours, le mélange est passé à la passoire. La fine matière peut être mise dans la seconde barrique. Les grands fragments et le matériel non encore décomposé sont remis à la première barrique, qu'on peut remplir lentement encore."}]},{"head":"Composter les ordures humaines ou les vidanges","index":45,"paragraphs":[{"index":1,"size":42,"text":"Le Quand le compost est prêt, il n'est pas toujours possible de l'utiliser toute suite et il faut le conserver quelque temps afin de l'appliquer. Il faut veiller à ce que le compost ne perde pas de sa fertilité pendant le stockage."}]},{"head":"Prêter attention au compost stocké","index":46,"paragraphs":[{"index":1,"size":35,"text":"Compost ne doit pas être laissé à découvert sous les pluies ou au soleil. Les pluies éliminent les substances nutritives et le soleil peut faire brûler le compost. Le compost perd de sa fertilité ensuite."},{"index":2,"size":27,"text":"Pour éviter cela, il faut recouvrir le tas de compost. On peut utiliser les feuilles de bananiers, des feuilles de palmes tressées, ou un morceau de plastique."},{"index":3,"size":42,"text":"Une autre raison d'utiliser le compost rapidement est qu'il pourrait servir de lieu d'incubation à des insectes indésirables tels que des termites et des scarabées nasicornes (Oryctes rhinoceros).  ? Appliquer le compost en fosses ou en rigoles où les végétaux sont plantés."}]},{"head":"Engrais","index":47,"paragraphs":[{"index":1,"size":27,"text":"Cette méthode est particulièrement utile dans les régions sèches. Les plantes sont plantées dans du compost pur ou du compost mélangé avec la couche supérieure du sol."}]},{"head":"Terre de pépinière, terreau, plantation d'arbres.","index":48,"paragraphs":[{"index":1,"size":75,"text":"Le compost est très avantageux pour les plants de la pépinière, soit dans un lit des semences ou une pépinière où ils germent, soit dans des pots ou dans des fosses dans lesquel(le)s les jeunes plants ou les jeunes arbres sont plantés. Compost est bien capable de retenir l'eau, alors les jeunes plants ne souffriront pas facilement de manques d'eau et ils obtiendront à partir du compost tous les éléments nutritifs dont ils ont besoin."}]},{"head":"Prévention et lutte contre l'érosion","index":49,"paragraphs":[{"index":1,"size":39,"text":"L'emploi du compost pour la prévention de l'érosion est fortement lié à l'amélioration de la fertilité du sol. Un sol bien fertilisé est en général moins sensible à l'érosion, du fait que la matière organique maintient l'unité du sol."},{"index":2,"size":47,"text":"En plus, le compost sert de couvre-terre pour protéger le sol contre la pluie. Voir Agrodok nº 11 : « La protection des sols contre l'érosion dans les tropiques », pour lire plus sur le rôle de la matière organique dans la réduction de l'érosion du sol."}]},{"head":"Collecter l'eau de ruissellement","index":50,"paragraphs":[{"index":1,"size":30,"text":"Pour lutter contre l'érosion à l'aide du compost, on peut creuser des fossés bien drainés, parallèles aux courbes de niveau, et les remplir de compost qui retiendra l'eau de ruissellement."}]},{"head":"Le compost comme nourriture de poissons","index":51,"paragraphs":[{"index":1,"size":36,"text":"En appliquant de l'engrais aux viviers, le compost constitue une bonne nourriture de poissons. La nourriture naturellement présente dans des viviers consiste en très petits plants (des algues ou phytoplancton) et de très petits animaux (zooplancton)."},{"index":2,"size":62,"text":"Du compost (ou du fumier) est ajouté au vivier comme nourriture indirecte des poissons. L'ajout de fumier entraîne le développement du plancton dans l'eau. Beaucoup d'espèces de poissons, tels que les Tilapia et la famille des carpes (Cyprinidae) se nourrissent de plancton. En général, les poissons réagissent bien aux ajouts de fumier dans les viviers. La production peut dès lors augmenter considérablement."}]},{"head":"Gérer le vivier","index":52,"paragraphs":[{"index":1,"size":62,"text":"Pour que les poissons dans les viviers soient en bonne santé et se développent bien, il faut que la qualité de l'eau y soit bonne. Les poissons ont besoin d'oxygène pour pouvoir grandir. En grande partie, cet oxygène est produit par les algues qui flottent dans l'eau ; s'il y a une grande quantité d'algues dans l'eau, elle prend une couleur verte."},{"index":2,"size":103,"text":"Pour maintenir la qualité de l'eau et entretenir la teneur de la nourriture de poissons naturellement disponible dans l'eau, une bonne application d'engrais est importante. La quantité d'engrais à ajouter dans l'eau dépend du nombre des poissons qui se trouvent dans le vivier. Si une trop faible quantité d'engrais est ajoutée, il y aura moins de nourriture naturelle qui est produite et par conséquent moins de poissons sont produits. L'apport d'une quantité trop importante d'engrais ou l'apport irrégulier d'engrais peut entraîner un manque d'oxygène (du fait que les algues et le plancton utilisent de l'oxygène pendant la nuit) et la mort des poissons."}]},{"head":"Appliquer du compost au vivier","index":53,"paragraphs":[{"index":1,"size":51,"text":"Il est conseillé d'appliquer le compost au moins une fois par semaine et le mieux est de le faire chaque jour. Il est important de distribuer le compost de manière égale sur le vivier pour permettre aux algues et au plancton de l'utiliser de façon optimale et de pouvoir se multiplier."},{"index":2,"size":42,"text":"En pratique, on ajoute souvent dans les viviers des matériaux organiques bruts. Une grande partie de ces déchets pourrit, ce qui consomme beaucoup d'oxygène de l'eau. Cela augmente le risque que les poissons ne puissent pas avoir suffisamment d'oxygène et qu'ils s'asphyxient."},{"index":3,"size":23,"text":"Il est plus avantageux d'utiliser le compost que les déchets organiques sous leur forme brute, puisque le compost constitue du matériel déjà décomposé."},{"index":4,"size":88,"text":"L'ajout de compost aux viviers ne fait pas beaucoup baisser la teneur en oxygène de l'eau. Ceci pour deux raisons : le compost ne consomme que peu d'oxygène, et l'ajout de compost a pour conséquence un développement important du phytoplancton qui produit de l'oxygène. Du fait de ces deux conséquences positives, on peut ajouter beaucoup plus de compost que de déchets organiques frais à l'eau des viviers, et cela permettra de produire plus de poissons. Contrairement aux engrais artificiels, le compost peut être consommé directement par les poissons."},{"index":5,"size":37,"text":"On en conclut donc que le compost est une nourriture idéale pour les poissons des élevages intensifs. On n'assiste pas à des carences en oxygène ; on peut donner plus de nourriture, et par conséquent produire plus."},{"index":6,"size":26,"text":"Un vivier bien géré et fertilisé peut soutenir 3 kg de poissons par 100 m 2 par jour. En pratique, cette quantité est généralement plus faible."},{"index":7,"size":72,"text":"A certains endroits, le compostage se fait dans un coin du vivier. Cette méthode est moins efficace que la fabrication de compost sur terre suivi par l'étalement sur le vivier entier. Les rendements de poissons sont plus élevés lorsqu'on utilise la dernière méthode. Ceci est probablement dû au fait que les substances nutritives d'un tas de compost construit dans un coin du vivier ne sont pas bien distribuées partout dans le vivier."}]},{"head":"Nourriture de poissons à partir de la jacinthe d'eau.","index":54,"paragraphs":[{"index":1,"size":118,"text":"La nourriture de poissons à base de la jacinthe d'eau décomposée (voir paragraphe 6.1), des excréments et de la paille de riz donnée au Tilapia peut rapporter 360 kg par 100 m 2 . La recette suivante est utilisée pour faire du compost : ? Sécher au soleil 1000 kg de la jacinthe de l'eau jusqu'a ce que le poids a diminué jusqu'à environ 400 kg. Ensuite, mélanger bien la jacinthe de l'eau séchée et l'étaler sur une couche de paille (de riz) qui mesure 3 mètres sur 3. Faire un tas de compost qui mesure environ un mètre de hauteur et transpercer le tas à l'aide de cannes en bambou pour que de l'air puisse y pénétrer."},{"index":2,"size":39,"text":"? Mélanger le tas de compost toutes les deux semaines, en déplaçant le matériel du côté inférieur vers le côté supérieur et vice versa. Au bout de deux mois, le compost sera prêt pour être distribué sur le vivier."},{"index":3,"size":48,"text":"Afin de récolter 25 kg de Tilapia d'un vivier d'environ 100 m 2 au bout de six mois, il faut les nourrir d'environ 2 kg de compost tous les jours. Pour arriver à ces quantités, vous aurez besoin de quatre tas de compost de la taille décrite ci-dessus."},{"index":4,"size":50,"text":"Voir aussi ; Agrodok nº 15 : « La pisciculture en eau douce à petite échelle » pour avoir plus de renseignements généraux sur les vivriers, et Agrodok nº 21 : «La pisciculture à la ferme » pour des informations en détails sur des méthodes intégrées de nourrir des poissons."},{"index":5,"size":7,"text":"8 Fumier liquide et extraits de compost"},{"index":6,"size":60,"text":"L'objectif de la fabrication de fumier liquide et des extraits de compost est de fournir rapidement aux plantes la nourriture naturelle appropriée pendant la période de croissance. Le fumier liquide et les extraits de compost sont prêts à être utilisés au bout de deux ou trois semaines, tandis que cette période est de six semaines ou plus pour le compost."},{"index":7,"size":57,"text":"Le fumier liquide et les extraits de compost peuvent paraître superflus dans un système organique, dans lequel l'accent est mis à l'alimentation du sol plutôt que des plantes. Cependant, il arrive que la nourriture liquide soit la seule solution, par exemple quand les racines sont abîmées et ne sont plus en mesure d'absorber suffisamment de substances nutritives."},{"index":8,"size":21,"text":"La nourriture liquide provenant de fumier animal ou d'une plante telle que la Consoude (Symphytum spp.) fournit rapidement des éléments nutritifs."},{"index":9,"size":24,"text":"Une nourriture liquide est essentielle aussi lorsque les plantes sont cultivées dans un endroit restreint ou dans un pot ou un sac en plastic."}]},{"head":"Comment faire du fumier liquide et des extraits de compost ?","index":55,"paragraphs":[{"index":1,"size":12,"text":"Note : les instructions pour les extraits de compost commencent au nº3"},{"index":2,"size":93,"text":"Vous aurez besoin des équipements et des matériaux suivants : ? Du fumier -soit de poules ou des lapins ou un mélange des deux ? Un récipient -une barrique ou une demi-barrique (seau) pour des faibles quantités ? Un sac fort ou sac de jute ? Une perche forte et de la corde 2 Suspendre le sac qui contient le fumier dans un récipient rempli de l'eau propre. Le sac doit être solidement fermé avec une corde et suspendu à une perche forte qui est placée à travers le dessus de la barrique."},{"index":3,"size":41,"text":"3 Pour préparer les extraits de compost, des branches et des feuilles vertes et succulentes sont coupées en morceaux et mises dans la barrique qui est remplie de l'eau propre. On n'a pas besoin de mettre les feuilles dans un sac."},{"index":4,"size":21,"text":"4 Faire reposer le fumier (pour le fumier liquide) ou les feuilles coupées (pour les extraits de compost) pendant 15 jours."},{"index":5,"size":10,"text":"5 Recouvrir la barrique pour empêcher l'eau de s'évaporer excessivement."},{"index":6,"size":31,"text":"Au bout de trois jour et ensuite, tous les deux jours, remuer le liquide dans la barrique. Pour le fumier liquide, remuer en levant le sac à l'aide de la perche."},{"index":7,"size":25,"text":"Au bout de 15 jours, l'eau prendra une couleur noirâtre et la plus grande partie des substances nutritives seront dissolues dans l'eau. Enlever le sac."},{"index":8,"size":38,"text":"Diluer le contenu de la barrique dans le rapport un à deux (un part de fumier liquide ou d'extrait de compost ajouté à deux parts de l'eau propre). Arroser les plantes aux pieds et éviter d'arroser les feuilles."},{"index":9,"size":68,"text":"Arroser les végétaux avec ce fumier liquide ou l'extrait de compost pendant deux ou trois semaines. C'est efficace comme fumure en surface après plantation des végétaux utilisant du compost.   Dans la recette ci-dessous, des matières organiques sont spécifiées. Les renseignements donnés dans le dernier paragraphe vous permettent de varier les matériaux et d'y expérimenter afin de trouver la meilleure méthode de préparer le Bokashi dans votre situation spécifique."}]},{"head":"Méthode aérobique","index":56,"paragraphs":[{"index":1,"size":12,"text":"Voici une recette pour la préparation de Bokashi (de la Costa Rica):"},{"index":2,"size":69,"text":"Matériel nécessaire : ? 1 sac de fumier de poule (riche en azote) ? 1 sac de son de riz (riche en carbone) ? 1 sac de charbon de bois (petits morceaux de 1-2 cm) ? 1 sac de résidus de canne à sucre ? 2 litres de mélasse ? ½ sac de Bokashi ou du compost (contenant des ME) ? 2 sacs de terre propre ? de l'eau"}]},{"head":"Mélanger:","index":57,"paragraphs":[{"index":1,"size":27,"text":"Il est important de bien mélanger les matériaux. Il convient de le faire comme suit : ? Couper tous les matériaux en petits morceaux et les empiler."},{"index":2,"size":305,"text":"? Dissoudre les mélasses dans l'eau (20 l) ; le chauffage de l'eau rend la dissolution plus facile. ? Etaler une couche de matériaux ; utiliser un tiers de la quantité de la recette pour constituer une couche. ? Arroser la couche à l'aide d'un arrosoir en utilisant la solution de mélasse. ? Poser une autre couche du matériau différent (1/3 de la quantité) sur la première couche. ? Arroser cette couche aussi avec la solution de mélasse ? Répéter ce processus jusqu'à ce tous les matériaux soient utilisés. ? Si vous avec un seul tas de matériaux mouillés, retourner le tas encore une fois pour que les matériaux soient mieux mélangés. ? Enfin, faire un tas d'environ 50 cm de hauteur. Dans des zones qui ont un climat plus froid, le tas peut être un peu plus élevé pour permettre des températures assez élevées dans le tas (dans des régions au climat plus chaud, le tas pourrait être un peu plus bas pour l'effet contraire). ? Recouvrir le tas de sacs ou de nattes. Eviter l'utilisation de matière plastique parce qu'elle empêche l'air de passer. ? Retourner le tas, toutes les 12 heures. Faire attention de le faire de sorte que le matériel qui était à l'extérieur finisse par être à l'intérieur et vice versa. Si la température du tas est très élevée, retourner plusieurs fois pour baisser la température. ? Au bout d'une journée, le mélange sera brun et quand vous enlevez la couverture vous découvrirez probablement des champions qui ont poussé. ? Au bout du troisième jour, enlever la couverture du tas afin de faire sécher le mélange. La couleur changera de brune en grisâtre. Le tas aura une odeur aigre-douce. ? Continuer à retourner le tas toutes les 12 heures pour que le séchage soit plus rapide. Sécher bien le Bokashi."}]},{"head":"Temps de préparation","index":58,"paragraphs":[{"index":1,"size":44,"text":"Dans les zones tropicales, le Bokashi préparé en conditions aérobiques est prêt au bout de 5-7 jours. Sous des climats tempérés, le processus prend plus de temps, probablement 2-3 semaines. Sa couleur est grise, sa texture est fine et il a l'aspect de poussière."}]},{"head":"Stockage","index":59,"paragraphs":[{"index":1,"size":37,"text":"De préférence, le Bokashi est appliqué toute suite, mais il est aussi possible de le mettre en sacs et de le stocker pendant environ 3 mois, dans un endroit sec et bien ventilé, à l'abri du soleil."}]},{"head":"Préparation anaérobique","index":60,"paragraphs":[{"index":1,"size":17,"text":"Si vous n'avez à préparer que de petites quantités, il est à conseiller d'appliquer le processus anaérobique."},{"index":2,"size":41,"text":"Le début du processus, c'est à dire le mélange et l'arrosage, est pareil au processus aérobique. Après avoir mélangé les ingrédients, emballer le mélange dans un grand sac ou récipient en plastique noir. Fermer hermétiquement. Tenir à l'abri du soleil direct."},{"index":3,"size":44,"text":"Le Bokashi est prêt dès qu'il répand une odeur douce de matière fermentée (l'odeur de la bière ou du vin) et lorsque vous verrez des champions qui poussent. Si l'odeur est mauvaise (pourrie), le Bokashi a mal fermenté et ne devrait pas être utilisé."}]},{"head":"Temps de préparation","index":61,"paragraphs":[{"index":1,"size":18,"text":"Il faut 3-4 jours pour la fermentation dans les zones tropicales et 7-8 jours dans les zones tempérées."},{"index":2,"size":17,"text":"Si la production de Bokashi ne réussit pas, expérimenter avec d'autres types de matériaux et différentes quantités."}]},{"head":"Appliquer le bokashi","index":62,"paragraphs":[{"index":1,"size":37,"text":"On peut utiliser le Bokashi de la même façon dont on utilise les engrais artificiels. On peut l'appliquer au sol directement après la planta-tion, bien qu'il faille attendre pendant 14 jours avant de planter ou de semer."},{"index":2,"size":34,"text":"Enfouir le Bokashi dans le sol à une profondeur de 5-10 cm. Il est important de recouvrir le Bokashi de terre du fait que les microorganismes ne survivent pas à la lumière du soleil."},{"index":3,"size":125,"text":"? Pour la plupart des cultures maraîchères, il suffit d'appliquer le Bokashi trois fois pendant la saison culturale. L'ajout d'une poignée (30 grammes) de Bokashi au sol, à une distance de 15-20 cm des racines des plantes. ? Outre aux cultures maraîchères, on peut bien appliquer le Bokashi aux plantations du café, des bananiers et du tabac, etc. ? Pour des cultures agricoles, l'application de 100-200 grammes de Bokashi par mètre carré en moyenne est suffisante. Si le niveau de matière organique dans le sol est faible, il faut ajouter plus de Bokashi. La dose maximum est de 1 kg par mètre carré. ? Bokashi peut aussi être ajouté aux trous de plantation. Recouvrir le Bokashi avec de la terre avant de planter les plants."},{"index":4,"size":29,"text":"Bokashi ne doit jamais toucher directement les tiges ou les racines de plantes : après l'application au sol, il faut attendre 14 jours avant de planter ou de semer."},{"index":5,"size":70,"text":"10 Oui ou non à la préparation de votre propre engrais organique Ce chapitre traite des avantages et des inconvénients généraux de la préparation de votre propre engrais organique. Ils sont toujours relatifs : un inconvénient dans une situation donnée peut être un avantage dans une autre situation. Pour terminer ce chapitre, nous proposons une liste de contrôle qui pourra servir de fil conducteur pour prendre votre décision à vous."}]},{"head":"Avantages et inconvénients","index":63,"paragraphs":[{"index":1,"size":16,"text":"Avantages ? Le coût du compost est de beaucoup inférieur à celui de l'achat d'engrais chimiques."},{"index":2,"size":23,"text":"? Réutilisation de déchets organiques qui contiennent des substances nutritives ; autrement ils seraient laissés à pourrir et les substances nutritives seraient perdues."},{"index":3,"size":9,"text":"? L'engrais organique peut améliorer la structure du sol."},{"index":4,"size":24,"text":"? A long terme, la fertilité du sol est améliorée : Les substances nutritives du compost sont libérées progressivement et sur une longue période."},{"index":5,"size":17,"text":"? Dû à l'augmentation de matière organique, la capacité de rétention de l'eau du sol est améliorée."},{"index":6,"size":15,"text":"? L'engrais organique contient beaucoup d'oligo-éléments que les engrais chimiques en général ne contiennent pas."},{"index":7,"size":32,"text":"? Il semble que les plantes qui poussent sur un sol traité à l'engrais organique soient plus résistantes aux maladies que celles qui poussent sur un sol traité uniquement aux engrais chimiques."}]},{"head":"Inconvénients","index":64,"paragraphs":[{"index":1,"size":18,"text":"? Le compostage, la préparation de fumier liquide ou de Bokashi exige beaucoup de temps et de travail."},{"index":2,"size":25,"text":"? La fabrication d'engrais organiques n'est pas possible partout. Cela dépend entre autres de la place et du matériel disponible, ainsi que des circonstances locales."},{"index":3,"size":19,"text":"? L'utilisation de compost peut parfois augmenter le risque d'avoir des mauvaises herbes ou des maladies dans la culture."},{"index":4,"size":16,"text":"? Un tas de compost attire des animaux nuisibles, tels qu'insectes, rats, souris, et également serpents."},{"index":5,"size":17,"text":"? La teneur des engrais organiques en substances nutritives est nettement inférieure à celle des engrais chimiques."}]},{"head":"Oui ou non à la fabrication des engrais organiques","index":65,"paragraphs":[{"index":1,"size":48,"text":"Avant de commencer la fabrication d'engrais organiques, il est important de vérifier certain points afin d'augmenter la chance de réussite et d'empêcher les déceptions : ? Avez-vous ou bien ont ceux avec qui vous travaillez suffisamment de temps et d'énergie à consacrer à la fabrication d'engrais organiques ?"},{"index":2,"size":23,"text":"? Qu'est-ce que vous gagnez en commençant la fabrication ? (Comparer les prix des engrais artificiels, considérer la fertilité actuelle du sol, etc.)."},{"index":3,"size":34,"text":"? Y-a-t-il suffisamment de matière organique pour fabriquer de l'engrais organique ? (Considérer les possibilités de chercher de manière active des résidus organiques ou de planter des haies dont on peut couper des feuilles)."},{"index":4,"size":17,"text":"? Lorsque vous travaillez avec des agriculteurs, ont-ils assez de motivation pour introduire une nouvelle méthode ?"},{"index":5,"size":15,"text":"? Existe-t-il des alternatives moins chères et plus faciles, telles que les engrais verts ?"},{"index":6,"size":28,"text":"Tous ces aspects et d'autres encore doivent être considérés. Il est donc vivement conseillé de discuter de tous ces points avant de passer à la mise en pratique."}]},{"head":"Questions pratiques servant de fil conducteur pour démarrer","index":66,"paragraphs":[{"index":1,"size":32,"text":"Les questions pratiques suivantes peuvent servir de fil conducteur quand vous commencez à faire des engrais organiques : ? Quelles connaissances doit-on posséder sur le processus de fabrication de ces engrais ?"},{"index":2,"size":7,"text":"? Où sera situé le tas ?"},{"index":3,"size":8,"text":"? Quelle taille peut/doit avoir le tas ?"},{"index":4,"size":13,"text":"? Quelle est la quantité et le type de matériau organique disponible ?"},{"index":5,"size":10,"text":"? Avec quelle régularité le matériau organique est-il disponible ?"},{"index":6,"size":9,"text":"? Quelle est la qualité du matériau organique ?"},{"index":7,"size":7,"text":"? Qui va exécuter le travail ?"},{"index":8,"size":7,"text":"? De combien de temps dispose-t-on ?"},{"index":9,"size":20,"text":"? Dans les périodes dans lesquelles beaucoup de matériau organique est disponible, a-t-on suffisamment de temps pour le transformer ?"},{"index":10,"size":11,"text":"? Quelle quantité de compost doit ou peut être produite ?"},{"index":11,"size":8,"text":"? A quoi va servir le compost ?"},{"index":12,"size":23,"text":"? Y a-t-il d'éventuels tabous ou d'autres facteurs culturels ou socioéconomiques qui rendent l'utilisation de certains matériaux organiques ou du compost difficile ?"},{"index":13,"size":28,"text":"Quand on a décidé de commencer le compostage, il faut bien prendre le temps de faire des essais. Prenez votre temps pour le premier tas, le \"tas d'essai\"."},{"index":14,"size":126,"text":"La première fois, vous n'aurez vraisemblablement pas un résultat optimal, mais c'est en le faisant et refaisant que chacun découvrira la méthode la plus appropriée dans votre situation spécifique. Ne vous attendez pas à ce que le compost fasse des miracles ! Farine de cacao 4,0 2,0 2,5 0,5 Noix de coco résidus de fibres 0,5 Pulpe de café 1,0 -0,8 0,8 Farines de graines de coton 7,0 3,0 2,0 0,5 Feuilles tombées 0,5 0,2 0,5 1,0 Herbes non mûres 1,0 1,2 Farine d'arachide 7,0 1,5 1,5 0,5 Tiges de mais 0,8 0,2 1,4 0,2 Tiges de mil / sorgho 0,7 0,1 1,4 0,4 Mélasse 0,7 -5,5 Oranges éliminées 0,2 0,1 0,2 Tiges de Pois d'Angola 0,7 Farines de graines de colza 5,5 2,5 1,5 1,0"},{"index":15,"size":99,"text":"Coques d'arachide 1,3 0,1 0,6 1,4 Fanes d'arachide 0,7 0,1 0,5 0,5 Balles de riz 0,5 -0,5 0,1 Son de riz 2,0 1,9 1,3 -Paille de riz 0,7 0,1 1,0 0,3 Sciure pourrie 0,2 Sciure fraîche 0,1 Suie 5,5 1,0 0,4 Farine de soja 7,0 1,5 2,5 0,5 Fanes de soja 1,4 0,1 1,0 0,9 Résidus de canne à sucre 0,3 Tiges de tabac 6,0 Jacinthe de l'eau séchée 2,2 0,3 3,9 2,0 Mauvaises herbes 0,5 0,2 0,7 0,5 Engrais vert (séché) Trèfle 2,4 0,2 0,9 2,0 Crotalaria juncea 2,0 0,2 1,0 0,8 Sesbania seban 2,1 0,2 1,1 0,8"},{"index":16,"size":9,"text":"Source de ce tableau : Rodale Guide of Composting."}]}],"figures":[{"text":"Figure 1 : Figure 1 : Retourner le compost (KIOF) "},{"text":"Figure 2 : Figure 2 : Quelques oeganismes du sol, certaines ne sont guère visibles à l'oeil nue "},{"text":"Figure 4 : Figure 4 : Couper le matériau organique en petits fragments "},{"text":"Figure 5 : Figure 5 : Exemple d'un tas de compost Indore "},{"text":"Figure 6 : Figure 6 : La méthode de blocs (HDRA) "},{"text":"Figure 7 : Figure 7 : Processus du compostage dans des fosses "},{"text":"Figure 8 : Figure 8 : Enclos de vannerie avec du compost et des plants plantés autour (HDRA) "},{"text":"Figure 9 : Figure 9 : Boma pourvu d'une litière pour le compostage (Source :Muller-Samann & Kotschi, 1994)  "},{"text":"5 En saison sèche, il faut humidifier le fumier. Pendant la saison pluvieuse, le fumier sera très humide. Si tel est le cas, il faut faire un tas moins haut (environ un mètre). Du fumier séché peut être empilé jusqu'à une hauteur d'environ un mètre et demi. "},{"text":"Figure 10 : Figure 10 : Un boma et un emplacement de compost (Source : KIOF et HDRA) "},{"text":"Figure3 Figure 11 : Jacinthe d'eau "},{"text":"Figure 12 : Figure 12 : Algue marine adulte Giant Kelp (Macrocystis). "},{"text":"Figure 13 : Figure 13 : Tas élevé de compost (HDRA) "},{"text":"Figure 14 : Figure 14 : Une barrique adaptée à fabriquer du compost. "},{"text":"Figure 15 : Figure 15 : Jardin potager "},{"text":"Figure 16 : Figure 16 : Un lit des semences fait du compost "},{"text":"Figure 19 : Figure 19 : Fabriquer du fumier liquide (KIOF) "},{"text":"Figure 20 : Figure 20 : Faire de l'extrait de compost (KIOF) "},{"text":"Figure 21 : Figure 21 : Contrôler le taux d'humidité "},{"text":" C'est ce qu'on appelle fermentation, et c'est le résultat de la décomposition des structures de fibres dures et complexes de la matière organique. C'est au centre du tas de compost que ce processus de fermentation (décomposition) est le plus important.  "},{"text":"Espace autour du tas de compost Il TransportLa distance entre le lieu de provenance de la matière organique, par exemple les lieux des récoltes, et le tas de compost doit être la plus courte possible. De même, la distance entre le tas et le champ où le compost sera utilisé ne doit pas être trop grande. De cette façon, on économise du temps et du travail pour le transport de la matière organique et du compost. L'idéal est de choisir un emplacement ombragé et à l'abri du vent, par Figure 3 : Un abri simple au-dessus de trois tas de compost (Mira exemple derrière un bâtiment, une rangée d'arbres. L'humidité du tas s'évaporera alors moins facilement, et le tas sera suffisamment ventilé. Louis) L'idéal est de choisir un emplacement ombragé et à l'abri du vent, par Figure 3 : Un abri simple au-dessus de trois tas de compost (Mira exemple derrière un bâtiment, une rangée d'arbres. L'humidité du tas s'évaporera alors moins facilement, et le tas sera suffisamment ventilé. Louis) Un emplacement à l'abri du vent a l'avantage supplémentaire d'éviter Un emplacement à l'abri du vent a l'avantage supplémentaire d'éviter que les matériaux du tas ne s'envolent, et de limiter les variations de que les matériaux du tas ne s'envolent, et de limiter les variations de températures dans le tas. En outre, il est pratique d'avoir de l'eau à températures dans le tas. En outre, il est pratique d'avoir de l'eau à proximité du tas de compost, pour pouvoir l'arroser s'il est trop sec. proximité du tas de compost, pour pouvoir l'arroser s'il est trop sec. Dans des conditions climatiques humides, il est important de protéger Dans des conditions climatiques humides, il est important de protéger le tas contre de trop grandes quantités d'eau. C'est faisable si l'on le tas contre de trop grandes quantités d'eau. C'est faisable si l'on choisit un emplacement bien drainé et abrité. Les emplacements les choisit un emplacement bien drainé et abrité. Les emplacements les mieux drainés sont souvent ceux qui se trouvent sur des hauteurs. Un mieux drainés sont souvent ceux qui se trouvent sur des hauteurs. Un tas de compost construit sous un arbre (par exemple un manguier ou doit y avoir suffisamment d'espace autour du tas pour pouvoir le un anacardier/faux acajou) est souvent bien protégé des pluies exces-retourner ou le contrôler au cours du compostage. Le plus pratique est sives. Ces deux types de conditions climatiques déterminent souvent d'avoir une surface 2 à 3 fois plus grande que celle du tas que l'on le choix d'un emplacement approprié pour la construction du tas de compost. veut construire. tas de compost construit sous un arbre (par exemple un manguier ou doit y avoir suffisamment d'espace autour du tas pour pouvoir le un anacardier/faux acajou) est souvent bien protégé des pluies exces-retourner ou le contrôler au cours du compostage. Le plus pratique est sives. Ces deux types de conditions climatiques déterminent souvent d'avoir une surface 2 à 3 fois plus grande que celle du tas que l'on le choix d'un emplacement approprié pour la construction du tas de compost. veut construire. Animaux nuisibles Un abri simple construit au-dessus de l'emplacement du tas de com-Un tas de compost doit toujours être construit dehors et pas trop près post, protège le tas contre le soleil et la pluie. La protection contre ces des habitations ou des étables. Il attire souvent des animaux nuisibles influences climatiques améliora le processus de compostage. Les va-tels que souris, rats, termites et autres insectes. Ceux-ci peuvent riations de températures et d'humidité seront moins importantes ainsi. transmettre des maladies aux hommes et aux animaux domestiques, et Animaux nuisibles Un abri simple construit au-dessus de l'emplacement du tas de com-Un tas de compost doit toujours être construit dehors et pas trop près post, protège le tas contre le soleil et la pluie. La protection contre ces des habitations ou des étables. Il attire souvent des animaux nuisibles influences climatiques améliora le processus de compostage. Les va-tels que souris, rats, termites et autres insectes. Ceux-ci peuvent riations de températures et d'humidité seront moins importantes ainsi. transmettre des maladies aux hommes et aux animaux domestiques, et attirer d'autres animaux dangereux (serpents). attirer d'autres animaux dangereux (serpents).  "},{"text":" Le compostage dans des rigoles est la même que le compostage dans des fosses à l'exception que les plantes se cultivent directement audessus de la fosse contrairement au fait d'enlever le compost de la fosse et de l'étaler sur le sol. Il faut d'abord creuser une rigole. Les dimensions dépendent de la quantité de matériel disponible et du nombre de plantes que vous allez planter dans la rigole. La largeur de la rigole peut varier entre 50 cm et quelques mètres. La profondeur est 1 m ou moins et la longueur peut varier. Il faut remplir le rigole comme suit :  "},{"text":" compostage d'ordures humaines et de vidanges constitue une manière utile de s'y débarrasser et présente une bonne source de substances nutritives pour les plantes. Cependant, différents problèmes se posent lorsqu'on procède au traitement d'ordures humaines ou des vidanges. Il y a la possibilité des maladies qui se répandent par le maniement des ordures et par la consommation des plantes ayant poussé sur le compost provenant d'ordures humaines.Quand on a à faire avec ce type d'ordure, il est primordial d'appliquer des méthodes appropriées et d'avoir acquis de l'expérience de ce processus de compostage. 7 Utilisations du compost 7 Utilisations du compost Le compost peut avoir beaucoup d'utilisations différentes. En voici Le compost peut avoir beaucoup d'utilisations différentes. En voici Les problèmes indiqués ne devraient pas empêcher l'utilisation dans quelques exemples : Les problèmes indiqués ne devraient pas empêcher l'utilisation dans quelques exemples : un tas de compost des ordures ou des vidanges d'origine humaine. Ce ? engrais ; un tas de compost des ordures ou des vidanges d'origine humaine. Ce ? engrais ; livret ne traite pas des détails du compostage d'ordures humaines. Si ? terreau, terre de pépinière, plantation d'arbres ; livret ne traite pas des détails du compostage d'ordures humaines. Si ? terreau, terre de pépinière, plantation d'arbres ; vous voulez faire des expérimentations, referez-vous aux livres qui ? prévention contre l'érosion ; vous voulez faire des expérimentations, referez-vous aux livres qui ? prévention contre l'érosion ; sont mentionnés dans la section 'Littérature recommandée'. ? aliment pour poissons ; sont mentionnés dans la section 'Littérature recommandée'. ? aliment pour poissons ; ? culture des champignons (Cet Agrodok ne traite pas de ce sujet). ? culture des champignons (Cet Agrodok ne traite pas de ce sujet). Vous pouvez aussi vous adresser au service Questions et Réponses Vous pouvez aussi vous adresser au service Questions et Réponses d'Agromisa ou à la HDRA Overseas Advisory Section. Les adresses d'Agromisa ou à la HDRA Overseas Advisory Section. Les adresses de ces instances sont données en la section 'Adresses Utiles'. de ces instances sont données en la section 'Adresses Utiles'.  "},{"text":" Il est avantageux d'utiliser du compost comme engrais parce qu'en améliorant la structure du sol, il améliore la fertilité du sol pendant longtemps. Le facteur clef de l'amélioration de la structure du sol est la matière organique. Elle contient de grandes quantités de microéléments qui sont essentiels à la croissance des plantes et elle améliore la capacité de rétention de l'eau du sol. Un autre aspect est que le compost ne libère ses substances nutritives aux plantes qu'un peu à la fois, si bien que son action dure beaucoup plus longtemps. Les engrais chimiques ne contiennent que quelques éléments nutritifs Les engrais chimiques ne contiennent que quelques éléments nutritifs (Azote, Phosphore et Potassium), mais la concentration de ces élé- (Azote, Phosphore et Potassium), mais la concentration de ces élé- ments est beaucoup plus importante que dans le compost. Les subs- ments est beaucoup plus importante que dans le compost. Les subs- tances nutritives contenues dans des engrais chimiques sont libérées tances nutritives contenues dans des engrais chimiques sont libérées rapidement. Cela implique que les engrais chimiques constituent une rapidement. Cela implique que les engrais chimiques constituent une provision rapide et unique d'éléments nutritifs pour répondre aux be- provision rapide et unique d'éléments nutritifs pour répondre aux be- soins d'une culture. soins d'une culture. Application du compost à l'endroit où il est requis Application du compost à l'endroit où il est requis Si l'on veut directement appliquer le compost comme engrais aux Si l'on veut directement appliquer le compost comme engrais aux cultures sur une grande superficie, il en faudra des quantités énormes. cultures sur une grande superficie, il en faudra des quantités énormes. C'est un inconvénient du compost. C'est un inconvénient du compost.  "},{"text":" Bokashi est un engrais organique, obtenu par la fermentation de matière organique. Le nom de Bokashi est issu du mot japonais qui signifie : matière organique fermentée. Bokashi contient une grande quantité d'éléments nutritifs et fonctionne comme engrais à effet rapide. Il est comparable à un engrais artificiel tel que NPK. Traditionnellement, les agriculteurs japonais utilisent du Bokashi afin d'améliorer la fertilité du sol et de fournir des substances nutritives aux cultures.Le Bokashi se fabrique en fermentant de la matière organique soit en plein air soit en situation fermée. En plein air, le mélange vient en contact avec l'oxygène contenu dans l'air ; c'est ce qu'on appelle une situation aérobique, qui est comparable au processus normal de compostage. Si le mélange qui est en pleine fermentation est hermétiquement fermé (par exemple en sacs de plastic) il est question d'une situation anaérobique. et encore plus haut probablement.Cela veut dire qu'au processus anaérobique, les substances nutritives sont même mieux conservées qu'au processus aérobique. Cependant, appliquant le processus anaérobique, il est difficile de préparer des grandes quantités de Bokashi. Ce dernier est plus facile appliquant le processus aérobique. Le son de riz constitue une bonne source d'azote. Il contient aussi des carbohydrates et du phosphore. Le son de riz est important du fait qu'il stimule le processus de fermentation et qu'il nourrit bien les micro-organismes. Au lieu de son de riz, vous pouvez utiliser d'autres types de son, comme le son de blé et le son de maïs ou des plantes à racines combustibles telles que le manioc, l'igname ou les pommes de terre. Il faut les couper en morceaux avant de les utiliser. L'utilisation de fruits tels que les bananes est une alternative. D'autres sources de C sont la paille, les mauvaises herbes et les sciures. Résidus de canne à sucre L'ajout de résidus de canne à sucre (la bagasse) au Bokashi permet une bonne aération et une bonne rétention de l'eau pendant le processus de fermentation. Des substances nutritives telles que l'azote sont mieux retenues aussi. De matériaux alternatifs sont : les balles de riz, les balles de café, les copeaux de bois, les épis de mais, l'herbe séchée. De vieux bokashi contient beaucoup de micro-organismes ; ces microorganismes mettent en marche le processus de fermentation. Le mélange artificiellement préparé de micro-organismes efficaces peut être procuré aux institutions dont les adresses sont données en la section 'Adresses Utiles'. Si vous préparez du Bokashi pour la première fois et s'il ne vous est pas facile de vous procurer le mélange ME, il convient d'utiliser de la terre propre et moite, de préférence de la forêt. Humidité La production de Bokashi ne demande qu'une petite quantité d'eau. Si le Bokashi est trop humide, il pue. Pour préparer le Bokashi suivant la recette donnée dans le paragraphe suivant, on a besoin de 20 litres. La quantité nécessaire dépend aussi du taux d'humidité des matériaux. de C : N). La qualité de Bokashi est améliorée par l'ajout au mélange 9 Bokashi en pleine fermentation de coquillages (farine de craie) et des minéraux de C : N). La qualité de Bokashi est améliorée par l'ajout au mélange 9 Bokashi en pleine fermentation de coquillages (farine de craie) et des minéraux argileux Bentonite. argileux Bentonite. Pour la matière organique servant à la fermentation de Bokashi, on a besoin d'ingrédients spéciaux et sélectionnés (son de riz, son de blé, farine de poisson, etc.), et des matériaux d'ordures organiques. Bokas-hi a été développé au Japon par le professeur Teruo Higa. Comparer le Bokashi au compost Dans le processus de fermentation de Bokashi, les substances nutriti-ves sont mieux conservées qu'au processus de décomposition qui a lieu durant le compostage. Ceci est dû au fait que pendant le processus de fermentation, les températures atteignent un niveau moins élevé qu'au processus normal de compostage. Au processus anaérobique de fermentation de Bokashi, les températu-res remontent à environ 40 ºC, tandis qu'au processus aérobique et au processus normal de compostage, les températures peuvent remonter à mat tropical et 2-3 semaines sous un climat plus tempéré. Le Bokashi peut être appliqué au sol directement après la préparation, bien qu'il vous faille attendre 14 jours avant de planter ou de semer. Des micro-organismes efficaces L'aspect important de la préparation de Bokashi est l'ajout des micro-organismes efficaces (ME). C'est un mélange artificiellement préparé de micro-organismes utiles. Après avoir été appliqués au sol, ces micro-organismes efficaces s'installent dans le sol et évinceront les micro-organismes nuisibles. Il améliore l'efficacité de la matière orga-nique dans le sol ainsi que la fertilité du sol. Les Micro-organismes efficaces peuvent être procurés chez les institu-tions où le Bokashi est développé et la recherche se fait à ce sujet. Les adresses sont donnés en la section 'Adresses Utiles'. Si vous n'êtes pas en mesure d'obtenir le mélange ME, il est égale-ment possible d'utiliser de la terre propre ; de préférence de la terre moite et fraîche de la forêt. Cette terre contient beaucoup de micro-organismes et très probablement elle n'est pas polluée par des produits chimiques. Bien que son efficacité soit moindre que le ME selectionné artificiellement, les résultats pourront être encore satisfaisants. 9.1 Les matériaux organiques N'importe quelle matière organique peut être utilisée pour la fabrica-tion de Bokashi. Il faut utiliser au moins 3 matériaux différents pour une combinaison de matériaux qui soit contiennent beaucoup d'azote Sources d'azote Le fumier de poules constitue une bonne source d'azote. D'autres ty-pes de fumier (de vaches, d'ânes, de pigeons, etc.) sont aussi utilisa-bles, bien que la quantité doive être multipliée par 1½. D'autres sources d'azote sont la farine de poisson, le poudre d'os ou des plantes légumineuses (fixant l'azote), par exemple les feuilles de Mucuna, de Crotalaria, de Leucaena, etc. Il faut d'abord sécher ces plantes et les découper en morceaux avant de les utiliser. Elles contiennent aussi d'importantes substances nutritives. Source de carbone Charbon de bois Le charbon de bois est un matériau poreux, qui accroît la capacité de rétention d'éléments nutritifs et améliore la structure du sol. Il agit aussi de lieu d'hébergement de micro-organismes. Si du charbon de bois n'est pas disponible, vous pouvez utiliser de la paille, du varech (des algues marines séchées) ou des gousses de haricots. Les balles de riz grillées constituent un matériau alternatif. Des micro-organismes efficaces La mélasse La mélasse est un produit secondaire de la production de canne à su-cre. Elle contient beaucoup d'énergie et elle stimule le processus de fermentation par l'alimentation des micro-organismes. Une autre mé-thode est d'utiliser du sucre ou du miel, mais évidemment ce sont des produits beaucoup plus chers. Le taux d'humidité devrait être de 30-40%. Vous pouvez contrôler ce-ci en pressant une poignée du mélange. L'eau ne devrait pas ruisseler environ 70 ºC La fabrication de Bokashi prend peu de temps : 6-8 jours sous un cli-accroître la diversité des micro-organismes. Il est important d'avoir du mélange pressé. Le mélange devrait constituer une masse unie sans Pour la matière organique servant à la fermentation de Bokashi, on a besoin d'ingrédients spéciaux et sélectionnés (son de riz, son de blé, farine de poisson, etc.), et des matériaux d'ordures organiques. Bokas-hi a été développé au Japon par le professeur Teruo Higa. Comparer le Bokashi au compost Dans le processus de fermentation de Bokashi, les substances nutriti-ves sont mieux conservées qu'au processus de décomposition qui a lieu durant le compostage. Ceci est dû au fait que pendant le processus de fermentation, les températures atteignent un niveau moins élevé qu'au processus normal de compostage. Au processus anaérobique de fermentation de Bokashi, les températu-res remontent à environ 40 ºC, tandis qu'au processus aérobique et au processus normal de compostage, les températures peuvent remonter à mat tropical et 2-3 semaines sous un climat plus tempéré. Le Bokashi peut être appliqué au sol directement après la préparation, bien qu'il vous faille attendre 14 jours avant de planter ou de semer. Des micro-organismes efficaces L'aspect important de la préparation de Bokashi est l'ajout des micro-organismes efficaces (ME). C'est un mélange artificiellement préparé de micro-organismes utiles. Après avoir été appliqués au sol, ces micro-organismes efficaces s'installent dans le sol et évinceront les micro-organismes nuisibles. Il améliore l'efficacité de la matière orga-nique dans le sol ainsi que la fertilité du sol. Les Micro-organismes efficaces peuvent être procurés chez les institu-tions où le Bokashi est développé et la recherche se fait à ce sujet. Les adresses sont donnés en la section 'Adresses Utiles'. Si vous n'êtes pas en mesure d'obtenir le mélange ME, il est égale-ment possible d'utiliser de la terre propre ; de préférence de la terre moite et fraîche de la forêt. Cette terre contient beaucoup de micro-organismes et très probablement elle n'est pas polluée par des produits chimiques. Bien que son efficacité soit moindre que le ME selectionné artificiellement, les résultats pourront être encore satisfaisants. 9.1 Les matériaux organiques N'importe quelle matière organique peut être utilisée pour la fabrica-tion de Bokashi. Il faut utiliser au moins 3 matériaux différents pour une combinaison de matériaux qui soit contiennent beaucoup d'azote Sources d'azote Le fumier de poules constitue une bonne source d'azote. D'autres ty-pes de fumier (de vaches, d'ânes, de pigeons, etc.) sont aussi utilisa-bles, bien que la quantité doive être multipliée par 1½. D'autres sources d'azote sont la farine de poisson, le poudre d'os ou des plantes légumineuses (fixant l'azote), par exemple les feuilles de Mucuna, de Crotalaria, de Leucaena, etc. Il faut d'abord sécher ces plantes et les découper en morceaux avant de les utiliser. Elles contiennent aussi d'importantes substances nutritives. Source de carbone Charbon de bois Le charbon de bois est un matériau poreux, qui accroît la capacité de rétention d'éléments nutritifs et améliore la structure du sol. Il agit aussi de lieu d'hébergement de micro-organismes. Si du charbon de bois n'est pas disponible, vous pouvez utiliser de la paille, du varech (des algues marines séchées) ou des gousses de haricots. Les balles de riz grillées constituent un matériau alternatif. Des micro-organismes efficaces La mélasse La mélasse est un produit secondaire de la production de canne à su-cre. Elle contient beaucoup d'énergie et elle stimule le processus de fermentation par l'alimentation des micro-organismes. Une autre mé-thode est d'utiliser du sucre ou du miel, mais évidemment ce sont des produits beaucoup plus chers. Le taux d'humidité devrait être de 30-40%. Vous pouvez contrôler ce-ci en pressant une poignée du mélange. L'eau ne devrait pas ruisseler environ 70 ºC La fabrication de Bokashi prend peu de temps : 6-8 jours sous un cli-accroître la diversité des micro-organismes. Il est important d'avoir du mélange pressé. Le mélange devrait constituer une masse unie sans (un faible rapport C :N) soit beaucoup de carbone (rapport important (un faible rapport C :N) soit beaucoup de carbone (rapport important  "}],"sieverID":"7ef0cd2a-4c43-4e9f-93e4-a50d88f026ce","abstract":"Tous droits réservés. Aucune reproduction de cet ouvrage, même partielle, quel que soit le procédé, impression, photocopie, microfilm ou autre, n'est autorisée sans la permission écrite de l'éditeur."}

data/part_3/039fae8f753375fac4c36b6224566213.json

@@ -0,0 +1 @@
+{"metadata":{"id":"039fae8f753375fac4c36b6224566213","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ac2137b8-9478-418e-a6a0-5e4c5aff9338/retrieve"},"pageCount":9,"title":"Mineral analysis reveals extreme manganese concentrations in wild harvested and commercially available edible termites","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":93,"text":"Insects are consumed as food in many countries around the world. Much of this consumption derives from cultural traditions of entomophagy, particularly in Africa, south-east Asia, and central America 1,2 . Marketing and export of edible insects can also provide an important source of revenue (e.g. 3 ) and the use of insects as food is expanding into countries beyond those where use is traditional. As a result, edible insects now attract global attention in research, media and commercial sectors; particularly with respect to their contribution to food security and sustainability 4,5 ."},{"index":2,"size":120,"text":"The expanding market of edible insects creates challenges in terms of regulation and quality control 6 . Novel edible insects are reaching new markets, bringing unique obstacles for value chain regulation; for example accurate identification of species. Specific factors, such as wild harvesting and rural processing bring additional difficulties when trying to establish and maintain the quality of insect foods 6,7 ; for example, the accumulation of heavy metals 8,9 . However, the extent and source of variations in mineral content within and between species remains largely unknown. This knowledge gap is important, as nutritional information underpins food safety standards and is vital for decision making when novel foods are entering markets, for example in the European Union 10 ."},{"index":3,"size":214,"text":"Termites, in particular winged termites (henceforth referred to as 'alates'), are widely consumed in quantity as food across Africa, America and Asia 1,11,12 when they emerge en masse during the rainy season. Worldwide it is reported that 43 species are used as either human or livestock feed, with some species, particularly those from the genus Macrotermes, most commonly used as human food 12 . A number of studies on alates as food have highlighted their nutritional value and potential contribution to food security, both in raw and processed form [13][14][15] , due to the high protein and fat content of these insects 16,17 . Alates are also available in local and international markets, which provides local income and contributes to economic development [16][17][18] . In contrast to many farmed insects, alates are wild harvested, which could result in greater differences between collections due to variation in diets, the species collected, and the local conditions. In some insects, including edible species, accumulation of minerals to toxic levels has been associated with environmental contamination 8,9,19 . In addition, there is a startling variation in trace minerals concentrations reported in studies examining alates (Table 1). Establishing consistent estimates of mineral concentrations in alates is critical when assessing their potential benefit and informing their potential marketability 20,21 ."},{"index":4,"size":41,"text":"We examine the content of five trace minerals (Fe-Mn-Zn-Cu-Mg) in a selection of alates from Benin and South Africa, where termites are commonly consumed as human food. We compare these concentrations of trace minerals to commercially available insects, including alate termites."}]},{"head":"Methods insect material used for analysis. Field collection of edible termites. Alates of Macrotermes subhyalinus","index":2,"paragraphs":[{"index":1,"size":258,"text":"were collected from north-west Benin, where Macrotermes termites are consumed as food 22 . Termites were identified to species using classical taxonomy of termite soldiers collected from mounds in the area. Fungus comb, mound soil, and termite soldiers were also collected using a hoe from a subset of the mounds visited in the area around Tanguieta. The samples were collected by hand around lights at dusk into a basin of clean water, between May and August 2017 and 2018. The locations were within a 10 km radius of Tanguieta, Atakora department, Benin (Fig. 1Ai; Table S1). Samples therefore constitute a combination of alate termites from multiple mounds in a given area. We also collected samples of the large tobacco cricket (Brachytrupes membranaceus) from the same region in north-west Benin, by digging them out from their burrows using a hoe, to provide a second local edible insect species. Two further samples of alates were also collected from additional sites at Parakou (Borgou department, Benin), and from near Acornhoek (Mpumalanga, South Africa; Fig. 1A). In both these sampling locations termites are by communities. All samples were rinsed with clean bottled water after collection to remove any mud or dust. Termites were then briefly sun-dried to remove external moisture and to assist with wing removal, a treatment that is traditional in Benin. Following wing removal then stored in food-grade storage containers at −20 °C or below until mineral analysis. For samples collected from South Africa, de-winged termites were oven dried at 60° overnight to allow for further transport at room temperature."},{"index":2,"size":110,"text":"Commercial insect types used. A selection of dried, processed edible insects were purchased from a supplier in the UK to provide a product comparison for the wild harvested termites (Table S1). The commercial insects included both farmed insects and wild-harvested insects (including one sample of alate termites), multiple insect orders, and many widely consumed insect species. In particular, analysing commercially available alate termite and leaf-cutter ant queens provided a suitable reference comparison for our termites, and more widely to insects that use fungus farming for food. Single packets of each insect type were purchased and tested. To confirm the identity of the species being examined insects were barcoded 23 ."},{"index":3,"size":82,"text":"extraction and measurement of trace minerals. Sample transport and analysis. All mineral analysis was conducted at Chalmers University of Technology, Gothenburg unless stated otherwise. All termite samples from Benin were stored and transported fresh at −20 °C. Samples collected from Acornhuek in South Africa were dried and transported at room temperature. All commercial insects are delivered pre-dried and were then frozen and transported at −80 °C to Sweden from the UK. Upon arrival in Sweden all samples were stored at −80 °C."},{"index":4,"size":88,"text":"Moisture and total ash content for termite samples. Four replicates of fresh termites from north-west Benin were measured for total moisture and total ash content. To this end, 50 g of termites (de-winged) were freeze dried for a period of 72 hours. This was not possible to do with the South Africa termite samples or the commercial insect samples as they arrived pre-dried. Total ash content was then determined according to AOAC Official Method 942.05.  20,21 . *values represent adequate intake (AI). **refers to magnesium in supplement form."},{"index":5,"size":125,"text":"Extraction of minerals from insect material. The fresh termite samples collected from Benin were freeze-dried before mineral extraction. After drying, for all insects between 25 and 100 individuals were homogenised in a food grinder in order to obtain 2 g of ground insect material. In total, 150-300 mg of sample was then used for mineral extraction. Microwave assisted acid digestion was performed in reinforced Teflon tubes using 3 ml milliQ H 2 0, 750 µl nitric acid and 150 µl HCl (Fisher Chemical, Sweden). Samples were ramped to 180 °C, held at 180 °C for 30 minutes, and left to cool to room temperature. Following extraction all mineral samples were made up to 10 ml with milliQ water and stored for further dilution and quantification."},{"index":6,"size":219,"text":"Quantification of trace minerals. Minerals (Fe-Mn-Zn-Cu-Mg) were quantified using atomic absorption spectroscopy on an Agilent Technologies 200 Series AA 240FS AA with an UltrAA Boosted Lamp Supply with Agilent hollow cathode lamps. An average was calculated from triplicate repeat measures of absorption area (2.5 second time period, 6 second pre-read delay). Lamp position was optimised manually prior to each run. Dilutions of standards were prepared and used to calibrate biological samples, as advised for the Agilent AAS 200 series per operating protocol. The discovery of unexpectedly high manganese (Mn) content in termites led to two further analyses of Mn concentrations in alates from north-west Benin. Mn was examined using two additional independent methods. Mn was examined using ion chromatography 24 and also independently validated by the National Food Agency in Sweden using ICP-MS, who additionally assayed lead, aluminium, molybdenum and cadmium concentrations. Six termite samples were analyzed for Mn along with Al, Fe, Cu, Zn, Mo, Cd and Pb by an accredited ICP-MS method at the National Food Agency in Uppsala Sweden. Samples were microwave extracted using nitric acid and hydrochloric acid at 200 °C. The method used was based on NMKL method nr 186 and EN 15763:2009. Due to high concentrations of Mn in the samples, dilutions were necessary and therefore several metals were not quantified by accreditation."},{"index":7,"size":39,"text":"To test for potential sources of the high Mn concentrations in alates, Mn content in soil samples from Macrotermes mounds and fungus comb samples from within mounds were also examined using the atomic absorption spectroscopy (three biological replicates respectively)."}]},{"head":"Distribution of trace minerals in termites.","index":3,"paragraphs":[{"index":1,"size":146,"text":"Termite samples were mounted on carbon stubs for examination in a HITACHI TM-1000 Scanning Electron Microscopy with an energy-dispersive X-ray spectroscopy (EDX) detector (Oxford Instruments). EDX detector specifically detect major elements (above the atomic number of Na) placed in a specific area of the SEM picture. The distribution of the Mn in the integument was assessed by examination of the whole termite. The termites were further dissected to evaluate the distribution of the minerals in the interior of the thorax and abdomen. Statistics. The concentrations of Mn were compared: alates against soldiers, abdomens vs cephalothoraxes, and mound soil versus fungus comb using t-tests after log transformation of data. Calculations were performed in R 25 . All values for commercial insects are reported in mg/100gDM (dry matter) as commercial insects were delivered pre-dried.. We also report our values for alates from north-west Benin in mg/100gfw (fresh weight)."}]},{"head":"Results","index":4,"paragraphs":[{"index":1,"size":137,"text":"Mineral contents found in wild-harvested and commercial insects. Alates collected from Benin contained 52.5% ± 1.2 SE water of which 3.65% ± 0.27 SE was ash. There was considerable variation between different insects for all minerals examined (Table 2). The most striking result was the high Mn content found in alates. Alates from Benin, South Africa, and commercial alates purchased online all had extremely high concentrations of Mn (271-515 mg Mn/100gdw). These concentrations are around 100 fold more than we found in other commercial insects, (range: 0.5-3.9 mg Mn/100gdw). Both the secondary ion-chromatography testing for Mn concentrations (388 mg Mn/100gdw) and the independent ICP-MS evaluation (489 mg Mn/100gdw) confirmed the high Mn content in north-west Benin alates (Table S2). Other heavy metal values (Mb-Cd-Pb) were either at very low levels or below the detectable range (Table S2)."},{"index":2,"size":95,"text":"Particularly high concentrations of magnesium were found in two commercial insects, mealworms and silkworm pupae (244.6 and 305.5 mg Mg/100gdw respectively), which is approximately 3-5 times the concentrations measured in the other insects. Also of note were the relatively high concentrations of iron found in the water scorpions, the large tobacco cricket, and mopane worms (33.4, 65.7 and 54.5 mg Fe/100gdw respectively), approximately 2-3 times the concentrations measured in the other insects. The locust, house cricket and large tobacco cricket showed the highest quantities of zinc, and termites and water scorpions the lowest (Table 2)."}]},{"head":"potential sources of manganese levels in termites.","index":5,"paragraphs":[{"index":1,"size":140,"text":"To explore the origin of the high Mn in termites, we first compared soldier and alate castes of M. subhylanus from north-west Benin. Termite soldiers contained significantly lower Mn concentrations (14.6 mg Mn/100gdw) than were detected in the alates (422.2 mg Mn/100gdw) (t = 30.3 df = 4.4 P < 0.01; Table 3). Soldier termites did however, still show slightly higher Mn concentrations than other commercial insects. To establish if the Mn was anatomically localised and could be reduced by processing (for example beheading of alates prior to consumption) we examined whether heads and bodies of M. subhylanus differed in Mn content. Termite heads had significantly lower Mn concentrations than the abdomen material (t = 27.2 df = 3.3 p < 0.01; Table 3), with about 200 times the concentration of Mn found in the abdomen compared to the head."},{"index":2,"size":158,"text":"Further comparison of Macrotermes mound soil samples with fungus comb samples also showed large differences in levels of Mn. Fungus combs were found to have significantly higher Mn concentrations than mound soil (t = 26.9, df = 2.5, P < 0.01; Table 3), with 342 mg Mn/100gdw and 0.04 mg Mn/100gdw respectively. To follow up to the detection of high Mn found localised to the abdomens of M. subhylinus we performed scanning electron microscopy (SEM) imaging. The SEM-EDX area analysis on the external cuticle of an alate shows moderate Mn in the mandibles (Fig. 2A; Table 4) and abdominal cuticle (Fig. 2B; Table 4), with more enrichment of Mn in the spiracle (Fig. 2C; Table 4; Table S3). Hotspots of Mn within the termite abdomen were observed (Fig. 2D; Table 4). Spherical structures with heterogeneous diameters (ranging from 0.5 to 2 µm) are placed together in a specific area of around 15 × 18 µm in the abdomen."}]},{"head":"Discussion","index":6,"paragraphs":[{"index":1,"size":47,"text":"Wild foraged termites, which represent a commonly used food resource in sub-Saharan Africa, were analysed for mineral content. These data were compared to other commercially bought insect material sold for human consumption. Our results highlight the need for systematic nutrient analysis of insects aimed for human consumption."},{"index":2,"size":221,"text":"High manganese specific to termites. Our most striking result is the unexpectedly high Mn content we found in all alate termites from all locations sampled, whether field collected or commercially-bought in the UK.  Quantities of Mn were more than 100-fold greater than in other commercial insects. These high concentrations of Mn are in contrast to a number of studies examining other Macrotermes termites 14,26 , but are consistent with two previous studies from Zimbabwe and Zambia 18,27 . Such unexpected and large variation in Mn between studies could be either methodological or biological and should be the focus of a concerted review of Mn across termite species. Nonetheless, repeated findings of high concentrations of Mn suggest that certain alate termites could have a general propensity to contain high Mn. Considering alates are widely consumed 11 , and sometimes in large quantities, these data could have important implications for food safety and nutrition. We are confident the high Mn detected in these species is biologically derived and not contamination from sampling methods or materials used. First, water used during collection was bottled drinking water and so very unlikely to be a contaminant, and second, the results from the electron microscopy imaging and the specificity of the Mn to M. subhyalinus abdomens are both consistent with the Mn being stored within biological tissue."},{"index":3,"size":172,"text":"Mn is a required mineral element in small quantities, but can be toxic at high levels causing the neurological condition known as manganism 28 . Animal studies indicate high levels may also be teratogenic 29 . The levels of Mn we report would mean that 100 g of dry termites could provide ~40 times the recommended upper limit (RUL) for adults (18; Table 1). The safe limit for young children (24; Table 1), who commonly consume termites, is much lower: for a 5-13 year old more than 2-5gfw termites per day (15-43 termites) will exceed the RUL 21 . A further consideration relates to the potential for competition between iron and Mn for absorption 30 . This may compound problems associated with high Mn concentrations, in particular for women and children in lower income areas where anaemia is a problem and iron deficiency is widespread. The boom-bust pattern of consumption that occurs when alates emerge en masse could also enhance potential effects; with large emergences being consumed immediately, thus creating acute exposures."},{"index":4,"size":211,"text":"While the majority of reports of Mn toxicity are of people working in smelters exposed to large amounts of Mn, environmental sources such as contaminated water are also implicated 31,32 . Nonetheless, Mn poisoning has never been reported from normal dietary intake. However, we know of no study examining alates as food that looks at any effects of high Mn. In light of the concentrations of Mn that our study and other reports 18,27 , more focussed research is critical to understand why and how such high Mn concentrations are reached in alates and why different studies have reported such variable results. It also remains unclear to what extent this Mn is bioavailable when consumed by humans and in what quantity and form it is stored within the termites. Cell culture absorption assays or animal absorption assays for trace metals provide a potential route to explore this 33 . Such methods have been used to examine the bioavailability of dietary minerals in other insects and found high bioavailability when compared with other animal sources 34 . A further point of interest would be to investigate if different trace minerals from insects compete with each other during absorption, for example does the presence of high Mn impede the absorption of dietary iron."},{"index":5,"size":138,"text":"These results may also have implications beyond just the human food chain. A recent review of Mn in insects found that high levels can have negative effects in bees and flies 35 . Our results are consistent with alate termites accumulating and storing manganese in their abdomens. However, any suggestions with respect to the underlying biology of this accumulation and if it has benefits or costs to alate termites is speculative. Alate termites also form a seasonal part of the diet for a range of animals; including insects, reptiles, amphibians, birds, and mammals. Some of these groups, for example mammals, are known to be sensitive to Mn accumulation 35 . It follows that the consumption and absorption of termites that are very rich in Mn could have downstream implications for community food webs and is worth further investigation."},{"index":6,"size":116,"text":"We found high Mn levels in two termite genera that are regularly consumed (Macrotermes and Odontotermes). It is likely not a coincidence that both of these genera are fungus-growers and Mn concentrations were very high in the fungus comb. If fungus growing is found to be the single determinant of Mn concentrations, it remains possible that levels are lower in non-fungus growing species. A concerted effort to examine a taxonomically diverse range of edible termites (of various castes), with consistent and repeatable results, could provide a robust estimate of mineral concentrations across termites. This scale of evaluation has been repeatedly called for in reviews of insects as food, but has yet to be realised 7,18,36 ."}]},{"head":"Sources of manganese and potential roles in alates.","index":7,"paragraphs":[{"index":1,"size":367,"text":"To further understand the high Mn concentrations in alates, we compared alates to soldiers (distinct termite castes). Soldiers and alates can both be used as food, although alates are available in larger abundances during their emergences. Previously reported enrichment of manganese in the mandibles of soldiers 37 is one explanation for high manganese in these species. However, we found no support for the mandible-specific enrichment hypothesis: the comparison between soldiers and alates showed manganese concentrations are higher in alates and comparison between the termite cephalothorax and abdomen showed Mn enrichment was specific to the abdomen. The finding of specific Mn enriched structures within the abdomen (Fig. 2D) point instead to a biological role of manganese rich tissue. As the alate abdomen constitutes a large proportion of the total insect, removal of the abdomen would result in the majority of beneficial nutrients being lost. Thus, simple processing (e.g head removal) that is carried out in many insects 38 is also not appropriate for reducing manganese concentrations in these alates. Macrotermitinae termites, which include Macrotermes, farm fungus to breakdown plant material into digestible food. A comparison of the fungus comb and mound soil revealed remarkably high Mn concentrations in the fungus comb but not the soil. This result is consistent with an already established biological role for Mn in lignin digestion; Manganese peroxidase is one enzyme produced by basidiomycetes fungi to break down lignin 39 . In addition, Alates from some Macrotermes species transport fungus when founding new colonies 40,41 . Further examination of the composition of the Mn rich nodules in the alates abdomens will help explore this hypothesis. Alternately, alates may have high concentrations on Mn if it is necessary for the production of worker and soldier castes during colony formation. This may explain the high concentrations found in the commercially available alate termites labelled as Nasutitermes, which do not farm fungus. consumption and marketing of termites. Insects can have a high economic value and could provide a means of mitigating against food insecurity 42 . However, the observed high levels of Mn could present a significant challenge to future development of termite alates if this phenomenon is widespread, particularly as a commercial product (for example 16)."},{"index":2,"size":76,"text":"From a European perspective, the approval for insects as food should be straightforward given that legislation stipulates that toxicological levels of food are expressed in terms of an absolute and binary Acceptable Daily Intake (ADI) level: if this is exceeded, then the food is not considered fit for human consumption 43 . Given this framing, currently we suggest there is little potential for the development of an export market for termite alates in an unprocessed form."},{"index":3,"size":105,"text":"From the perspective of local consumers in Benin, the ethical calculation is more complex 44 . Many consumers in Benin live in higher risk environments where simplistic choices about what is a 'good' or 'bad' food is less realistic 45,46 . Whether to exploit an available food source for immediate nourishment or not if it may increase the risk of future illness is therefore not a simple choice. Nonetheless, we urge that the findings of this study should be brought to the attention of current consumers of termite alates. We hope that this paper highlights potential concerns and identifies future avenues for research and development."},{"index":4,"size":125,"text":"In the insects sourced commercially in the UK, high manganese concentrations were observed only in the termites (Odontotermes spp. but labelled as Nasutitermes spp.). Given the small quantity these insects are sold in (10 g per packet) it is unlikely to be a serious risk if single packets are consumed. Nonetheless, this finding highlights the principal that every species (and form) of insect should be examined thoroughly for nutritional quality and safety before market. There is also considerable variation between the remaining six commercially purchased edible insects in all other minerals examined. Thus, whilst insects can be a source of important micronutrients, targeted analysis of each species will reveal which insects are rich in particular micronutrients. This information is essential for food safety and marketing."},{"index":5,"size":135,"text":"conclusions. Alate termites from multiple locations and multiple genera contained high concentrations of Mn. Even small quantities of termites would far exceed the current upper recommended intakes for both adults and children. Results suggest this is biologically derived accumulation, rather than a result of environmental contamination. These are pertinent results considering how widely alates are consumed. We recommend further research to determine the mechanisms for this accumulation and to establish how widespread high Mn concentrations are across termite species and feeding groups. Information about the bioavailability of Mn from edible termites, and how Mn could interact with other dietary minerals during digestion is also lacking and should be a research priority. More generally, our findings highlight the importance of treating insect species on an individual basis when considering using or marketing them as human food."}]}],"figures":[{"text":"Figure 1 . Figure 1. (A) (i) The locations of broader geographic sampling (ii) The sampling sites of Macrotermes spp. Alates within Benin and (iii) The zone in which more intensive sampling of Macrotermes spp. alates was carried out. (B) An image of alate termites just after collection prior to de-winging. (C) An image of a de-winged Macrotermes subhyalinus alates. "},{"text":"42 Table 3 . The quantities of manganese found in different termite castes (soldiers and alates), different parts of alate anatomy (cephalothorax or abdomens only), and two components of the termite mound (external soil and comb from the fungus gallery). Values are expressed as mg Mn/100gdw ± SEM. Macrotermes subhyalinus specimens from Benin. "},{"text":"Figure 2 . Figure 2. Scanning Electronic Microscopy images used to evaluate the distribution of Manganese in different parts of termite alates: (A) mandibles, (B) cuticle, (C) spiracle and (D) interior of the abdomen. "},{"text":"Table 1 . Example of highest and lowest reports of mineral contents for termites of the genus Macrotermes. Level reported Fe Zn Cu Mn Mg Level reportedFeZnCuMnMg Lowest 0.14 (26) 0.21 (26) 0.03 (26) 0.08 (13) 0.15 (14) Lowest0.14 (26)0.21 (26)0.03 (26)0.08 (13)0.15 (14) Highest 116 (14) 15 (18) 5 (18) 714 (18) 81 (18) Highest116 (14)15 (18)5 (18)714 (18)81 (18) RDA (Child 4-8) 10 5 0.44 * 1.5 * 130 RDA (Child 4-8) 1050.44 *1.5 *130 RDA (Adult female) 18 8 0.9 * 1.8 * 320 RDA (Adult female)1880.9 *1.8 *320 RUL (Child 4-8) 40 12 3 3 110** RUL (Child 4-8)401233110** RUL (Adult female) 45 40 10 11 350** RUL (Adult female)45401011350** Values are reported as mg/100g fresh weight. Numbers in parentheses indicate the studies referenced. Dietary Values are reported as mg/100g fresh weight. Numbers in parentheses indicate the studies referenced. Dietary advice values are presented as recommended daily allowance (RDA), and the recommended Upper Limit (RUL) advice values are presented as recommended daily allowance (RDA), and the recommended Upper Limit (RUL) in mg/day      in mg/day  "},{"text":"Table 2 . The quantities of five minerals found in different insect species. All values are expressed as mg/100gdw material and the variation is the SEM. Insect type Location Fe Zn Cu Mn Mg Insect typeLocationFeZnCuMnMg Alate termites  13.4 ± 0.4 10.3 ± 0.4 8.5 ± 0.5 422 ± 27 104.8 ± 6.7 Alate termites13.4 ± 0.410.3 ± 0.48.5 ± 0.5422 ± 27104.8 ± 6.7 (Macrotermes subhyalinus) Tanguieta, Benin 6.2 ɵ 4.9 ɵ 4.0 ɵ 200.5 ɵ 39.8 ɵ (Macrotermes subhyalinus)Tanguieta, Benin6.2 ɵ4.9 ɵ4.0 ɵ200.5 ɵ39.8 ɵ Alate termites (Macrotermes spp.) Parakou Benin 10.3 ± 0.3 ʈ 13.8 ± 0.3 ʈ 8.2 ± 0.3 ʈ 292.7 ± 21.4 ʈ Not measured Alate termites (Macrotermes spp.)Parakou Benin10.3 ± 0.3 ʈ13.8 ± 0.3 ʈ8.2 ± 0.3 ʈ292.7 ± 21.4 ʈNot measured Alate Termites (Odontotermes spp.) South Africa 8.8 ± 0.2 ʈ 9.2 ± 0.4 ʈ 6.6 ± 0.4 ʈ 515 ± 74 ʈ Not measured Alate Termites (Odontotermes spp.)South Africa8.8 ± 0.2 ʈ9.2 ± 0.4 ʈ6.6 ± 0.4 ʈ515 ± 74 ʈNot measured Alate Termites (Macrotermes spp.) South Africa 9.8 ± 0.5 ʈ 12.0 ± 0.4 ʈ 5.1 ± 0.6 ʈ 481 ± 112 ʈ Not measured Alate Termites (Macrotermes spp.)South Africa9.8 ± 0.5 ʈ12.0 ± 0.4 ʈ5.1 ± 0.6 ʈ481 ± 112 ʈNot measured Alate termite (Odontotermes spp.) * South-East Asia 13.9 ± 0.5 ʈ 12.9 ± 0.3 ʈ 7.6 ± 0.3 ʈ 271.4 ± 29.8 ʈ 95.0 ± 1.3 ʈ Alate termite (Odontotermes spp.) *South-East Asia13.9 ± 0.5 ʈ12.9 ± 0.3 ʈ7.6 ± 0.3 ʈ271.4 ± 29.8 ʈ95.0 ± 1.3 ʈ Tobacco Cricket (Brachytrupes Tanguieta, Benin 65.7 ± 3.1 ʈ 16.6 ± 0.6 ʈ 1.0 ± 0.1 ʈ 2.8 ± 0.2 ʈ Not measured Tobacco Cricket (BrachytrupesTanguieta, Benin65.7 ± 3.1 ʈ16.6 ± 0.6 ʈ1.0 ± 0.1 ʈ2.8 ± 0.2 ʈNot measured membranaceus)       membranaceus) Locust (Locusta migratoria) a UK bought pre-dried 9.2 ± 0.5 ʈ 25.0 ± 0.2 ʈ 6.0 ± 0.2 ʈ 1.0 ± 0.1 ʈ 85.0 ± 1.2 ʈ Locust (Locusta migratoria) aUK bought pre-dried 9.2 ± 0.5 ʈ25.0 ± 0.2 ʈ6.0 ± 0.2 ʈ1.0 ± 0.1 ʈ85.0 ± 1.2 ʈ House cricket (Acheta domesticus) a UK bought pre-dried 9.2 ± 0.6 ʈ 26.6 ± 0.8 ʈ 5.3 ± 0.1 ʈ 3.8 ± 0.3 ʈ 68.1 ± 0.4 ʈ House cricket (Acheta domesticus) aUK bought pre-dried 9.2 ± 0.6 ʈ26.6 ± 0.8 ʈ5.3 ± 0.1 ʈ3.8 ± 0.3 ʈ68.1 ± 0.4 ʈ Water scorpion (Lethoserus indicus) a UK bought pre-dried 33.4 ± 0.1 ʈ 11.5 ± 0.1 ʈ 2.3 ± 0.1 ʈ 1.2 ± 0.1 ʈ 111.3 ± 2.8 ʈ Water scorpion (Lethoserus indicus) aUK bought pre-dried 33.4 ± 0.1 ʈ11.5 ± 0.1 ʈ2.3 ± 0.1 ʈ1.2 ± 0.1 ʈ111.3 ± 2.8 ʈ Queen leafcutter Ant (Atta spp.) a UK bought pre-dried 11.0 ± 0.3 ʈ 19.0 ± 0.8 ʈ 2.8 ± 0.1 ʈ 2.1 ± 0.5 ʈ 64.6 ± 2.6 ʈ Queen leafcutter Ant (Atta spp.) aUK bought pre-dried 11.0 ± 0.3 ʈ19.0 ± 0.8 ʈ2.8 ± 0.1 ʈ2.1 ± 0.5 ʈ64.6 ± 2.6 ʈ Mopane worm (Gonimbrasi belina) UK bought pre-dried 54.5 ± 3.6 ʈ 16.6 ± 0.6 ʈ 6.4 ± 0.2 ʈ 3.9 ± 0.2 ʈ Not measured Mopane worm (Gonimbrasi belina)UK bought pre-dried 54.5 ± 3.6 ʈ16.6 ± 0.6 ʈ6.4 ± 0.2 ʈ3.9 ± 0.2 ʈNot measured Silkworm pupae (Bombyx mori) a UK bought pre-dried 3.8 ± 0.1 ʈ 17.7 ± 0.2 ʈ 2.2 ± 0.1 ʈ 1.9 ± 0.1 ʈ 305.5 ± 3.1 ʈ Silkworm pupae (Bombyx mori) aUK bought pre-dried 3.8 ± 0.1 ʈ17.7 ± 0.2 ʈ2.2 ± 0.1 ʈ1.9 ± 0.1 ʈ305.5 ± 3.1 ʈ Mealworm (Tenebrio molitor) a UK bought pre-dried 6.0 ± 0.2 ʈ 14.4 ± 0.2 ʈ 2.5 ± 0.1 ʈ 0.5 ± 0.1 ʈ 244.6 ± 2.9 ʈ Mealworm (Tenebrio molitor) aUK bought pre-dried 6.0 ± 0.2 ʈ14.4 ± 0.2 ʈ2.5 ± 0.1 ʈ0.5 ± 0.1 ʈ244.6 ± 2.9 ʈ  "},{"text":"Table 4 . Composition in wt% of the total elemental content for five mineral (Mg, Mn, Fe, Zn and Cu) for mandibles, abdominal cuticle, spiracle and interior abdomen of Macrotermes subhyalinus specimen from Benin.   abdominal  interior abdominalinterior  mandibles cuticle spiracle abdomen mandiblescuticlespiracleabdomen Mg (%) n.d 0.7 1 0.7 Mg (%)n.d0.710.7 Mn (%) 1.4 4.3 12 9.2 Mn (%)1.44.3129.2 Fe (%) 6.5 n.d 1.6 2.8 Fe (%)6.5n.d1.62.8 Zn (%) 2.5 2.5 n.d n.d Zn (%)2.52.5n.dn.d Cu (%) n.d n.d n.d n.d Cu (%)n.dn.dn.dn.d  "}],"sieverID":"4675ab77-ad85-4c09-b246-ced5a428d9f2","abstract":"termites are widely used as a food resource, particularly in Africa and Asia. Markets for insects as food are also expanding worldwide. to inform the development of insect-based foods, we analysed selected minerals (fe-Mn-Zn-cu-Mg) in wild-harvested and commercially available termites. Mineral values were compared to selected commercially available insects. Alate termites, of the genera Macrotermes and Odontotermes, showed remarkably high manganese (Mn) content (292-515 mg/100 gdw), roughly 50-100 times the concentrations detected in other insects. Other mineral elements occur at moderate concentrations in all insects examined. on further examination, the Mn is located primarily in the abdomens of the Macrotermes subhyalinus; with scanning electron microscopy revealing small spherical structures highly enriched for Mn. We identify the fungus comb, of Macrotermes subhyanus, as a potential biological source of the high Mn concentrations. consuming even small quantities of termite alates could exceed current upper recommended intakes for Mn in both adults and children. Given the widespread use of termites as food, a better understanding the sources, distribution and bio-availability of these high Mn concentrations in termite alates is needed."}

data/part_3/04a3b24babbc4f31521ce58c21eea596.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04a3b24babbc4f31521ce58c21eea596","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/adec706b-064d-42e1-a903-e5b6445bd3eb/retrieve"},"pageCount":16,"title":"Dairy systems for smallholders in poor countries: Options for improving livelihoods","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":18,"text":"Animal source foods: 5 of 6 highest value global commodities (total value of these 5=US Int $715 billion)"},{"index":2,"size":5,"text":"FAOSTAT 2015 (values for 2013)  "}]}],"figures":[{"text":"From 2005/7 amounts of cereals, dairy and meat will be needed by 2050 From 2bn−3bn tonnes cereals each year From 664m−1bn tonnes dairy each year From 258m−460m tonnes meat each year Huge increases over 2005/7 amounts of cereals, dairy and meat will be needed by 2050 "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"2500ebac-b30d-45be-addc-3dd90fc5c851","abstract":""}

data/part_3/050d5d95dec440dde019d9b407773607.json

@@ -0,0 +1 @@
+{"metadata":{"id":"050d5d95dec440dde019d9b407773607","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0dff0892-b95e-43eb-a391-7ca3abbe64ec/retrieve"},"pageCount":19,"title":"Companion Modelling (ComMod) to Support Collective Land Management in the Highlands of Northern Thailand 1","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":632,"text":"For the last two decades, the highlands of northern Thailand have been the theatre of numerous conflicts dealing with natural resource management among an increasing number of stakeholders with different and sometimes contradictory perspectives. These conflicts mostly originate over an increasing scarcity of farmland and water resources, which is due to factors such as increasing population density, integration into the market economy, and environmental policies. 2 Two main types of conflicts dominate in upper northern Thailand: water-related conflicts between highlanders and lowlanders, and conflicts regarding farmland and forest cover, with local communities opposing the State. 3 Highlanders did not have much say in the regulation of these conflicts so far. Their agricultural practices were considered harmful to the environment and the government highly restricted their access to land and its management. As a result of several decades of highly centralized natural resource management, not only did degradation of environment continue, but many communities dependent on natural resources were impoverished. 4 In Thailand, as in other countries of Southeast-Asia, the recent general policymaking framework regarding natural resource management is favouring decentralization and public participation. This is an important opportunity for local communities to regain control over natural resource management and to increase their say in public affairs. 5 During the last decade, participation became a key word in numerous projects, but most of them adopted participation as a means, and not as a goal. 6 Moreover, they were often based on a so-called \"ethno-romantic\" view of hill tribe communities and failed to take into account diversity and divergence of points of view among stakeholders within local communities. 7 Therefore, much effort is still needed to enable the various local stakeholders to participate genuinely in local natural resource management issues. However, their eco-sociosystems are complex and uncertain, with numerous interacting ecological, social, and economic dynamics, as well as an increasing number of stakeholders with different socio-economic interests, land-use strategies, and points of view. 8 The general objective of the research activities presented in this paper is to develop innovative and context-adapted methodologies and tools to enable local stakeholders to identify and rank their key problems, to exchange their points of view on these problems, and to reflect collectively on ecologically adapted and socially acceptable solutions in such agrarian situations. We assume that this can be achieved through the facilitation of a collective learning process. In our work, learning is broadly defined as a change in the way people perceive their social and ecological environment (and consequently the way they act on it), according to their experiences, beliefs, values, intentions, and interactions with other people. 9 Companion Modelling (ComMod) is an emerging approach designed to facilitate collective learning and action at the community level. In most cases, it is combining the use of Multi-Agent Systems and Role-Playing Games to facilitate dialogue between various stakeholders concerned by a given local natural resource management issue. 10 Since late 2002, such a ComMod process is being tested in Mae Salaep, an Akha village of upper northern Thailand, to promote collective catchment management. This research takes place while highlanders are accused by lowlanders of continued deforestation and accelerated soil erosion in the head watersheds, and of disturbing the functioning of whole watersheds through sedimentation in rivers and reservoirs, as well as flash floods in downstream areas. In the past, numerous development projects attempted to solve this problem by proposing technical erosion control measures to farmers. Most of these attempts failed because of a lack of compatibility with local farmers' practices and strategies. The initial objective of the ComMod process was to stimulate collective learning on the soil erosion problem at the community level in Mae Salaep village. In particular, it aimed at examining the interactions between soil and water conservation, agricultural diversification, and social equity with the local stakeholders."},{"index":2,"size":120,"text":"Following a presentation of the local context, the problem, and the original characteristics of the ComMod approach, this article describes its concrete use with Akha villagers. The article explains how a shared representation of the watershed and its dynamics is achieved, and the way it supports collective learning on land management. The flexibility and adaptive characteristics of the gaming and simulation tools used with the people are highlighted as they fit with the evolving nature of coordination processes in adaptive natural resource management. How the focus of discussions evolved from agroecological to socio-economic dynamics related to soil erosion issue is also explained. Finally, preliminary lessons from this ComMod experiment are presented, as well as new perspectives for improving this approach."}]},{"head":"The Agrarian Situation and the Soil Erosion Problem in Mae Salaep","index":2,"paragraphs":[{"index":1,"size":233,"text":"Located in the northwestern part of Chiang Rai Province, Mae Salaep is a settlement made of two hamlets inhabited by Akhas people. The border with Burma is just a one-day walk across the mountains and the village was established in 1907 by a first group of migrants who crossed the border. Along the last century, the village has been permanently occupied by several groups of migrants. Since the construction in 1979 of an all-weather road connecting the village to the cities in the lowlands, small-scale farmers are being integrated into the market economy. As in many other parts of mountainous northern Thailand, the former agrarian system based on swiddening is being replaced by a semipermanent and cash crop-based agriculture. 11 This transition started more than 20-year ago and has reached an advanced stage in this area. Horticultural productions such as lychee or tea are now playing a key role. Fallow periods are already very short (generally one or two years long only), and every year more fields become permanently cultivated. As most of the farmers' fields are located on steep slopes with angles up to 60%, the perceived increase of the risk of land degradation through soil erosion by concentrated runoff is becoming a major issue. However, whether this risk is increasing, as believed by most of the powerful lowlanders, or not, and how to prevent this from happening is a complex issue."},{"index":2,"size":145,"text":"Land degradation is complex because it is not only related to agronomic and ecological factors, such as rainfall intensity, vegetative cover during critical climatic periods, or the angle and the length of the slopes. 12 It is also interacting with economic, social, and political driving forces and dynamics (i.e. price fluctuations, land ownership, access to credit, off-farm employment, etc.) that determine the choice and extent of different cropping systems. Moreover, when dealing with such a problem, we need to take into account the diversity of the concerned stakeholders. The households' integration into the market economy led to an extensive socio-economic differentiation among farmers having different amounts of productive resources, socio-economic objectives, and related land use strategies. 13 Beyond the local farming community, other key stakeholders are the recently-established sub-district administration office, the Royal Forestry Department and other government agencies promoting rural development in the highlands."}]},{"head":"Companion Modelling based on Multi-Agent Systems and Role-Playing Games in Mae Salaep","index":3,"paragraphs":[{"index":1,"size":89,"text":"According to Ostrom, 14 it is possible to avoid the tragedy of the commons (overexploitation of common resources) described by Hardin 15 if users coordinate to set up rules regulating their access to resources. As natural resource management situations are rapidly changing and highly uncertain, it would be vain to attempt to define what are the \"best\" rules. 16 Therefore, our objective is to reinforce people's adaptability by improving collective decision making-processes for elaborating these rules. Röling 17 assumes that this can be achieved through a collective learning process."},{"index":2,"size":66,"text":"ComMod is a participatory modelling approach aiming at facilitating such collective learning processes. Alternating field and laboratory activities in an iteractive and continuous way, its objectives are to facilitate the adaptive management capacity of local communities through the collective building of a shared representation of the problem at stake to identify acceptable solutions and related action plans. 18 In ComMod, the following tools are closely associated:"},{"index":3,"size":131,"text":"1. Multi-agent Systems: These computer modelling tools belong to the emergent field of Distributed Artificial Intelligence. 19 They are particularly appropriate to represent and simulate complex agro-ecosystems to examine natural resource management problems because they focus on interactions among heterogeneous social agents and their common environment. The various users and resource managers can be represented with their own interests, strategies, and set of practices in, for example, a cultivated watershed having its own bio-physical dynamics.  22 At the end of this first cycle combining the design and use of two Multi-Agent Systems models and a Role-Playing Game, the local stakeholders requested to change several features and rules of the tools to update them and to better represent their new preoccupations. The second ComMod cycle was implemented accordingly with the following steps:"},{"index":4,"size":13,"text":"1. Field survey to collect information about the new problem to be examined."},{"index":5,"size":8,"text":"2. Multi-Agent Systems modelling of the observed dynamics."}]},{"head":"Conception and implementation of a new Role-Playing Games associated to this new","index":4,"paragraphs":[{"index":1,"size":90,"text":"Multi-Agent Systems model. Two gaming sessions were implemented during the first day of a participatory workshop held in the village in May 2004. The first gaming session was played according to the organizers' representation of the system and was followed by a short collective debriefing. Players were asked to suggest changes to make the Role-Playing Games more in touch with their representation of reality, or to test a given scenario to solve the problem at stake. The second gaming session was played according to the suggested new features and rules."},{"index":2,"size":26,"text":"4. Individual interviews of the players the following day to better understand their behaviour during the game, and to evaluate the short-term impact of the game."},{"index":3,"size":22,"text":"5. Modification of the new Multi-Agent System model to integrate the participants' suggestions for improvement and new knowledge acquired during the game."}]},{"head":"Plenary session of participatory simulations on the third day using this improved","index":5,"paragraphs":[{"index":1,"size":26,"text":"Multi-Agent Systems model to support a negotiated agreement on a desired situation among stakeholders, and to explore several scenarios identified by them for reaching this objective."},{"index":2,"size":17,"text":"7. Back to the laboratory, more advanced simulations of scenarios were carried out (Barnaud et al, forthcoming)."},{"index":3,"size":46,"text":"8. More interviews with players were also carried out to assess the short and medium term effects of this ComMod cycle on their perceptions of the problem and their behaviour, their opinion about the usefulness of the process, and their wishes regarding a third ComMod cycle."}]},{"head":"ComMod in action: co-learning among Akhas villagers and researchers","index":6,"paragraphs":[{"index":1,"size":190,"text":"The First Researchers' Model and the Villagers' Requests for Changes The research team built a first Multi-Agent Systems model to synthesize the existing knowledge about the interactions between crop diversification, soil erosion, and households' economic differentiation. This model was used to conceive a first Role-Playing Games to confront this research team's understanding of the situation with the local stakeholders' one. 23 The knowledge acquired during the game was used to build a second and much simpler Multi-Agent Systems model, very similar to the Role-Playing Games in its rules and features and therefore easier to understand for the participants. This simpler model was used to support discussions and exploration of scenarios with them. The participants validated the researchers' representation of the agro-ecological aspects of soil erosion, but they requested changes in the model to focus on the expansion of perennial crops in the catchment, as this came out as their preferred way to alleviate the land degradation problem. They requested to integrate more perennial crops and to focus on socio-economic aspects closely related to their adoption, in particular access to credit, off-farm employment, and price fluctuations as shown in Figure 2."}]},{"head":"Figure 2. The Shift of Focus from Agro-Ecological to Socio-Economic Aspects of Land Degradation along the Successive Commod Cycles in Mae Salaep, Chiang Rai Province","index":7,"paragraphs":[{"index":1,"size":147,"text":"Perennial crops are seen by the villagers as a way to alleviate land degradation while providing more stable farmers' incomes. Moreover, as they require less labour than annual crops, they provide more time for off-farm employment, a major source of income in this area. Two perennial crops dominate in the watershed. Lychee was introduced in the early eighties but could be adopted by the wealthiest farmers only. More recently, green tea has been expanding and is accessible to a broader range of farmers because it requires no input, reaches maturity faster, and has a more stable market price than lychee. Farmers call it \"the plantation crop of the poor.\" However, even green tea plantations are not adopted by all villagers because harvesting the first leaves occurs only several years after planting. In fact, the possibility to invest in perennial crops is closely related to access to credit."}]},{"head":"Adaptation of the Model and the Role-Playing Game to Stakeholders' Preoccupations","index":8,"paragraphs":[{"index":1,"size":59,"text":"The first objective of this second ComMod cycle was to better understand the interactions between the adoption of perennial crops by the different types of farmers, access to credit, and off-farm employment, as requested by local stakeholders. The second objective was to stimulate exchanges of perceptions about this question between researchers and local stakeholders, and among local stakeholders themselves."}]},{"head":"• Understanding the Local System through an On-Farm Survey","index":9,"paragraphs":[{"index":1,"size":183,"text":"Here is a brief description of our first understanding of the local system through informal interviews with villagers. Two credit systems, formal and informal, co-exist in the village. Informal credit corresponds to loans settled among villagers, either without interests within networks of acquaintances, or with high interest rates (more than 5% per month) when loan sharks are involved. Regarding formal credit, beside a traditional village fund created ten years ago, a new government fund was made available in 2002. The older village fund provides small amounts of cash to any household, with interest rates fluctuating between 2% and 5% per month. The government fund provides larger sums, without interest, but is only accessible to well-off households because they are the only ones who can guarantee that they will reimburse the loan. This unequal distribution of the government fund is only partially compensated by its redistribution through informal loans within networks of acquaintances. As those networks are usually small and quite homogeneous, there are a number of small landholders, acquainted with households as poor as them, with no access to this source of credit."}]},{"head":"• A New Model to Represent the Observed Dynamics","index":10,"paragraphs":[{"index":1,"size":36,"text":"The objective of this model was to represent this complex local system under study according to the various stakeholders' perspectives, and to support the collective identification and assessment of possible future scenarios regarding access to credit."},{"index":2,"size":266,"text":"Because the stakeholders were more comfortable with it, we chose to improve the simpler Role-Playing Game-based Mae Salaep model to strengthen the appropriation of the modelling process by users. Changes were made from the first Mae Salaep model to produce the second version. A few changes were needed to fit the evolution of the agrarian situation. They concerned the introduction of green tea, new access to government fund credit and further differentiation among households. Most changes were made to tailor the new model to the shift of focus from agro-ecological to socio-economic aspects, particularly modelling of decision-making processes regarding investment in perennial crops, formal/informal credit, and off-farm activities. Figure 3   As in the game, there are twelve farmer-agents in the model. The time step is the cropping year. During each simulation, 15 time steps, i.e. 15 successive cropping years, are run. To represent informal credit, each farmer-agent is assigned two acquaintances among the other agents. Each year, if credit is needed, a model agent will successively try to find the required loan with the government fund, his acquaintances, the village fund, and, in a very last resort, through loan sharks. When an agent is indebted with loan sharks, he sends all his family labour to work in off-farm activities. If this is not enough to raise enough money, this agent is forced to sell his land and to leave the village. A labour constraint was also introduced into the model. Each year, the agents decide whether they assign family members to off-farm opportunities or not, knowing that off-farm employment may limit areas planted to annual crops."}]},{"head":"A New Role-Playing Game to Share This Model with Stakeholders","index":11,"paragraphs":[{"index":1,"size":10,"text":"The objectives of this new Role-Playing Games were as follows:"},{"index":2,"size":52,"text":"1. To stimulate exchanges between researchers and stakeholders, i.e. to \"open the black box\" 24 of the model and give them a chance to validate, criticize or improve it, 2. To stimulate exchanges among the farmers-participants with various interests, land-use strategies, and perspectives on the problem of unequal access to perennial crops."},{"index":3,"size":97,"text":"To facilitate model sharing, its associated Role-Playing Game displays very similar features and mode of operation. Consequently, changes made in Mae Salaep Role-Playing Game 1 to conceive this second Role-Playing Game were almost the same than the modifications made in the Multi-Agent System model to build its second version. Because a gaming session should not be too long and must remain lively, we could not add more features and rules linked to socio-economic processes without simplifying some agroecological features related to soil erosion. The main principles and rules of this new game are presented in Box 1."}]},{"head":"Box 1. The Main Rules and Features of the Second Mae Salaep Role-Playing Game","index":12,"paragraphs":[{"index":1,"size":245,"text":"Each participant plays the role of a farmer managing a set of fields located on different slopes of a 3D block model representing a catchment. The 12 players-farmers are given various amounts of land, labour, and capital according to the actual farming conditions of the three main types of farms present in the village (types A, B and C for small and cash crop-oriented, medium and conservative, and largest and diversified farming households respectively). There are 3, 6, and 3 players representing type A, B, and C respectively, played by farmers who actually belong to these categories. During each gaming round (corresponding to one crop year), the players successively assign a given crop to each of their fields (taking the labour constraint into account), harvest their products, observe cash crop prices conditions, go to the market to sell their products, pay for their annual expenses, draw an \"exceptional expense card\" which they have to pay for, draw an \"offfarm opportunity card\" which they can accept or refuse, and finally go to the credit desk to ask for and/or reimburse credit if needed. At any time they can exchange money with other players. Each year, the general climatic and market price conditions are determined by drawing a card at random. The annual incomes obtained by players depend on their choice of crops, the level of prices for cash crops, and the two \"chance cards.\" Six cropping years could be played within two half day gaming sessions."}]},{"head":"Box 2. Dynamics Observed During Two Gaming Sessions of the Mae Salaep Second Role-Playing Game on 26 May 2004 in Mae Salaep Village of Chiang Rai Province","index":13,"paragraphs":[{"index":1,"size":253,"text":"During the first gaming session, medium-sized and large landholders (type B and C) invested massively in tea and lychee plantations by making extensive use of both formal and informal credit. The small landholders (type A) chose much less risky strategies by \"growing\" mainly low input annual crops. Because everybody needed cash, the players were eager to draw off-farm opportunity cards. Off-farm income was a main source of cash and this kind of revenue was extensively redistributed among players through numerous informal exchanges. This first gaming session was followed by a short collective debriefing. The participants noticed that type A smallholders were the only ones who did not invest in plantation crops because they lacked access to credit. An old participant suggested solving the problem with informal credit: \"It is not possible to change the rules of formal credit. Informal credit is more efficient. They should ask me, I would agree to lend them money without interest.\" On the other hand, some younger participants suggested changes in the formal credit: they proposed to try a 3-year grace period for smallholders under the government fund (3 years was the time needed for plantations to reach maturation in the game). Type A farmers said that to be able to reimburse their loans, they should be allowed to send all their family workers to off-farm employers until the plantations reach maturity. This new rule was tested in the second gaming session: all the smallholders invested in small tea and lychee plantations and succeeded in reimbursing their loans."}]},{"head":"Gaming Sessions, Discussions and Collective Exploration of Possible Future Scenarios","index":14,"paragraphs":[{"index":1,"size":110,"text":"The first gaming session revealed the social inequity regarding investments in plantation crops because of unequal access to credit. All the participants agreed on the fact that this situation was both realistic and problematic. This collective agreement stimulated discussions among them. Questions were raised such as: how could they change the rules of formal and informal credit so that smallholders (type A) would have a better access to credit? Is it possible to change those rules? Would smallholders benefit from such a change or would they face a higher risk of bankruptcy? What would be the consequence of such changes for the medium-sized and larger landholders (type B and C)?"},{"index":2,"size":14,"text":"They exchanged their views on these topics and proposed two possible solutions (Box 2)."},{"index":3,"size":95,"text":"1. One regarding changes in informal credit: in the game, like in reality, small landholders that are not acquainted with wealthy farmers do not have access to informal credit; a player suggested that there should be more solidarity for those small landholders and that wealthy villagers should lend them money without interests, 2. Another one dealing with new rules for formal credit: in the actual situation, the government fund provides annual credit but small landholders do not have access to it; two players suggested establishing a 3-year grace period for smallholders under this government fund."},{"index":4,"size":12,"text":"This second scenario was tested in the afternoon gaming session (Box 2)."},{"index":5,"size":201,"text":"Scenarios Identified, Selected, and Simulated During the individual interviews following the game, the participants were asked to assess the model of the game, to assess whether some important dynamics related to the problem were missing or not well represented. The model of the game was validated by all the players. \"It is exactly like reality!\" was a frequently heard comment during these interviews. A few suggestions for improvements were made by some players, in particular regarding the calibration of off-farm incomes in the game (depending on the situation they faced in reality, some of them found these incomes to be too high, while others found them too low). This validated model integrating the suggestions made by the players was used as a support in participatory simulations. Indeed, the game succeeded in stimulating discussions and suggestions of scenarios by stakeholders, but only one new scenario could be played within the afternoon. To remove this time constraint and be able to test more scenarios, simulations could be run by using the MaeSalaep 2 model with the participants. They could easily follow the simulations and understand the functioning and the limits of the model, as they had played the game corresponding to this model."},{"index":6,"size":8,"text":"Three tested scenarios are presented in figure 4:"},{"index":7,"size":49,"text":"1. The first scenario corresponds to the current situation, i.e. the rules for the operation of formal and informal credit are similar to the actual ones: one-year long loans from the government fund distributing Baht 25 0, 10, and 20 thousands to type A, B, and C farms respectively."},{"index":8,"size":116,"text":"2. The second scenario tests new rules for the operation of informal credit corresponding to the suggestion of an older player: the lack of access to credit by type A smallholders should be solved through informal credit. This is translated into a scenario with larger and more heterogeneous social networks allocating informal credit (Figure 5). This scenario is very efficient in reducing the number of bankrupt smallholders but does not allow them to increase their investments in plantation crops. This is because they borrow money from their acquaintances only for urgent family consumption needs, not for investment. Moreover, this scenario is very hypothetical because there is no explicit rule in the current functioning of informal credit."},{"index":9,"size":104,"text":"3. The third scenario is implemented with a new set of rules for formal credit: 26 threeyear long loans of 12, 24, and 54 thousands Baht for type A, B, and C farms respectively. This option enables the three types of farmers to invest significantly more in plantation crops. If the loan is rather small, smallholders manage to reimburse it. They face less risk of bankruptcy than in the current situation thanks to the incomes from their plantations. However, this solution is less efficient than the previous scenario (type A villagers acquainted with type B and C villagers) to reduce their risk of bankruptcy."}]},{"head":"Figure 4. Different Social Networks among Three (A, B, C) Types of Farms to Regulate the Distribution of Informal Credit in the Simulations","index":15,"paragraphs":[{"index":1,"size":9,"text":"Network 1 (actual situation) Network 2 (larger and heterogeneous)"}]},{"head":"Figure 5. Results of Simulations (After 15-Year/Time Steps) Exploring the Effects of Various Rules for the Allocation of Formal and Informal Credit on the Adoption of Perennial Crops and Farmer's Differentiation Preliminary Lessons from a Commod-Facilitated Collective Learning Process","index":16,"paragraphs":[{"index":1,"size":242,"text":"In this section, we will evaluate the first phases of this ComMod experiment according to its objective, i.e. to stimulate a collective learning process for sustainable participatory land management at the community level. According to Leeuwis 27 and van Paassen, 28 the facilitation of a collective learning and negotiation process requires several tasks: a good understanding of the local context by the facilitators, the participants' awareness of the existence of a problem and of the necessity to solve it collectively, the exchanges of their different perspectives on this problem, the negotiation of a joint desired outcome, and the exploration of possible scenarios of changes to achieve this desired outcome. As discussed below, the ComMod experiment in Mae Salaep achieved to a certain extent to stimulate these different aspects of a collective learning process. Nevertheless, these authors also underline the importance of the communication with higher institutional levels to enhance room for manoeuvring of local stakeholders and to support and strengthen their projects. This is the main limit of this experiment, so far, and we are now working to improve this weak linkage. As discussed at the end of this section. The collective learning and negotiation process that occurred in Mae Salaep has not yet turned into action partly because of the lack of an effective dialogue with local administrative institutions having the resources to support village projects. Scenario III: modified rules for formal credit (longer period for reimbursement and more equitable distribution)."},{"index":2,"size":5,"text":": Small market integrated farms"},{"index":3,"size":230,"text":"Researchers' Continuous Understanding of the Complex Socio-Ecological System under Study Lavigne-Delville 29 underlines that an important limit of participatory approaches conducted in the past was the lack of understanding of the complexity of the local context in which the projects were embedded. The experiment in Mae Salaep started with an indepth diagnostic analysis of the local socio-ecological context and the key agro-ecological processes. Nevertheless, the ComMod process itself allows researchers to fine-tune their understanding of the complex socio-ecological system under study through an interactive exchange of perspectives between researchers and local stakeholders. For example, in the game of the first ComMod cycle, local stakeholders were invited to react on the representation of the land degradation process as seen by the research team. They could express their own perspectives on the problem and suggest their preferred way to alleviate it, i.e. the expansion of perennial crops in the catchment. The process enabled the research team to better understand local farmers' preoccupations and to adapt their tools accordingly. This underlines the relevance of alternating field and laboratory activities in an iterative way. Such a process allows researchers to adapt models and games to the evolutions of the learning and negotiation process and of the local socio-ecological context. This approach requires very flexible tools, and the availability of model developers who genuinely want to understand and represent the rationality of the local stakeholders."},{"index":4,"size":100,"text":"The game and the discussions it stimulated also enabled the research team to better understand the social context in which the process is embedded. In particular, we could better elucidate tacit knowledge and distribution of power among villagers related to decision-making for credit allocation. Such tacit knowledge explains the difference between the way people say they behave (that corresponds to the limited knowledge acquired from previous interviews) and their actual behaviour. It is crucial for the researchers to understand the status, interests, and relationships of the various participants to be in a position to facilitate a genuine collective learning process."},{"index":5,"size":194,"text":"Awareness of a Problem and of the Need to Solve It Collectively According to Röling, 30 such awareness is a prerequisite to motivate the participants to join in a collective learning and negotiation process. In our experiment, participants say that the ComMod process contributed to a certain extent to a growing awareness about the soil erosion problem and the \"need\" to change current crop production practices towards the adoption of more perennial plantations. This is also because the Royal Forestry Department is still threatening to further restrict the villagers' access to farmland if they do not adopt soil & water conservation practices. In fact, this awareness was already present in the minds of several innovating villagers, and the game served as a support for these villagers to communicate their ideas and knowledge about perennial crops to other villagers. In the second ComMod cycle, the game also triggered awareness about the problem of unequal access to perennial crops and credit among the villagers. This is a problem not only for small landholders but also for other villagers because if Royal Forestry Department complains about numerous villagers' practices, sanctions will be globally applied to all villagers."},{"index":6,"size":135,"text":"The Role-Playing Game is a key tool to raise awareness. It triggers experimental learning 31 in which the participants can observe by themselves the feedback resulting from their actions. Leeuwis distinguishes between positive feedback, information that indicates that one is on the right track, and negative feedback indicating the existence of a problem. This author notes that negative feedbacks might have less impact than positive feedbacks because people tend to close their eyes on \"bad news\", but it can also stimulate willingness to solve the problem. In our experiment, both kinds of feedbacks occurred. While on one hand the players could see that perennial crops provided better incomes than annual crops, on the other hand they stated that a category of villagers were unable to move in that direction and discussed to solve this problem."}]},{"head":"Exchanges of Perspectives on the Problem among Stakeholders","index":17,"paragraphs":[{"index":1,"size":112,"text":"In the second ComMod cycle, participants repeatedly said during the interviews of evaluation that the Role-Playing Game allowed them to better understand each other's situations and points of views by providing a new platform for communication where none existed before. Some medium-sized and large farms owners said that they had the opportunity to better understand the kind of difficulties faced by smallholders. Moreover, they could exchange and express their different views regarding the credit issue. A community leader declared that \"in every day life, everybody has his own problems, people do not have the opportunity to think about others' situations. There is no place like this where we can think all together.\""},{"index":2,"size":80,"text":"The ComMod experiment provided a missing place not only for dialogue among villagers but also between villagers and the local officers of Department of Public Welfare working in this village that facilitated our research activities. Whereas at the beginning the one with a higher hierarchical level was quite suspicious about the efficiency of the experiment, he recently declared that the experiment allowed him to better understand the villagers' problems and even changed their relationship towards more frequent and friendly contacts."}]},{"head":"Negotiation of a Common Goal and Possible Solutions","index":18,"paragraphs":[{"index":1,"size":171,"text":"The increasing awareness and exchanges of perspectives about the problem of unequal access to perennial crops that were stimulated by the morning gaming session triggered discussions among players to define a joint desired situation and possible new rules to achieve it. In this game, the desired situation was access to perennial crops for a wider range of farmers, and the discussed possible solutions regarded the rules of allocation of informal and formal credit. After negotiations, they decided that small landholders could benefit from a credit and would manage to reimburse it if they could change the duration of the grace period from one to three years, because this is the time needed for tea to provide a first harvest. When commenting on the negotiation process that occurred to identify this idea, a player said that he saw the game as a kind of democratic platform where all voices could be expressed. It would be ideal, but is it really the case? And if yes, could all the voices be really heard?"},{"index":2,"size":134,"text":"It is the role of the facilitation team to make sure that all stakeholders feel free to express themselves during the process. To achieve this, the first difficulty is that some players do not dare express themselves in the presence of Thai and western researchers, or government officers. This is especially true in the context of northern Thailand where ethnic minorities have been used to more top-down kinds of interventions. The second difficulty is that people of little influence do not express themselves in the group, in particular Akha women who are rarely able to speak Thai because they are less involved than men in off-farm activities. \"In Akha communities, women work, men speak,\" said a female participant. Still, their voice is essential, as they are the most active actual users of natural resources."},{"index":3,"size":51,"text":"The ice-breaking playful mood of the game was also a determining element to reduce these difficulties. Moreover, individual interviews were conducted besides collective discussions to ensure that all voices could be expressed. However, whether they were all heard and taken into account in the formulation of possible solutions is another matter."},{"index":4,"size":205,"text":"There are no open conflicts among villagers in Mae Salaep. Their cultural background is deeply oriented towards social cohesion and avoidance of such conflicts. In the case of a divergence of interests, an Akha person would rather accept any compromise than to face a confrontation. 32 Still, because no farmers have similar amounts of resources and interests, there can be divergence of interests among them. In addition, these divergences can block the process of collective identification of solutions. Typically, in the village, some relatively wealthy villagers exert influence over small landholders through informal loans (with interests in the case of loan sharks, or even without interests in the case of more hidden relations of dependence). Those people might be afraid to loose some of their privileges by changing the rules of formal credit systems. Moreover, as those villagers are also the ones who decide the allocation of formal credit, even if they are not ill intentioned, they could be tempted to maintain the status quo. In this respect, the Role-Playing Game plays a key role, as the playful mood and the fact that \"it is a game\" helps villagers to discuss potentially conflicting issues more freely than in a conventional and more threatening classic meeting."},{"index":5,"size":231,"text":"According to van der Veen, 33 in a communicative learning process, the phase during which participants synthesize the diverse expressed facts and arguments to formulate a \"collective\" solution is determining. It is at this stage that the most influential or intelligent participants risk to impose (consciously or not) their point of view. Therefore, there is a need to draw special attention to the composition of the group of participants. Researchers and participatory workshop organizers should be aware of the status and social role of the participants in the community to be able to interpret correctly the collective discussions and agreements stimulated by the ComMod process. In our case, the participant who formulated the suggestion for changes in the rules of formal credit allocation is a well-known community leader. He is an innovative and rather well off farmer, that other villagers observe and imitate \"because he is clever and always make good choices,\" said one of them. This leader does not express himself very easily in groups, especially because he cannot speak Thai very well. However, by leading the Christian community in the village, he benefits from the respect inspired by his status. Moreover, we should keep in mind that the ideas he is supporting are very much in line with Christian precepts, and that only one half of the villagers are Christians, the other one being animists with specific Akha beliefs."}]},{"head":"Exploration of Possible Scenarios to Achieve This Goal","index":19,"paragraphs":[{"index":1,"size":214,"text":"The participants could assess the solutions they suggested by simulating them in the Role-Playing Game, and with the computerized Multi-Agent System model. This exploration of scenarios corresponds to an experimental learning process in which the participants get a better insight in their complex socio-ecological system by observing the effects of their individual and collective decisions. Such an experimental learning had a strong impact on the participants. The Christian leader said that \"in the game, the players can try by themselves. It is more efficient than speaking.\" According to another wealthy farmer, \"the game helps to think in advance because during a gaming session, players could observe six cropping seasons and assess the effects of their choices regarding crop and credit. In every day life, we do not have the opportunity to think in advance. We can only think to grow maize each year to buy and eat rice.\" A woman mentioned that the experiment provided her with the opportunity to plan for credit, because this was usually a matter managed by her husband. At the collective level, they could test the new rule for loan reimbursements they had suggested and observed the benefits of this solution. However, these discussions about changing the rules governing the management of credit did not translate into concrete action."},{"index":2,"size":178,"text":"The Lack of Linkage with Institutions at a Higher Level: The Main Limit of This Experiment So Far The lack of concrete action so far is easy to understand. In the game, villagers suggested to change the rules for the allocation of the government fund, and more precisely a three-year long credit that would allow small landholders to invest in perennial crops and to reimburse their credit on time. However, if the allocation of this fund among villagers is managed by a committee of villagers, the grace period is decided by the government. Still, the discussions about credit stimulated by the ComMod process did not disappear totally as they switched to discusions about the rules governing the other formal source of credit available in the village, the village fund. Here, the villagers are fully responsible for the definition of the rules governing this fund. However, the idea of a three-year grace period was abandoned as the fund was considered insufficient, and they discussed its rates of interest. They decided to lower these rates to favour credit to smallholders."},{"index":3,"size":46,"text":"The real impact of the game in this decision is uncertain, as these kinds of discussions and decisions had already occurred in the past. This limited impact of the ComMod process in this experiment highlights the need for the support of institutions at a higher level."},{"index":4,"size":161,"text":"There is a need to facilitate dialogue between these two levels and to reinforce institutional linkages in a bottom-up way to increase the impact of this ComMod process. Except for the local officers of the Department of Public Welfare that facilitated our research activities in the village, official representatives of administrations at a higher level were neither integrated into the model nor invited to the participatory workshops, so far, because we thought that their presence could have intimidated villagers and brought the collective discussions to a standstill. But, now that the participants feel confident enough and even willing to integrate them into the collective learning process, this new phase can occur. When asked what other stakeholders should be invited to take part in a future gaming session, the villagers mentioned the Tambon (or Sub-district) Administrative Organization at their officers who should be invited to play their own role in the game, \"so that they know what is happening in the village.\""},{"index":5,"size":116,"text":"The impact and legitimacy of the ComMod process could also be improved with a further implication of facilitators belonging to local institutions. In this experiment, the local officers of the Department of Public Welfare could have played this role, but until now they were reluctant to be genuine drivers of the process because of the difficulty to integrate it in their obligations towards their hierarchy. However, as their interest is growing, they might adopt the game as a tool in their development activities with villagers in the future. The transmission of the game to this local development agency and the evaluation of its use and effects will be implemented in a future step of this experiment."}]},{"head":"Conclusions and Perspectives","index":20,"paragraphs":[{"index":1,"size":85,"text":"The association of simulation and gaming tools tested in this experiment displayed a great potential and flexibility to facilitate and accompany collective learning and negotiation processes on complex natural resource management issues with local communities. It was efficient to stimulate an interactive dialogue between researchers and stakeholders, and more importantly, among local stakeholders themselves. The participants defined collectively what was the problem in their opinion, exchanged their perspectives on this problem, negotiated a joint desired outcome, and explored possible scenarios of change to reach it."},{"index":2,"size":162,"text":"But what to do to ensure that this kind of experiment does not remain only a dialogue among a few villagers that is admittedly very interesting for the participants and for the researchers but has no concrete benefit for the community? How to strengthen the effects of ComMod experiments? Higher level institutions should be more implicated in such approaches. The effective adoption of genuine participation by administrative institutions is a challenge in Thailand where a highly centralized form of governance was the norm during the past decades. However the current process of decentralization, and in particular the adoption of the 1997 Constitution and the establishment of elected tambon councils at the sub-district level, constitute important opportunities to remodel the institutional framework in a way favoring dialogue between local communities and the once untouchable bureaucracy. Such a dialogue is particularly necessary in the context of mountainous northern Thailand, because institutions have long been biased against ethnic minority groups, accused of damaging the environment."},{"index":3,"size":107,"text":"Our future challenge is to test and adapt the ComMod approach to facilitate such a dialogue. To improve the ComMod approach in this regard, we suggest that the research team should first conduct an institutional analysis of local organizations' strategies and interests and identify local institutions that could participate in the process. Then we would present to them the principles of the ComMod approach, and establish with them in which ways and with which objectives they would be interested to implicate themselves. The need for their implications in this kind of approaches underlines the growing need to train local officers towards a more bottom-up way of thinking. "}]}],"figures":[{"text":" ** Aspects on which farmers-participants requested to focus in the 2 nd ComMod cycle * Aspects of land degradation that were collectively validated in the 1 st ComMod cycle "},{"text":" displays the main entities of Mae Salaep 2 model with their various attributes and methods. The figure highlights the changes made from first to second version of the model. "},{"text":"Figure 3 . Figure 3. Class Diagram of the Mae Salaep 2 Model "},{"text":" Type A: Small and m arket integrated farms Type B: Average and cons ervative farms Type C: Large and diversified farms : Large farms & diverse productions current situation & rules Scenario II: modified rules for informal credit (larger and more heterogeneous social networks of acquaintances). "},{"text":"Notes1 Communication published in Natural Resources Related Conflict Management in Southeast Asia, edited by Suwit Laohasiriwong & Ming-Chee Ang, after a presentation at the IDR-KKU International Conference on \"Natural Resources Related Conflict Management in Southeast Asia,\" 6-8 September 2005, Khon Kaen, Thailand. 2 Bruneau, M. (2002) \"Évolution des étagements ethnopolitiques dans les montagnes sinoindochinoises.\" Hérodote 107. 4. pp. 89-118; Thomas, D.E., Weyerhaeuser, H. & Sapathong, P. (2002) \"Improved Tools For Managing Agroforestry Landscapes In Northern Thailand: Pilot Application Of Spatial Analysis And Negociation Support Systems\" in Poceedings of the 3rd International Conference on Montane Mainland Southeast Asia (MMSEA), Lijiang, Yunnan, China, Yunnan Science and Technology Press, China (China: Yunnan Science and Technology Press). 3 Rutherford, J. (2002) \"Institutions, Impacts, & Responses in the Agrarian Transformation of the Mountains of Northern Thailand\" in Poceedings of the 3rd International Conference on MMSEA, op. cit. "},{"text":"Figure 1. The Iteractive Companion Modelling Process Alternating Field and Laboratory Activities Carried Out in Mae Salaep, Chiang Rai Province  discussions among them that do not occur easily in reality because of potential discussions among them that do not occur easily in reality because of potential conflicts, or of the lack of opportunity and suitable platform to interact in a non- conflicts, or of the lack of opportunity and suitable platform to interact in a non- threatening environment.   threatening environment.  Conceptual Conceptual First ComMod modelling of observed First ComModmodelling of observed cycle initiated by dynamics cycle initiated bydynamics researchers (2002)   researchers (2002)  On-farm surveys Role Playing On-farm surveysRole Playing  on problem Game (RPG) on problemGame (RPG)   to exchange to exchange   points of view points of view New ComMod   New ComMod cycle on new   cycle on new emerging issue (2004) Participatory simulations (1) Adjustment of model to local emerging issue (2004)Participatory simulations (1)Adjustment of model to local  to assess stakeholders ' to assessstakeholders '  scenarios perspectives scenariosperspectives Modelling Confrontation to reality  ModellingConfrontation to reality (1) Simulations with RPG and/or Multi-Agent System  (1) Simulations with RPG and/or Multi-Agent System Figure 1 displays the main methodological phases implemented in this case study. The Figure 1 displays the main methodological phases implemented in this case study. The first participatory modelling cycle carried out during 1999-2002 is described in details first participatory modelling cycle carried out during 1999-2002 is described in details elsewhere.   elsewhere.  20  20 2. Role-Playing Games: To involve local stakeholders in the modelling process, in this 2. Role-Playing Games: To involve local stakeholders in the modelling process, in this experiment, we choose to translate an initial Multi-Agent Systems built by researchers experiment, we choose to translate an initial Multi-Agent Systems built by researchers to integrate knowledge about the soil erosion problem into a Role-Playing Game. To to integrate knowledge about the soil erosion problem into a Role-Playing Game. To play this Role-Playing Game helps local stakeholders to understand the structure and play this Role-Playing Game helps local stakeholders to understand the structure and operation of the computerized Multi-Agent Systems model, and gives them a chance to operation of the computerized Multi-Agent Systems model, and gives them a chance to validate, to criticize, and to improve it. Such a transformation is possible because validate, to criticize, and to improve it. Such a transformation is possible because Multi-Agent Systems have similar features to Role-Playing Games: agents Multi-Agent Systems have similar features to Role-Playing Games: agents corresponding to roles, the spatial interface to the gaming board, the time step in a corresponding to roles, the spatial interface to the gaming board, the time step in a simulation to a round of the game, etc.. 21 Moreover, a Role-Playing Game implicating simulation to a round of the game, etc.. 21 Moreover, a Role-Playing Game implicating several stakeholders involved in solving a common problem, is expected to stimulate several stakeholders involved in solving a common problem, is expected to stimulate  "}],"sieverID":"208afd14-59a6-4ab9-b328-82c52c9b1bf9","abstract":""}

data/part_3/052aa72e10020deab97468bb004607bd.json

@@ -0,0 +1 @@
+{"metadata":{"id":"052aa72e10020deab97468bb004607bd","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6b83c556-c51b-408b-b3a3-10c91e1d8a3b/retrieve"},"pageCount":2,"title":"The 3 rd International Forum on Water and Food","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":110,"text":"1. The shallow groundwater based irrigation systems have significantly contributed to communities' economy, proverty reduction, and food access. 2. Appropriate technical, policy and institutional support systems such as provision of appropriate technologies, value chains, input--output marketing systems, better understanding of the hydrogeology and the nature and extent of existing use are required to enable the farmers to fully exploit the potential of groundwater based irrigated agriculture. . hard--labor associated with the digging of wells during the cropping season and refilling them after harvesting remains a major constraint to SGI expansion. PN65 Phase 2 will assess current irrigation practices, test, and recommend alternative SGI technologies that are less labor--intensive and affordable."},{"index":2,"size":71,"text":"It will examine factors that lower enterprise profitability and challenges facing farmers and offer recommendations to improve returns on investment in SGI. Opportunities for farm diversification will be explored to enhance productivity. The project will also identify opportunities for outscaling SGI in other areas beyond the initial study sites including identification of extrapolation domains within the Basin that are homogeneous with respect to biophysical and socio--economic variables for out--scaling SGI practices. "}]}],"figures":[],"sieverID":"29f99c0b-76bc-42e2-9df2-b28764c82113","abstract":"Using a multi--disciplinary approach, PN65 assessed the extent, potential and socio--economics of SGI in the White Volta Basin. The study used high image resolution to delineate irrigated areas and developed a conceptual numerical model to analyze the sustainability of SGI in the study area. Socio-economic surveys were carried out to determine SGI adoption patterns and coverage. Results from the study show that farmers practicing SGI are generating considerable economic benefits that can be enhanced by addressing issues of appropriate technology, value--chain analysis, and input--output marketing systems. The study also confirmed that the incidence of poverty among households with access to shallow groundwater irrigation is lower as compared to purely rainfed farmers. However, the"}

data/part_3/052b1c6f6b5863ebd86d35e2aec7926a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"052b1c6f6b5863ebd86d35e2aec7926a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a6937a03-1a30-4140-b4b3-f04d2a3ca58c/retrieve"},"pageCount":19,"title":"Burundi Bean reviewing and planning","keywords":[],"chapters":[{"head":"Structure of Presentation","index":1,"paragraphs":[]},{"head":"Overview of country output & outcome results","index":2,"paragraphs":[{"index":1,"size":65,"text":"alongside the targets set out 2. A look at lessons learnt and way forward. 3. Discussions & identification of immediate action points for fulfilling promises made at target level 4. Discussion on if targets need to be changed downward ( and a communication made to the donor) or remain as they are and efforts be made to re-orient the action plans to address the targets."},{"index":2,"size":2,"text":"Output 1: "}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Output Indicator 2015 2016 2017 2018 2019 Target Status ( % achieved Provide additional information     Output 2:   Output 2: Output Indicator 2015 2016 2017 2018 2019 Target Status ( % Provide additional Output Indicator2015 2016 20172018 2019TargetStatus ( %Provide additional Number of preferred high yielding stress tolerant varieties developed Number of bio fortified bean varieties released Number of products Adapted & Farmer accepted developed Number of tools developed ICM technologies developed Number of gender specific through community nutrition engagement labour efficient techniques/ Number of nutrition related technologies identified Levels of satisfaction with the policy briefs Number of nutrition sensitive technologies (above) Amount of seed (tons) of new approaches validated and promoted dry bean varieties produced Number of delivery systems policy briefs and disseminated Number of Nutrition related 2 --1 ------- 1 1 -1 ------- 1 1 --------- 1 1 --------- 1 1 --------- 6 4 3-best 5 bet 2 2 1 > 50% 2 750,000 4 1 achieved) 7 (116.7%) 7 3 1 (50%) 1371.12 information Released in 2015 These 7 varieties were released in 2015 and are also bio fortified Number of preferred high yielding stress tolerant varieties developed Number of bio fortified bean varieties released Number of products Adapted & Farmer accepted developed Number of tools developed ICM technologies developed Number of gender specific through community nutrition engagement labour efficient techniques/ Number of nutrition related technologies identified Levels of satisfaction with the policy briefs Number of nutrition sensitive technologies (above) Amount of seed (tons) of new approaches validated and promoted dry bean varieties produced Number of delivery systems policy briefs and disseminated Number of Nutrition related2 --1 -------1 1 -1 -------1 1 ---------1 1 ---------1 1 ---------6 4 3-best 5 bet 2 2 1 > 50% 2 750,000 4 1achieved) 7 (116.7%) 7 3 1 (50%) 1371.12information Released in 2015 These 7 varieties were released in 2015 and are also bio fortified used for dry bean seed and         used for dry bean seed and ICM technologies to reach men         ICM technologies to reach men and women end users         and women end users  "},{"text":"Lesson Learned: Way forward: Output 3: Output Indicator 2015 2016 2017 2018 2019 Target Status( % achieved) Provide additional information     Output 4:   Output 4: Output Indicator 2015 2016 2017 2018 2019 Target Status ( % Provide additional Output Indicator2015 2016 20172018 2019TargetStatus ( %Provide additional        achieved) information achieved)information Number of women involved in - - - - - 40%   Number of women involved in-----40% Number of business models linking bean farmers to research and decision making bodies - - - - - 1 1 (100%)  Number of business models linking bean farmers to research and decision making bodies-----11 (100%) markets Number of people - - - - - 20% in   markets Number of people-----20% in Number of functional platforms linking farmers to (Male/Female/youth) trained on gender equity - - - - - 1 participating 2 sites  Number of functional platforms linking farmers to (Male/Female/youth) trained on gender equity-----1 participating 2 sites markets Number of men and women -- 100 120 140 150 510 (50% 2721  markets Number of men and women--100120140150510 (50%2721 Number of value chains of participating in various capacity building initiatives (in processed products analyzed Number and types of degree and non-degree) Number of NARs identified and promotion strategies for processed products trained on M&E --- 1 -- --- --- ---- women) 1 1 tracer study 1 1 9 Trained in 2016 during the ICT enabled M&E initiative Number of value chains of participating in various capacity building initiatives (in processed products analyzed Number and types of degree and non-degree) Number of NARs identified and promotion strategies for processed products trained on M&E---1 ------------women) 1 1 tracer study 1 19Trained in 2016 during the ICT enabled M&E initiative Number of business models processed bean products disseminated used to support trade in available and results Impact assessment reports -- -- -- -- -- 1 1   Number of business models processed bean products disseminated used to support trade in available and results Impact assessment reports----------1 1 Lesson Learned:     Way forward:   Lesson Learned:Way forward: Lesson Learned:     Way forward:   Lesson Learned:Way forward:  "},{"text":"No of households (50% represented by women) accessing bean varieties & ICM technologies -750,000 No. of women and youth accessing labor saving technologies -5,000 No. of HH accessing climbing bean varieties in Burundi-300,000 Level of satisfaction with the delivery systems for dry bean varieties, products and ICM-60%  Immediate Outcome 2: Immediate Outcome 2: Years  2015 2016 2017 (SEM-1) Years201520162017 (SEM-1) HH Accessing dry bean varieties and ICM technologies 18,791 25,198 26,900 HH Accessing dry bean varieties and ICM technologies18,79125,19826,900 No. of HH accessing dry beans & ICM 2015-2017  No. of HH accessing dry beans & ICM 2015-2017 30,000    30,000 25,000    25,000 20,000    20,000 15,000    15,000 10,000    10,000 5,000    5,000 0 2015 2016 2017 0201520162017 HH accessing dry beans and ICM 18,791 25,198 26,900 HH accessing dry beans and ICM18,79125,19826,900 Phase Target 750,000  Phase Target750,000 Milestone Status 70,889  Milestone Status70,889 Achievement (%) 9.5%   Achievement (%)9.5%  "},{"text":"Number of households accessing bio fortified bean varieties and bean based products -250,000  Years 2015 2016 2017 (SEM-1) Years201520162017 (SEM-1) HH Accessing bio fortified 7,851 9,584 10,542 HH Accessing bio fortified7,8519,58410,542 No. of HH accessing bio fortified varieties and bean products 2015- No. of HH accessing bio fortified varieties and bean products 2015- 12,000    12,000 10,000    10,000 8,000    8,000 6,000    6,000 4,000    4,000 2,000    2,000 0 2015 2016 2017 0201520162017 HH accessing bio fortified varieties and bean products 7,851 9,584 10,542 HH accessing bio fortified varieties and bean products7,8519,58410,542 Phase Target  250,000  Phase Target250,000 Milestone Status  27,977  Milestone Status27,977 Achievement (%)  11.2 %  Achievement (%)11.2 %  "},{"text":"Number of people accessing information -50,000 Level of satisfaction with information media-70%  Years 2015 2016 2017 (SEM-1) Years201520162017 (SEM-1) HH selling to profitable markets 5,000 4,214 555,375 HH selling to profitable markets5,0004,214555,375 No. of people accessing Information (Trainings, printed material, trade No. of people accessing Information (Trainings, printed material, trade  shows, electronic media)  shows, electronic media) 600,000    600,000 500,000    500,000 400,000    400,000 300,000    300,000 200,000    200,000 100,000    100,000 0 2015 2016 2017 0201520162017 No. accessing Information 5,000 4,214 555,375 No. accessing Information5,0004,214555,375 Phase Target  50,000  Phase Target50,000 Milestone Status 564,589  Milestone Status564,589 Achievement (%) Beyond set target  Achievement (%)Beyond set target  "},{"text":"Yield per Hectare -750 kg/ha Area occupied by climbing beans under bush-> 20% Targets: Number of men, women & children utilizing bean based processed products-2,000,000 Number of households utilizing bio fortified varieties-280,000   Intermediate Outcome 3:  Intermediate Outcome 3: Years 2015 2016 2017 (SEM-1) Years 2015 2016 2017 (SEM-1) Years201520162017 (SEM-1)Years2015 2016 2017 (SEM-1) products No. of HH utilizing 15,743 18,392 20,552 HH using Bio-fort beans 7851 9584 2975  products No. of HH utilizing15,743 18,392 20,552HH using Bio-fort beans7851 9584 2975 No. of men, women & children accessing processed HH using Bio fortified varieties 2015-2017 No. of men, women & children accessing processedHH using Bio fortified varieties 2015-2017 products 2015-2017  12,000    products 2015-201712,000 450,000        450,000 400,000    10,000    400,00010,000 300,000 350,000    8,000    300,000 350,0008,000 250,000    6,000    250,0006,000 200,000        200,000 150,000    4,000    150,0004,000 50,000 100,000    2,000    50,000 100,0002,000 0 2015 2016 2017 0 2015 2016 2017 02015201620170201520162017 beneficiaries of processed products 156,059 378,483 405,375 HH using Bio fortified varieties 7,851 9,584 2,975 beneficiaries of processed products156,059378,483405,375HH using Bio fortified varieties7,8519,5842,975 Phase Target 2,000,000  Phase Target  280,000  Phase Target2,000,000Phase Target280,000 Milestone Status 939,917  Milestone Status  20,410  Milestone Status939,917Milestone Status20,410 Achievement (%) 47%   Achievement (%)  7.3%  Achievement (%)47%Achievement (%)7.3%  "},{"text":"Volumes of improved dry bean varieties traded disaggregated by gender-> 50% volume sales Project Status Summary-at the level of immediate outcome Indicators at immediate outcome  Indicators at immediate outcome Target Target Milestone Status Milestone Status % Achievement % Achievement Indicators at immediate outcomeTarget TargetMilestone Status Milestone Status% Achievement % Achievement Number of households utilizing bio fortified Yield per Hectare 280,000 750 kg/ha 20,410 7.3% Number of households utilizing bio fortified Yield per Hectare280,000 750 kg/ha20,4107.3% Number of women and youth accessing labor saving technologies Area occupied by climbing beans under bush- 5,000 > 20% -  -  Number of women and youth accessing labor saving technologies Area occupied by climbing beans under bush-5,000 > 20%-- Number of households accessing climbing bean varieties in Burundi Number of households utilizing bio fortified varieties- 300,000 280,000 - 20,410 - 7.3% Number of households accessing climbing bean varieties in Burundi Number of households utilizing bio fortified varieties-300,000 280,000-20,410-7.3% Number of men, women & children utilizing bean based processed 2,000,000 939,917 47% Number of men, women & children utilizing bean based processed2,000,000939,91747% products Number of men, women & children utilizing bean based processed 2,000,000  939,917  47% products Number of men, women & children utilizing bean based processed2,000,000939,91747% No of households (50% represented by women) accessing bean products- 750,000 70,889 9.5% No of households (50% represented by women) accessing bean products-750,00070,8899.5% varieties & ICM technologies Volumes of improved dry bean varieties traded disaggregated by > 50% volume     varieties & ICM technologies Volumes of improved dry bean varieties traded disaggregated by> 50% volume Number of households selling to profitable markets gender 250,000 sales 135,220 55.1% Number of households selling to profitable markets gender250,000 sales135,22055.1% Number of consumers (HH) accessing processed products 100,000 32,768 32.8% Number of consumers (HH) accessing processed products100,00032,76832.8% Number of people accessing information 50,000 564,589   Number of people accessing information50,000564,589  "},{"text":"Project Status Summary -at the level of intermediate outcome Ultimate Outcome Targets -(2015-2019)  Outcome Indicator   Targets Outcome IndicatorTargets  2015 2016 2017 2019 2015201620172019  baseline   baseline % change in the proportion of households facing -   5% % change in the proportion of households facing-5% food insecurity    food insecurity % change in individual dietary diversity score -   5% % change in individual dietary diversity score-5% (IDDS) in the target domain    (IDDS) in the target domain % change in men and women headed -   10% % change in men and women headed-10% households    households Change in nutritional status of target group -   5% Change in nutritional status of target group-5% (women, infants, school going children) in the    (women, infants, school going children) in the target domain    target domain  "}],"sieverID":"ead96efe-e03a-4dde-8689-4f74bbf6ffe9","abstract":""}

data/part_3/05d776ba1883b1dc0d6005d1c7321ee0.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05d776ba1883b1dc0d6005d1c7321ee0","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d66d7c8d-92e2-4fb7-8f96-097508217e8d/retrieve"},"pageCount":21,"title":"","keywords":[".. -.. --_... -\"'-\"-'-'--.... '!\"'...... \",,",",,/\"--","Et) In .. \"..U .... !Mthu .. of TropiCilI AgrkuUur. (IITA ) . ....\"'-.. ..-_ .. I ~ 'netttut In\",MUon .. cfAgrkuU .... T'ope.~ (UTA ) A.-' ' ' ' !' ' Indtulo Inlem.cI_'d. \"gtkultur. TropicaJ ( IITA ) : 't\"', r:J' >'fa'(~ ... . --. \"!t.v'E. \"!N:r~:,:,~ . . ' ~ \"\" / \\,-/',,-1\"-\"'/'\" i.\\~"],"chapters":[{"head":"Guides de recherche de I'IITA","index":1,"paragraphs":[{"index":1,"size":53,"text":"Les guides de recherche de I'IITA intorment et guident les chercheurs, techniciens, vulgarisateurs et educateurs engages dans des activites de recherche et de tormation essentielles pour Ie developpement agricole. lis peuvent etre utilises pour la recherche et la tormation et sont periodiquement mis a jour atin de relleter I'evolution de la connaissance scientitique."},{"index":2,"size":25,"text":"L'IITA autorise la reproduction de ce document a des fins non lucratives. Pour toute reproduction de nature commerciale, contacter Ie Service des publications de I'IITA."}]},{"head":"Texte","index":2,"paragraphs":[{"index":1,"size":8,"text":"Kehinde Jaiyeoba Nancy Jadu Cheikh Dia Rainer Zachmann"},{"index":2,"size":41,"text":"Mise en page Traduction de I'anglais Coordinalion Claassen, S.L. 1993. Travail minimum mecanise el culture sans labour en slalion experimer.lale. Guide de recherche de I'!ITA No. 11. Programme de la formalion, Inslilul internalional d'agriculture Iropicale (IITA), Ibadan. Nigeria. , 9 p."},{"index":3,"size":17,"text":"Guide de recherche de I'UTA No. 11 Travail minimum mecanise et culture sans labour en station experimentale"},{"index":4,"size":10,"text":"Objectif. Ce guide a pour objectif de vous permettre :"},{"index":5,"size":7,"text":"• de discuter des syst.i!mes de labour;"},{"index":6,"size":8,"text":"• de discuter des inconvenients du labour c1assique;"},{"index":7,"size":6,"text":"• de decrire Ie travail minimum;"},{"index":8,"size":8,"text":"• de decrire les systemes de non labour;"},{"index":9,"size":24,"text":"• de presenter les avantages et inconvenients des sys• t.i!mes de travail minimum/non labour; • d'appliquer Ie semis direct avec travail minimum du sol."},{"index":10,"size":2,"text":"Materiel necessaire"},{"index":11,"size":5,"text":"• Semoirs de non labour."},{"index":12,"size":12,"text":"• Diapositives sur les techniques de culture classique et de travail minimum."},{"index":13,"size":34,"text":"Travaw: pratiques • la production culturale ne depend pas de la preparation d'un \"champ propre\" (c'est-il-dire I' absence de residus culturaux); • Ie sol devrait, autant que possible, faire I'objet d'un minimum de perturbation."},{"index":14,"size":6,"text":"Les pratiques de travail minimum comprennent:"},{"index":15,"size":64,"text":"• Ie maintien des residus culturaux en surface atin de conserver I'humidite et de permettre la formation des matieres organiques du sol; • la reduction du nombre de passages dans Ie champ; • la suppression de la phase de pre-labour; • Ie passage, une fois (au lieu de plusieurs) des instruments de labour tels les pulveriseurs iI disques ou les herses a dents flexibles;"},{"index":16,"size":28,"text":"• Ie labour en ban des pour Ie semis en laissant les residus dans I'espace entre les rangs; • I'utilisation accrue d'herbicides afin de remplacer I'usage d'un cultivateur."},{"index":17,"size":14,"text":"Non labour. Les systemes de non labour peuvent etre consideres de deux manieres :"},{"index":18,"size":25,"text":"• en tant que Ie contraire des systemes de labour classique et ; • en tant que Ie plus radical des systemes de travail minimum."},{"index":19,"size":35,"text":"Le non labour est conforme aux principes du travail minimum compte tenu de la reduction du labour en une seule operation : I' ouverture de la terre pour introduire la graine au moment du semis."},{"index":20,"size":97,"text":"Le labour classique e&t de moins en moins utilise a l'echelle mondiale. Dans les pays developpes a c1imat tempere (surtout aux Etats Unis), les agriculteurs tirent davantage de revenus de leurs systemes de production en reduisant les couts de main-d'reuvre et de l'energie grace au non labour. Dans les pays en developpement a climat tropical, (par exemple en Mrique de l'Ouest), les chercheurs et les exploitants agricoles adoptent les systemes de labour reduit et de non labour en reponse ala fertiliW limitee des couches superficielles peu profondes qui sont facilement detruites par Ie. operations de labour classique."},{"index":21,"size":5,"text":"2 Inconvenient9 du labour classique"},{"index":22,"size":47,"text":"Le labour classique n ecessite plusieurs passages d'\"ne variete d'equipements de retourn ement et de pulverisation du sol dan s un champ: charrue a soc, pu lveriseur a disques, h e rse a dents n exibl es, etc. Ces operations de labour c1assique pTlisentent plusieurs inconvenients :"},{"index":23,"size":12,"text":"• elles produi sent un sol fin predispose a r erosion ;"},{"index":24,"size":21,"text":"• elles necessitent un equipe ment couteux et entrainent une forte consommation de carburant; • elles contribuent au compactage du sol."},{"index":25,"size":99,"text":"Avec Ie labour classique, les methodes de preparation de la terre perm ettent un retourn e ment de la terre et I'enfouissement de toute vegetation en surface et de tout debris vegetal. La terre est generalement preparee en efTectuant un labour iI I'aide d'une charrue a soc, suivi d'une ou davantage d'operations de labour secondaires afin de prepa rer Ie lit de semence ou d'incorporer des h erbicides ou autres produits chimiques da ns Ie sol. Un. terre bien travaillee est exposee Ii I'erosio n sa ns la protection fournie par les debris vegetaux, surtout en debut de campagne."},{"index":26,"size":37,"text":"Les cultures annuelles qui sont plan tees au debut de la saison des pluies fournissent une couverture vegetale en debut de saison iI cause de la petite taille des plantes pendant les etapes initiales de leur croissance."},{"index":27,"size":63,"text":"Les systemes de travail minimum assuren!. :a protection requise du sol en conservant les debris vegetaux des cultures precedentes. Ces debris constituent un paillis qui reduit I'evaporation , \\'impact des gouttes de pluie, et Ie ruissellement. Avec Ie travail minimum, ces residus sont maintenus dans Ie champ afin de Ie proteger contre I'erosion eolienne et hydrique jusqu'il la plantation de la culture suivante."},{"index":28,"size":62,"text":"3 Systemes de travail minimum du sol L'amelioration de la conception des machin es ainsi que la disponibilite de meilleurs herbicides permettent actuellement la production de plusieurs cultures conformement aux systkmes de travail minimum ou de non labour. Ces demiers laissent des debris vegetaux sur la s urface du sol ce qui permet de reduire I'erosion et de conserver I'humidite du sol."},{"index":29,"size":20,"text":"Travail minimu m_ La difference entre les operations de travail minimum et Ie labour classique se presente comme suit :"},{"index":30,"size":7,"text":"• suppression totale des operations de pre-labour;"},{"index":31,"size":35,"text":"• reduction des operations de labour. Par exemple, on utilise une sous-soleuse ou un pulveriseur a disques pour ameublir Ie sol avant la plantation. Ceci peut etre la seule operation de labour avant Ie semis;"},{"index":32,"size":23,"text":"• reduction aussi du travail secondaire; souvent un seul passage avec un pulveriseur il di sques ou une herse il dents flexibles suffit;"},{"index":33,"size":63,"text":"• utilisation des herbicides pour Ie desherbage (par exemple un herbicide de pre-levee applique pendant la plantation et d'autres herbicides appliques il n'i mporte quel moment de la croissance de la culture), alors que les systkmes classiques reposent sur I'utilisation de tracteurs, de la traction animale, ou de la main-d'reuVTe pour cultiver la terre au tour des plantes en vue du traitement herbicide."},{"index":34,"size":47,"text":"Labour en ban des_ Le labour en bandes est un systeme de travail minimum dans lequel seule une ban de large de .10-20 cm de la couche superficielle doit Hre labouree afin d'y planter les semences. Les etapes du labour en ban des sont les suivantes :"},{"index":35,"size":12,"text":"• Les semoirs mecaniques de non labour comportent quelques caracteristiques speciales :"},{"index":36,"size":21,"text":"• ils sont plus lourds que les semoirs c1assiques; aussi ne peuvent-ils pas penHrer dans Ie lit de semence non prepare;"},{"index":37,"size":70,"text":"• ils sont munis de coutres speciaux permettant de trancher les n\\sidus en surface. Les coutres droits canneJes permettent la preparation d'un lit de semence d'une largeur de 7 em et d'une profondeur de 10 a 13 cm environ , alors qu'avec des coutres circulaires il est possible d'obtenir un lit de semence d'une largeur de 2 a 4 em et d'une profondeur de 10 a 13 em environ ;"},{"index":38,"size":13,"text":"• leurs coutres sont munis de ressorts de compression pour faeiliter la penetration;"},{"index":39,"size":13,"text":"• leurs coutres peuvent etre regles afin d'obtenir Ie degre de labour souhaite;"},{"index":40,"size":16,"text":"• ils sont munis de disques jumeJes permettant d'ouvrir Ie sol et de deposer la graine;"},{"index":41,"size":19,"text":"• ils sont equipes de roues plombeuses qui ferment les sillons de semis et tassent Ie lit de semence."},{"index":42,"size":55,"text":"Les semoirs de non labour sont de plus en plus utilises pour les cultures doubles. eela permet de reduire Ie temps entre la recolte et la plantation et assure ainsi une saison culturale optimale '\" la deuxieme culture. En outre cela reduit la peTta en humidite du sol par evaporation causee par Ie labour classique."},{"index":43,"size":37,"text":"II convient de reconnoitre que Ie semoir mecanique de non labour est un investissement substantieJ. Lorsqu'il fait defaut, deux solutions de rechange s'offrent aux stations experimentales : Auantages des syst.emes de travail minimum ou de nonlabour :"},{"index":44,"size":16,"text":"• Moin s d'energie et de main -d'reuVTe sont requises pour Ie labour et la plantation."},{"index":45,"size":15,"text":"• L'energi e et la main-d'rellvre sont reduites ptnda nt I'ensemble du processus de production."},{"index":46,"size":7,"text":"• Reduction des besoins en machines agricoles."},{"index":47,"size":22,"text":"• Reduction du ruissellement; cela comporte deux avantages : plus grande disponibilite en eau pour la culture et moins d'erosion du sol."},{"index":48,"size":16,"text":"• Les rendements culturaux sont superieurs ou egaux il ceux obtenus en syst.eme de labour c1assique."},{"index":49,"size":58,"text":"• Les peri odes de semis sont plus souples. Le semis peut litre possible aussiwt apres une pluie et iI n'est pas necessaire d'attendre la realisation des operations de labour. Dan s des contextes de culture double( mals suivi de nieW, par exemple), la recolte, Ie debroussaillement, la pulverisation et Ie semis peuvent avoir lieu en quelques jours."},{"index":50,"size":10,"text":"Inconvenients des systemes de travail minimum et de non labour:"},{"index":51,"size":38,"text":"• Un equipement de semis specialise est requis, bien qu'iJ existe d'autres options, it savair Ie travail manuel et les semoirs c1assiques modifies. Cela peut endommager Ie semoir si Ie semis s' effectue a une vitesse trop elevee."},{"index":52,"size":20,"text":"• Si Ie sol est dur a cause d'un manque de pluie, Ie semoir peut ne pas pouvoir Ie penetrer."},{"index":53,"size":15,"text":"• Parfois il est difficile de recouvrir la semence dans un contexte de non labour."},{"index":54,"size":20,"text":"• L'engrais est applique en surface et n'est pas in• corpore. Une forte pluie aussitOt apres son application peut l'emporter."},{"index":55,"size":12,"text":"6 Etapes de non labOur et de labour en bandes du maTs"},{"index":56,"size":33,"text":"• Environ 10 jours avant plantation, appliquer un herbicide non selectif par exemple du paraquat, 5 J/ha pour les adventices latifoJiees, ou du Round-up, 5 J/ha pour les adventices perennes et les graminees."},{"index":57,"size":22,"text":"• Repandre II la volee un engrais de demarrage sur la surface: 200 kg/ha de 15 : 15 : (NPK) avant plantation."},{"index":58,"size":14,"text":"• Faucher II l'aide d'un gyrobroyeur apres avoir elimine la vegetation avec un herbicide."},{"index":59,"size":34,"text":"• En systeme d~ non labour, planter la semence dans Ie lit de semence non prepare en utili sant un semoir de non labour. Densite de semis suggeree pour Ie mals : 50-55.000 piedslha."},{"index":60,"size":23,"text":"• En systeme de labour en bandes, utiliser un rotovator prepare pour ce type de travail, ensuite semer II l'aide d'une canne planteuse."},{"index":61,"size":30,"text":"• 1 ou 2 jours apres la plantation, appliquer un deuxieme traitement de paraquat, II raison de 5 J/ha plus un herbicide de pre-levee, par exemple du primextra, 5 J/ha."},{"index":62,"size":28,"text":"• Si des problemes d'adventices se po sent apres la levee de la culture, utiliser un pulverisateur lidos et un boucJier pour appliquer du paraquat entre les lignes."},{"index":63,"size":10,"text":"Veiller II ne pas appliquer directement l'herbicide sur les cultures."},{"index":64,"size":4,"text":"• Esperer qu'iJ pleuve. "}]}],"figures":[{"text":"• travail minimum , • non labour.  . \" .. . \" .. Questionnaire Les syslemes de labour sont classes selon Ie nombre Questionnaire Les syslemes de labour sont classes selon Ie nombre d'operations de travail du sol requis et l'equipement uti-1 Quelles sont les trois categories de systemes de la-lise. En general, les trois categories de systemes de la-bour courants ? bour suivantes sont actuellement utilisees : 2 Quelles sont les pratiques specifiques au labour clas-sique? vail minimum? en station experimentale 3 Quels sont les principes justifiant Ie recours au tra-Travail minimum mecanise et culture sans labour • labour classique, d'operations de travail du sol requis et l'equipement uti-1 Quelles sont les trois categories de systemes de la-lise. En general, les trois categories de systemes de la-bour courants ? bour suivantes sont actuellement utilisees : 2 Quelles sont les pratiques specifiques au labour clas-sique? vail minimum? en station experimentale 3 Quels sont les principes justifiant Ie recours au tra-Travail minimum mecanise et culture sans labour • labour classique, 4 Citer des exemples de pratiques de travail minimum? 4 Citer des exemples de pratiques de travail minimum? 5 Quel systeme de travail minimum estconsidere comme Labour classique. II comprend Ie labour ain si que etant Ie plus radical? deux i1 cinq <!tapes secondaires du travail. Le nombre 6 Quelles sont les operations de non labour? d'operations i1 realiser dans Ie labour classique vari e se-7 Quels sont les inconvenients des operations de labour Ion Ie type de cultures et de zones. Ces etapes sont les c1assique 1 Systemes de labour 8 Pourquoi les cultures annuelles produisent-elles peu suivantes: 5 Quel systeme de travail minimum estconsidere comme Labour classique. II comprend Ie labour ain si que etant Ie plus radical? deux i1 cinq <!tapes secondaires du travail. Le nombre 6 Quelles sont les operations de non labour? d'operations i1 realiser dans Ie labour classique vari e se-7 Quels sont les inconvenients des operations de labour Ion Ie type de cultures et de zones. Ces etapes sont les c1assique 1 Systemes de labour 8 Pourquoi les cultures annuelles produisent-elles peu suivantes: de couverture vegetale precoce ? 2 Inconvenients du labour classique • operations de pre labour (par exemple Ie debrous• 9 Comment peut-on proteger Ie sol au moment de plan-3 Systemes de travail minimum du sol saillement ou Ie discage des residus vegetaux); ter les cultures an n ue II es ? 10 Quelle est I'action protectrice des dechets vegetaux sur Ie sol? 4 Systemes de nOD labour • labour en vue de la pulverisation du sol; 5 Avantages et inconvenie. nts • billonnage ou labour en plates-bandes pour don-6 Etapes de non labour et de labour en bandes du ner une forme au sol; de couverture vegetale precoce ? 2 Inconvenients du labour classique • operations de pre labour (par exemple Ie debrous• 9 Comment peut-on proteger Ie sol au moment de plan-3 Systemes de travail minimum du sol saillement ou Ie discage des residus vegetaux); ter les cultures an n ue II es ? 10 Quelle est I'action protectrice des dechets vegetaux sur Ie sol? 4 Systemes de nOD labour • labour en vue de la pulverisation du sol; 5 Avantages et inconvenie. nts • billonnage ou labour en plates-bandes pour don-6 Etapes de non labour et de labour en bandes du ner une forme au sol; 11 Quelle est la difference entre Ie labour minimum et Ie labour classique ? mals • utilisation de pulveriseurs i1 disques ou de culti-7 Bibliographie vateurs 11 Quelle est la difference entre Ie labour minimum et Ie labour classique ? mals • utilisation de pulveriseurs i1 disques ou de culti-7 Bibliographie vateurs 12 Comment definit-on Ie terme \"labour en bandes\" ? • utilisation de herses i1 dents; 13 Quelles sont les differentes etapes des operations de • utilisation de cultivateurs i1 rang unique ou mul- 12 Comment definit-on Ie terme \"labour en bandes\" ? • utilisation de herses i1 dents; 13 Quelles sont les differentes etapes des operations de • utilisation de cultivateurs i1 rang unique ou mul- labour en ban des? tiple (selon Ie type de cultures, de zones, et de labour en ban des? tiple (selon Ie type de cultures, de zones, et de 14 Pour que lies cultures les methodes de plantation de problemes d'adventices). 14 Pour que lies cultures les methodes de plantation de problemes d'adventices). non labour sont couramment utili sees ? non labour sont couramment utili sees ? 15 Dans quelle mesure Ie non labour est-i1 avantageux Travail minimum. Le travail ,,'l1D1mum (egalement 15 Dans quelle mesure Ie non labour est-i1 avantageux Travail minimum. Le travail ,,'l1D1mum (egalement pour Ie paysan ? appeIe labour optimum, reduit ou economique) repose pour Ie paysan ? appeIe labour optimum, reduit ou economique) repose 16 Quelles sont les limites de la plantation sans labour Resume. Compare au labour classiQue, Ie travail mini-sur plusieurs principes : 16 Quelles sont les limites de la plantation sans labour Resume. Compare au labour classiQue, Ie travail mini-sur plusieurs principes : comparee au labour classique dans un contexte de mum com porte plusieurs avantages. II est particuliere- comparee au labour classique dans un contexte de mum com porte plusieurs avantages. II est particuliere- culture en pente ? ment avantageux en zone tropicale oil Ie sol est facile-• l'economie d'energie et de main-d'reuvre peut per- culture en pente ? ment avantageux en zone tropicale oil Ie sol est facile-• l'economie d'energie et de main-d'reuvre peut per- 17 Quelles sont les caracteristiques specifiques aux se-ment appauvri par les operations de labour c1assiQue. Le mettre un accroissement des revenus; 17 Quelles sont les caracteristiques specifiques aux se-ment appauvri par les operations de labour c1assiQue. Le mettre un accroissement des revenus; travail minim'lm, Ie labour en bandes et Ie non labour • Ie labour classique reduit l'humidite du sol et travail minim'lm, Ie labour en bandes et Ie non labour • Ie labour classique reduit l'humidite du sol et permettent egalement une economie d'energie et de frais contribue i1 son erosion; de main-d'\",uvre. • l'homogeneisation du sol n'est pas necessaire; permettent egalement une economie d'energie et de frais contribue i1 son erosion; de main-d'\",uvre. • l'homogeneisation du sol n'est pas necessaire;  "},{"text":" syst.emes de travail minimum et de non labour comportent un certain nombre d'avantages et d'inconvenients. Ch aque cadre agricole et chaque agriculteur deVTont identifi er, en consultation avec les autres, Ie systeme Ie plus approprie illeur realite. Les syst.emcs de travail minimum ou de non labour peuvent ne pas litre indiques dans tous les cas. Une bonn e gestion comprend Ie choix d'un syst.eme pour des conditions pedologiques et cl imatiq ues particulieres ai n si que la se lection et I'utilisation d'un equipement approprie. residus de culture, pulveriser des herbicides pour residus de culture, pulveriser des herbicides pour eliminer toute biomasse, et semer Ii la main sans eliminer toute biomasse, et semer Ii la main sans aucun labour. Dans les pays oU la main-d'reuvre aucun labour. Dans les pays oU la main-d'reuvre ne co ute pas cher, cette methode peut s'averer ne co ute pas cher, cette methode peut s'averer pratique. pratique. • Adapter les semoirs classiques. Malgre • Adapter les semoirs classiques. Malgre i'insuffisance de la recherche dans Ie domaine, i'insuffisance de la recherche dans Ie domaine, les semoirs mecanises courants, montes sur tracteur ou a traction animale , peuvent Hre les semoirs mecanises courants, montes sur tracteur ou a traction animale , peuvent Hre modifies pour Ie semis direct en sols non travail- modifies pour Ie semis direct en sols non travail- les. On peut leur adjoindre des coutres droits et les. On peut leur adjoindre des coutres droits et appliquer une pression supplementaire alin de appliquer une pression supplementaire alin de leur faciliter la penetration dans Ie sol. Une leur faciliter la penetration dans Ie sol. Une pression est aussi necessaire pour permettre pression est aussi necessaire pour permettre aux roues plombeuses de bien refermer les sil- aux roues plombeuses de bien refermer les sil- Ions. II est necessaire d'approfondir les discus- Ions. II est necessaire d'approfondir les discus- sions et experiences dans ce domaine. sions et experiences dans ce domaine. 14 14  "},{"text":"on retrQllVe encore des souches au niveau du sol.  • Au lieu d' etre retournes par Ie labour, les debris • Au lieu d' etre retournes par Ie labour, les debris vegetaux laisses en surface peuvent creer davan- vegetaux laisses en surface peuvent creer davan- tage de problemes d'insectes et par consequent tage de problemes d'insectes et par consequent necessiter davantage d'insecticide. necessiter davantage d'insecticide. • Les champs paraissent negliges aux yeux d'une personne habituee a les voir laboures. • Les champs paraissent negliges aux yeux d'une personne habituee a les voir laboures. • Apres defrichement a l'aide d'une lame forestiere, • Apres defrichement a l'aide d'une lame forestiere, • Les herbicides tels Ie paraquat doivent Hre sau- • Les herbicides tels Ie paraquat doivent Hre sau- vent utilises et de maniere precise. L'application vent utilises et de maniere precise. L'application d'un herbicide non selectif est fondamentale d'un herbicide non selectif est fondamentale puisqu'aucun labour ou travail n'est effectue pour puisqu'aucun labour ou travail n'est effectue pour lutter contre les adventices et les graminees. lutter contre les adventices et les graminees. Cela augmente les depenses it tel point que les Cela augmente les depenses it tel point que les herbicides peuvent compromettre les economies herbicides peuvent compromettre les economies de main-d'reuvre et de carburant. La dose et Ie de main-d'reuvre et de carburant. La dose et Ie moment de I'application sont fondamentaux. La moment de I'application sont fondamentaux. La premiere application doit Hre effectuee assez tot premiere application doit Hre effectuee assez tot pour permettre la germination de nouvelles ad- pour permettre la germination de nouvelles ad- ventices avant semis. La deuxieme application ventices avant semis. La deuxieme application de paraquat doit cOlncider avec celie des herbi- de paraquat doit cOlncider avec celie des herbi- cides de pre-levee aussitot apres Ie semis. cides de pre-levee aussitot apres Ie semis. • Les adventices peuvent persister apres la levee • Les adventices peuvent persister apres la levee de la culture et la pulverisation de paraquat (ou de la culture et la pulverisation de paraquat (ou d'un autre produit), peut s'averer necessaire. Le d'un autre produit), peut s'averer necessaire. Le paraquat est dote d'une DL 50 faible et son appli- paraquat est dote d'une DL 50 faible et son appli- cation est dangereuse. cation est dangereuse. • L'application des herbicides et des engrais est • L'application des herbicides et des engrais est difficile it cause de rabsence de rangs ou de lignes a suivre. difficile it cause de rabsence de rangs ou de lignes a suivre.  "},{"text":" Int.\",.'''''' lnsIifute 01 Trop;c.J Agrlcu.ure (IITA) •• an 'ntema-tionM agriaJ'uraJ ~ c.nter in 'M Consu'III;~ GI'I)(,f) on Intema-t~1 Agrlculrutal RHeatch (CGIAR), which .. an cuocialion 01 about 50 countries, 'nt.\"..,iona/ and regional org.n;zalions, and privata foundelioM. IfTA ..... to ~ -,gricuhuraJ ptOduClion in a ausleir!able \"y, in ~ to improve ,,,. nulritionM stellA end _II-being 01 peopM in 'rop;c.J ~~ Alrica. To acIW .... this goal, IITA conducts r....-dt and ,,.;,,;,,g, provides lnIonnatJon. ooM«:t. and ochenges SIfInnpIastn, end ~ trensI .. d technology, in pM1lHKShip with Alrlcan neIit:YwI agricullurel ,....,-ch end tJew J 'opuent progtatns.. Institulo Inl~ de Agricu.ura Trop;c.J (IITA) • urn centro intemacionaJ de \"wtII;g.~ agrictJle ,.,,~ eo Gn.po Consullivo para InV8sti~ Agricola In,ernacionaI (GCIAI), ume \"•ori~.o de 0IKC8 » 50 pai!Ies, ~ inlBm«ioneia • regiolwis e Iunda¢B. privatiM. 0 IITA procure .\"\".\",.. duretlflbtent • • prod~ agriCOla para melhorw a .,.imenfa,*, • 0 bem-est.ar du popule¢fn de Alne. tropical 80 suJ do s.t.t._ P ... ~ .... O!bjBf;vo, 0 IITA conduz ectividade. de .m..st~ a lIeNmenIo, lomeoa inlonna¢e', reLine a troca malerial gen4tico e 1.vot'fH» a 1ransI~ de lecnoIogia en 00\" bora~o com oa program_ n.aciotJm aJrJc.n05 • inv.,'ig8~O a dBsenvoMmiento. InlemarionaJ Inslil:ule of Tropical Agriculture (lITA ) InlemarionaJ Inslil:ule of Tropical Agriculture(lITA ) Institut international d'agrtculture tropeale (lITA ) Institut international d'agrtculture tropeale(lITA ) Instilulo IntemacionaJ de Agricullura TropicaJ (lITA ) Instilulo IntemacionaJ de Agricullura TropicaJ(lITA ) \"\"'  \"\"'  "}],"sieverID":"5823be75-06d8-4f90-9bc6-2e07c1f98e86","abstract":""}

data/part_3/05e7d4c01a1b7b134f816e202a963f28.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05e7d4c01a1b7b134f816e202a963f28","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7947d48c-5cf1-4164-8c61-fa276d658463/retrieve"},"pageCount":11,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":51,"text":"(ii) A field for which no value is available should be left empty (e.g. Elevation). If data are exchanged in ASCII format, a field with a missing numeric value should be left empty. If data are exchanged in a database format, missing numeric values should be represented by generic NULL values."},{"index":2,"size":40,"text":"(iii) Dates are recorded as YYYYMMDD. If the month or day are missing, this should be indicated with hyphens or '00' [double zero]. If both (month and day) are missing, two double zeros are needed (e.g. 1975----, 19750000; 197506--, 19750600)."},{"index":3,"size":34,"text":"(iv) Country names: Three letter ISO codes are used for countries. The ISO 3166-1: Code List and the Country or the Country or area numerical codes added or changed are available online at: http://unstats.un.org/unsd/methods/m49/m49alpha.htm."}]},{"head":"Note:","index":2,"paragraphs":[{"index":1,"size":10,"text":"The list of obsolete codes can be found at: http://en.wikipedia.org/wiki/ISO_3166-1_alpha-3#Reserved_code_elements."},{"index":2,"size":25,"text":"(v) For institutes, the codes from FAO WIEWS should be used. The current set of Institute Codes is available from the FAO WIEWS site (http://www.fao.org/wiews)."}]},{"head":"•","index":3,"paragraphs":[{"index":1,"size":25,"text":"If new Institute codes are required, they can be generated on line by FAO National Focal points (http://www.fao.org/agriculture/crops/thematic-sitemap/theme/seedspgr/gpa/national-focal-points/en/) or they can be requested to: [email protected]."}]},{"head":"•","index":4,"paragraphs":[{"index":1,"size":29,"text":"For institutes that no longer exist, or that were not assigned an FAO WIEWS institute code, please provide full details in descriptors 4. 1, 4.1.1, 18.1, 22.1 and 25.1."}]},{"head":"MULTI-CROP PASSPORT DESCRIPTORS","index":5,"paragraphs":[]},{"head":"0.","index":6,"paragraphs":[{"index":1,"size":38,"text":"Persistent unique identifier (PUID) Any persistent, unique identifier assigned to the accession so it can be unambiguously referenced at the global level and the information associated with it harvested through automated means. Report one PUID for each accession."},{"index":2,"size":84,"text":"The Secretariat of the International Treaty on Plant Genetic Resources for Food and Agriculture (PGRFA) is facilitating the assignment of a persistent unique identifier (PUID), in the form of a DOI, to PGRFA at the accession level (http://www.planttreaty.org/doi). Genebanks not applying a true PUID to their accessions should use, and request recipients to use, the concatenation of INSTCODE, ACCENUM, and GENUS as a globally unique identifier similar in most respects to the PUID whenever they exchange information on accessions with third parties (e.g. NOR017:NGB17773:ALLIUM)."}]},{"head":"1.","index":7,"paragraphs":[{"index":1,"size":67,"text":"Institute code (INSTCODE) FAO WIEWS code of the institute where the accession is maintained. The codes consist of the 3-letter ISO 3166 country code of the country where the institute is located plus a number (e.g. COL001). The current set of institute codes is available from http://www.fao.org/wiews. For those institutes not yet having an FAO Code, or for those with 'obsolete' codes, see 'Common formatting rules (v)'."}]},{"head":"2.","index":8,"paragraphs":[{"index":1,"size":28,"text":"Accession number (ACCENUMB) This is the unique identifier for accessions within a genebank, and is assigned when a sample is entered into the genebank collection (e.g. 'PI 113869')."}]},{"head":"3.","index":9,"paragraphs":[{"index":1,"size":39,"text":"Collecting number (COLLNUMB) Original identifier assigned by the collector(s) of the sample, normally composed of the name or initials of the collector(s) followed by a number (e.g. 'FM9909'). This identifier is essential for identifying duplicates held in different collections."}]},{"head":"4.","index":10,"paragraphs":[{"index":1,"size":48,"text":"Collecting institute code (COLLCODE) FAO WIEWS code of the institute collecting the sample. If the holding institute has collected the material, the collecting institute code (COLLCODE) should be the same as the holding institute code (INSTCODE). Follows INSTCODE standard. Multiple values are separated by a semicolon without space."}]},{"head":"Collecting institute name","index":11,"paragraphs":[{"index":1,"size":39,"text":"(COLLNAME) Name of the institute collecting the sample. This descriptor should be used only if COLLCODE cannot be filled because the FAO WIEWS code for this institute is not available. Multiple values are separated by a semicolon without space."}]},{"head":"Collecting institute address","index":12,"paragraphs":[{"index":1,"size":39,"text":"(COLLINSTADDRESS) Address of the institute collecting the sample. This descriptor should be used only if COLLCODE cannot be filled since the FAO WIEWS code for this institute is not available. Multiple values are separated by a semicolon without space."}]},{"head":"Collecting mission identifier (COLLMISSID)","index":13,"paragraphs":[{"index":1,"size":16,"text":"Identifier of the collecting mission used by the Collecting Institute (4 or 4.1) (e.g. 'CIATFOR-052', 'CN426')."}]},{"head":"5.","index":14,"paragraphs":[{"index":1,"size":10,"text":"Genus (GENUS) Genus name for taxon. Initial uppercase letter required."}]},{"head":"6.","index":15,"paragraphs":[{"index":1,"size":19,"text":"Species (SPECIES) Specific epithet portion of the scientific name in lowercase letters. Only the following abbreviation is allowed: 'sp.'"}]},{"head":"7.","index":16,"paragraphs":[{"index":1,"size":10,"text":"Species authority (SPAUTHOR) Provide the authority for the species name."}]},{"head":"8.","index":17,"paragraphs":[{"index":1,"size":33,"text":"Subtaxon (SUBTAXA) Subtaxon can be used to store any additional taxonomic identifier. The following abbreviations are allowed: 'subsp.' (for subspecies); 'convar.' (for convariety); 'var.' (for variety); 'f.' (for form); 'Group' (for 'cultivar group')."}]},{"head":"9.","index":18,"paragraphs":[{"index":1,"size":13,"text":"Subtaxon authority (SUBTAUTHOR) Provide the subtaxon authority at the most detailed taxonomic level."},{"index":2,"size":1,"text":"10. "}]},{"head":"Acquisition date [YYYYMMDD]","index":19,"paragraphs":[{"index":1,"size":37,"text":"(ACQDATE) Date on which the accession entered the collection where YYYY is the year, MM is the month and DD is the day. Missing data (MM or DD) should be indicated with hyphens or '00' [double zero]."}]},{"head":"Country of origin","index":20,"paragraphs":[{"index":1,"size":34,"text":"(ORIGCTY) 3-letter ISO 3166-1 code of the country in which the sample was originally collected (e.g. landrace, crop wild relative, farmers' variety), bred or selected (breeding lines, GMOs, segregating populations, hybrids, modern cultivars, etc.)."},{"index":2,"size":15,"text":"Note: Descriptors 14 to 16 below should be completed accordingly only if it was 'collected'."}]},{"head":"Location of collecting site","index":21,"paragraphs":[{"index":1,"size":47,"text":"(COLLSITE) Location information below the country level that describes where the accession was collected, preferable in English. This might include the distance in kilometres and direction from the nearest town, village or map grid reference point, (e.g. 7 km south of Curitiba in the state of Parana)."}]},{"head":"Geographical coordinates","index":22,"paragraphs":[{"index":1,"size":22,"text":"• For latitude and longitude descriptors, two alternative formats are proposed, but the one reported by the collecting mission should be used"},{"index":2,"size":40,"text":"• Latitude and longitude in decimal degree format with a precision of four decimal places corresponds to approximately 10 m at the Equator and describes the point-radius representation of the location, along with Geodetic datum and Coordinate uncertainty in metres."}]},{"head":"Note:","index":23,"paragraphs":[{"index":1,"size":60,"text":"The following two mutually exclusive formats can be used for latitude: 15.2 Latitude of collecting site (Degrees, Minutes, Seconds format) (LATITUDE) Degrees (2 digits) minutes (2 digits), and seconds (2 digits) followed by N (North) or S (South) (e.g. 103020S). Every missing digit (minutes or seconds) should be indicated with a hyphen. Leading zeros are required (e.g. 10----S; 011530N; 4531--S)."}]},{"head":"Note:","index":24,"paragraphs":[{"index":1,"size":49,"text":"The following two mutually exclusive formats can be used for longitude: (LONGITUDE) Degrees (3 digits), minutes (2 digits), and seconds (2 digits) followed by E (East) or W (West) (e.g. 0762510W). Every missing digit (minutes or seconds) should be indicated with a hyphen. Leading zeros are required (e.g. 076----W)."}]},{"head":"Coordinate uncertainty [m]","index":25,"paragraphs":[{"index":1,"size":17,"text":"(COORDUNCERT) Uncertainty associated with the coordinates in metres. Leave the value empty if the uncertainty is unknown."}]},{"head":"Coordinate datum (COORDDATUM)","index":26,"paragraphs":[{"index":1,"size":30,"text":"The geodetic datum or spatial reference system upon which the coordinates given in decimal latitude and decimal longitude are based (e.g. WGS84, ETRS89, NAD83). The GPS uses the WGS84 datum."}]},{"head":"Georeferencing method (GEOREFMETH)","index":27,"paragraphs":[{"index":1,"size":23,"text":"The georeferencing method used (GPS, determined from map, gazetteer, or estimated using software). Leave the value empty if georeferencing method is not known."}]},{"head":"Elevation of collecting site [masl]","index":28,"paragraphs":[{"index":1,"size":15,"text":"(ELEVATION) Elevation of collecting site expressed in metres above sea level. Negative values are allowed."}]},{"head":"Collecting date of sample [YYYYMMDD]","index":29,"paragraphs":[{"index":1,"size":34,"text":"(COLLDATE) Collecting date of the sample, where YYYY is the year, MM is the month and DD is the day. Missing data (MM or DD) should be indicated with hyphens or '00' [double zero]."}]},{"head":"Breeding institute code","index":30,"paragraphs":[{"index":1,"size":47,"text":"(BREDCODE) FAO WIEWS code of the institute that has bred the material. If the holding institute has bred the material, the breeding institute code (BREDCODE) should be the same as the holding institute code (INSTCODE). Follows INSTCODE standard. Multiple values are separated by a semicolon without space."}]},{"head":"Breeding institute name","index":31,"paragraphs":[{"index":1,"size":42,"text":"(BREDNAME) Name of the institute (or person) that bred the material. This descriptor should be used only if BREDCODE cannot be filled because the FAO WIEWS code for this institute is not available. Multiple names are separated by a semicolon without space."}]},{"head":"Biological status of accession (SAMPSTAT)","index":32,"paragraphs":[{"index":1,"size":28,"text":"The coding scheme proposed can be used at 3 different levels of detail: either by using the general codes (in boldface) such as 100, 200, 300, 400, or  "}]},{"head":"Ancestral data","index":33,"paragraphs":[{"index":1,"size":43,"text":"(ANCEST) Information about either pedigree or other description of ancestral information (e.g. parent variety in case of mutant or selection). For example a pedigree 'Hanna/7*Atlas//Turk/8*Atlas' or a description 'mutation found in Hanna', 'selection from Irene' or 'cross involving amongst others Hanna and Irene'."}]},{"head":"Collecting/acquisition source (COLLSRC)","index":34,"paragraphs":[{"index":1,"size":29,"text":"The coding scheme proposed can be used at 2 different levels of detail: either by using the general codes (in boldface) such as 10, 20, 30, 40, etc., or  "}]},{"head":"Remarks (REMARKS)","index":35,"paragraphs":[{"index":1,"size":49,"text":"The remarks field is used to add notes or to elaborate on descriptors with value 99 or 999 (= Other). Prefix remarks with the field name they refer to and a colon (:) without space (e.g. COLLSRC:riverside). Distinct remarks referring to different fields are separated by semicolons without space."}]},{"head":"Introduction","index":36,"paragraphs":[{"index":1,"size":22,"text":"Text related to this updated version was amended reflecting main changes, including addition of this historical list of changes, as an Annex."}]},{"head":"Common formatting rules","index":37,"paragraphs":[{"index":1,"size":19,"text":"• Explanation of coding schemes related to new descriptors is provided to assist in the computerized exchange of data."},{"index":2,"size":22,"text":"• Country names: New ISO Country codes Web link is provided, along with a Web link for obsolete codes (e.g. SUN, DDR)."},{"index":3,"size":32,"text":"• FAO WIEWS Institute codes: The Web link for the current set of institute codes has been updated. A link is provided to an electronic form for generating new institute codes online."},{"index":4,"size":28,"text":"• Missing data: For those descriptors related to 'Dates', missing data can be indicated with hyphens or '00'[double zero] to ensure consistent data transfer whatever system is used."},{"index":5,"size":36,"text":"• Latitude and longitude: Two formats (Latitude: DDMMSSH or +/-DD.DDDD; Longitude: DDDMMSSE/W or +/-DDD.DDDD) are allowed, but only one of the two coordinate formats should be used (the one that was reported by the collecting mission)."}]}],"figures":[{"text":"15. 1 Latitude of collecting site (Decimal degrees format) (DECLATITUDE) Latitude expressed in decimal degrees. Positive values are North of the Equator; negative values are South of the Equator (e.g. -44.6975). "},{"text":"15. 3 Longitude of collecting site (Decimal degrees format) (DECLONGITUDE) Longitude expressed in decimal degrees. Positive values are East of the Greenwich Meridian; negative values are West of the Greenwich Meridian (e.g. +120.9123). 15.4 Longitude of collecting site (Degrees, Minutes, Seconds format) "},{"text":" Common crop name (CROPNAME)Common name of the crop. Example: 'malting barley', 'macadamia', 'maïs'. 11. Accession name     (ACCENAME) 11. Accession name(ACCENAME) Either a registered or other designation given to the material received, other than the donor's Either a registered or other designation given to the material received, other than the donor's accession number (23) or collecting number (3). First letter uppercase. Multiple names are accession number (23) or collecting number (3). First letter uppercase. Multiple names are separated by a semicolon without space. Example: Accession name: separatedbyasemicolonwithoutspace.Example:Accessionname: Bogatyr;Symphony;Emma.      Bogatyr;Symphony;Emma.  "},{"text":" by using the more specific codes such as 110, 120, etc. 100) Wild 100) Wild 110) Natural 110) Natural 120) Semi-natural/wild 120) Semi-natural/wild 130) Semi-natural/sown 130) Semi-natural/sown 200) Weedy 200) Weedy 300) Traditional cultivar/landrace 300) Traditional cultivar/landrace 400) Breeding/research material 400) Breeding/research material 410) Breeder's line 410) Breeder's line 411) Synthetic population 411) Synthetic population 412) Hybrid 412) Hybrid 413) Founder stock/base population 413) Founder stock/base population 414) Inbred line (parent of hybrid cultivar) 414) Inbred line (parent of hybrid cultivar) 415) Segregating population 415) Segregating population 416) Clonal selection 416) Clonal selection 420) Genetic stock 420) Genetic stock 421) Mutant (e.g. induced/insertion mutants, tilling populations) 421) Mutant (e.g. induced/insertion mutants, tilling populations) 422) Cytogenetic stocks (e.g. chromosome addition/substitution, aneuploids, 422) Cytogenetic stocks (e.g. chromosome addition/substitution, aneuploids, amphiploids) amphiploids) 423) Other genetic stocks (e.g. mapping populations) 423) Other genetic stocks (e.g. mapping populations) 500) Advanced or improved cultivar (conventional breeding methods) 500) Advanced or improved cultivar (conventional breeding methods) 600) GMO (by genetic engineering) 600) GMO (by genetic engineering) 999) Other (Elaborate in REMARKS field) 999) Other (Elaborate in REMARKS field)  "},{"text":" by using the more specific codes, such as 11, 12, etc. Name of the donor institute (or person). This descriptor should be used only if DONORCODE cannot be filled because the FAO WIEWS code for this institute is not available. Any other identifiers known to exist in other collections for this accession. Use the following format: INSTCODE:ACCENUMB;INSTCODE:identifier;… INSTCODE and identifier are separated by a colon without space. Pairs of INSTCODE and identifier are separated by a semicolon without space. When the institute is not known, the identifier should be preceded by a colon. FAO WIEWS code of the institute(s) where a safety duplicate of the accession is maintained. Multiple values are separated by a semicolon without space. Follows INSTCODE standard. Name of the institute where a safety duplicate of the accession is maintained. Multiple values are separated by a semicolon without space. If germplasm is maintained under different types of storage, multiple choices are allowed, separated by a semicolon (e.g. 20;30). (Refer to FAO/IPGRI Genebank Standards 1994 for details on storage type.) The status of an accession with regards to the Multilateral System (MLS) of the International Treaty on Plant Genetic Resources for Food and Agriculture. Leave the value empty if the 26. Type of germplasm storage (STORAGE) 26. Type of germplasm storage(STORAGE) 10) Wild habitat 10) Seed collection 10) Wild habitat 10) Seed collection  11) Forest or woodland 11) Short term 11) Forest or woodland 11) Short term  12) Shrubland 12) Medium term 12) Shrubland 12) Medium term  13) Grassland 13) Long term 13) Grassland 13) Long term 14) Desert or tundra 20) Field collection 14) Desert or tundra 20) Field collection 15) Aquatic habitat 30) In vitro collection 15) Aquatic habitat 30) In vitro collection 20) Farm or cultivated habitat 40) Cryopreserved collection 20) Farm or cultivated habitat 40) Cryopreserved collection 21) Field 50) DNA collection 21) Field 50) DNA collection 22) Orchard 99) Other (elaborate in REMARKS field) 22) Orchard 99) Other (elaborate in REMARKS field) 23) Backyard, kitchen or home garden (urban, peri-urban or rural) 27. MLS status of the accession (MLSSTAT) 23) Backyard, kitchen or home garden (urban, peri-urban or rural) 27. MLS status of the accession(MLSSTAT)  24) Fallow land 24) Fallow land  25) Pasture 25) Pasture 26) Farm store status is not known 26) Farm store status is not known 0 27) Threshing floor No (not included) 027) Threshing floor No (not included) 1 28) Park Yes (included) 128) Park Yes (included) 30) Market or shop 99 Other (elaborate in REMARKS field, e.g. 'under development') 30) Market or shop 99 Other (elaborate in REMARKS field, e.g. 'under development') 40) Institute, Experimental station, Research organization, Genebank 40) Institute, Experimental station, Research organization, Genebank 50) Seed company 50) Seed company 60) Weedy, disturbed or ruderal habitat 60) Weedy, disturbed or ruderal habitat  61) Roadside 61) Roadside  62) Field margin 62) Field margin 99) Other (Elaborate in REMARKS field) 99) Other (Elaborate in REMARKS field) 22. Donor institute code (DONORCODE) 22. Donor institute code(DONORCODE) FAO WIEWS code of the donor institute. Follows INSTCODE standard. FAO WIEWS code of the donor institute. Follows INSTCODE standard. 22.1 Donor institute name (DONORNAME) 22.1 Donor institute name(DONORNAME) 23. Donor accession number (DONORNUMB) 23. Donor accession number(DONORNUMB) Identifier assigned to an accession by the donor. Follows ACCENUMB standard. Identifier assigned to an accession by the donor. Follows ACCENUMB standard. 24. Other identifiers associated with the accession (OTHERNUMB) 24. Other identifiers associated with the accession(OTHERNUMB) 25. Location of safety duplicates (DUPLSITE) 25. Location of safety duplicates(DUPLSITE) 25.1 Institute maintaining safety duplicates (DUPLINSTNAME) 25.1 Institute maintaining safety duplicates(DUPLINSTNAME)  "}],"sieverID":"63850545-0f31-438f-9c5e-753256fcda99","abstract":"This list of Multi-crop Passport Descriptors (MCPD V.2.1) is an update to MCPD V.2 which was released in 2012. The MCPD V.2 was a revision of the first FAO/IPGRI publication released in 2001, expanded to accommodate emerging needs, such as the broader use of GPS tools, or the implementation of the International Treaty on Plant Genetic Resources for Food and Agriculture's Multilateral System for access and benefit-sharing.The MCPD, developed jointly by Bioversity International (formerly IPGRI) and FAO, is a widely used international standard to facilitate germplasm passport information exchange. These descriptors are compatible with Bioversity's crop descriptor lists, with the descriptors used by the FAO World Information and Early Warning System (WIEWS) on plant genetic resources (PGR), and with the GENESYS global portal.For each multi-crop passport descriptor, a brief explanation of content, coding scheme and suggested fieldname are provided. Annex I provides the historical 'List of major changes' of the MCPD previous versions."}

data/part_3/06c78b22bc0617b30c02258a7d834327.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06c78b22bc0617b30c02258a7d834327","source":"gardian_index","url":"https://www.iwmi.cgiar.org/Publications/Books/PDF/resource_recovery_from_waste-268-277.pdf"},"pageCount":10,"title":"Copyright Material -Provided by Taylor & Francis","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":44,"text":"by Asia Biogas Group. It has 8 power plants in Thailand and 1 in Lao PDR. TBEC projects produce 44 million m 3 of biogas or 88 GWh equivalent of biogas annually, and reduce greenhouse gas emissions by 320,000 tCO 2 e per year."},{"index":2,"size":108,"text":"TBEC is certified ISO 9001, ISO 14001, and follows the guidelines of the International Finance Corporation (IFC) of Thailand on global warming. TBEC is the market leader in the Mekong area for biogas projects for cassava wastewater in Rayong, Kalasin, Saraburi in Thailand, and for the palm oil and rubber industry in Surat Thani. The TBEC Tha Chang Biogas Project won many awards, including Best Biogas Project in Asia Selling Electricity to the Grid at the ASEAN Energy Award in 2010, the Crown Standard from the Thailand Greenhouse Gas Management Organization (TGO) and the designated national authority (DNA) of Thailand and Gold Standard by the World Wide Fund."}]},{"head":"KEY PERFORMANCE INDICATORS (AS OF 2013)","index":2,"paragraphs":[{"index":1,"size":1,"text":"Land:"},{"index":2,"size":54,"text":"Land is provided by concessionaries/industry owners Water requirements: Most is 'wastewater' output -25,000 m 3 of treated wastewater/day Capital investment: Highly project-specific depending on scale, location, labor and benefit sharing arrangements with concessionaires, but as an illustration installing a 1.4 MW biogas power plant involves investment costs of approximately 3.5-3.9 million USD in 2008"},{"index":3,"size":9,"text":"Labor: 116 full-time employees (including O&M of multiple plants)"},{"index":4,"size":45,"text":"Output: 25,000 m 3 of treated wastewater/day; Across several projects, TBEC has processed 6,200,000 m 3 of wastewater/year, converted 97,250,000 kg COD/year into around 38,360,000 Nm 3 of biogas/year, 26,500,000 kWh of electricity/year and 250,000 tCO 2 e/year of CERs Potential social and/or environmental impact:"},{"index":5,"size":9,"text":"Reduced dependence on imported fossil fuels for power generation; "}]},{"head":"Context and background","index":3,"paragraphs":[{"index":1,"size":27,"text":"Recognizing the need to reduce GHG emissions to mitigate climate change, TBEC promotes use of cost-effective and environmental-friendly renewable energy such as biogas generated from agroprocessing wastewater. "}]},{"head":"Market environment","index":4,"paragraphs":[{"index":1,"size":179,"text":"Thailand is the world's third largest producer of crude palm oil and has one of the largest tapioca processing industry. Most agricultural production processes have significant amounts of organic residue output as a by-product. There are also many underutilized agro-processing waste sources not only in Thailand but also around the region. Due to increasing pressure to reduce GHG emissions, such agro-processing units, the customers of TBEC are looking for ways of treating wastewater from such processing of agricultural products including palm oil or starch from cassava. The waste-to-biogas and power business of TBEC contributes to greater use of renewable energy, allowing the firm to make a profit by selling electricity at preferential prices, as well as carbon credits while improving the environment. The electricity generated is directly sold to the grid of the Provincial Electricity Authority (PEA). Electricity demand is expected to continue to grow over the coming decades despite significant efforts in improving efficiency. Electricity prices are regulated by the government to ensure electricity is priced at a rate which is accessible to both residential and industrial users."},{"index":2,"size":88,"text":"With high quality and safety standards, TBEC is a premium product company with around 10 competitors. For instance, Asia Biogas Company Ltd, Prapob Company and several other newcomers. Most of the new enterprises contract for construction of biogas plants and do not invest and operate the plant. As of 2008, 21 CDM projects in the palm-oil sector were registered with the Thai Greenhouse Gas Management Organization (TGO). The number of approved CDM projects in Thailand is still limited due to the high level of burdensome bureaucratic procedures involved."}]},{"head":"Macro environment","index":5,"paragraphs":[{"index":1,"size":79,"text":"The fossil fuels account for 80% of the total energy supply in Thailand. The Government of Thailand targets to increase the share of alternative energy from 6.4% at present to 20.3% of commercial primary energy by 2022, as per the Renewable Energy Development Plan. To achieve the above targets, the Government of Thailand supports the projects by several incentives such as subsidization, soft loan, tax incentive, Board of Investment (BOI), Energy Service Company (ESCO) Fund, CDM, adder cost, etc."},{"index":2,"size":26,"text":"Thailand, with its abundant and varieties of biomass and agricultural wastes, has the great challenge and opportunity for the waste-to-energy projects to supply renewable energy-based electricity."},{"index":3,"size":88,"text":"Thailand's Ministry of Energy estimates that the potential of power generation in Thailand from biomass, MSW and biogas is 3,700 MW. Bio-based renewable energy (RE), such as agricultural residues, crops, biogas from biomass and wastes, MSW and biofuels, has shared in a large portion of RE more than 90% of potential RE in Thailand. For example, with 64 palm-oil mills, Thailand had a potential of more than 5 million m 3 of biogas/year from palm oil mill effluent (POME) that can generate more than 50 GWh of electricity/year."}]},{"head":"Business model","index":6,"paragraphs":[{"index":1,"size":96,"text":"TBEC develops, designs, finances and operates biogas projects on a Build-Own-Operate-Transfer (BOOT) while the concessionaries provide land and inputs and operates the plant after expiry of BOOT period (Figure 100). The BOOT period is flexible and depends on type and characteristics of individual  projects. It normally takes between 15 to 17 years before the transfer is made to the host company. Thus, key customers are the agro-industrial unit and the entity purchasing electricity which is the Provincial Electricity Authority (PEA) in Thailand. TBEC's unique selling point is quality of product and service, appealing to higher-value markets."}]},{"head":"Value chain and position","index":7,"paragraphs":[{"index":1,"size":186,"text":"Figure 101 describes the relationship between some of the key value chain actors in a typical TBEC project. TBEC treats wastewater from agro-processing units (like palm oil) to generate electricity. The major supplier of the plant's raw material is the agro-industry with which TBEC has an agreement to treat waste from the process. Threat to supply of effluent does not exist due to such agreements. The biogas it generates from treating wastewater is used to produce electricity, which is sold to the Thai electricity grid. TBEC has a PPA with the electricity authority, and thus threat of buyer power is low. Electricity as well as thermal energy (heat) could also be sold back to host agro-processing units directly under energy purchase agreement. Carbon credits may be purchased by companies in Europe. The BOOT agreements cover sale of concessions to partners. Thus, the specific role of TBEC in a project can be substantial over time and has certain challenges. Biogas power plants are quite complicated and require careful supervision. Unprofessional management can reduce cost-effectiveness and increase risks. Seasonality of biogas production can cause trouble with production planning."},{"index":2,"size":28,"text":"TBEC develops a project under CDM to obtain CERs and successfully completed United Nations Framework Convention on Climate Change (UNFCCC) registration of all its projects as CDM projects."},{"index":3,"size":137,"text":"For example, the actual GHG emission reductions or net anthropogenic GHG removals by sinks achieved during the period of January 1, 2013 to December 31, 2014 were 91,678 tCO 2 e against the estimated amount of 51,823 tCO 2 e for Thachang project. The examples of the biogas yield from different dry substrates are as follow: 200-400 m 3 /ton of cattle manure and dung, 250-450 m 3 /ton of pig and chicken dung, 350-700 m 3 /ton of energy crops and 700-900 m 3 /ton of POME (FNR, 2007 and2009). A value-added option is to turn the biogas into green gas by removing CO 2 and other gaseous components (H 2 S, H 2 O) content and increasing the percentage of methane. Compared to the biogas, the green gas and natural gas contain 29% more methane."}]},{"head":"Institutional environment","index":8,"paragraphs":[{"index":1,"size":107,"text":"Thailand is one of the first countries in Asia to have a policy to encourage biofuels, cogeneration, distributed generation and the generation of power from renewable energy. Co-generation and the production of power from renewable energy is implemented under the Small Power Producer Program (SPP) of 10-90 MW capacity and Very Small Power Producer Program (VSPP) of less than 10 MW capacity. It became a very effective policy instrument in promoting investment in renewable energy and co-generation. Private power producers sell electricity to the electric utilities under power purchase agreements at a price determined based on avoided cost or users located nearby. The VSPP has a more"}]},{"head":"SOCIAL & ENVIRONMENTAL COSTS","index":9,"paragraphs":[{"index":1,"size":12,"text":"In case of leakage of gas, there are consequences to the environment"}]},{"head":"SOCIAL & ENVIRONMENTAL BENEFITS","index":10,"paragraphs":[]},{"head":"Jobs creation","index":11,"paragraphs":[{"index":1,"size":203,"text":"Indirectly increase income to the farmers Reduce the odor of the wastewater Environmental benefit through reduced CO 2 emissions by generating electricity from renewable source and reducing pollution (fossil fuels substitution) lenient set of requirements and less complicated power purchase arrangement of 'net metering'. The SPP and VSPP regulations have been amended to be more investor-friendly and practical, including changes to the criteria for qualifying facility, calculation of the avoided cost and interconnection requirements. In addition, the government also launched a program to encourage the renewable energy SPPs by providing an additional tariff for a period of 5-10 years from the Energy Conservation Fund. The \"adder\" was determined through a competitive bidding system, which resulted in approval of 14 projects with average \"adder\" of 0.18 baht per kWh (US¢ 0.56), representing approximately 5% increase from the normal tariff. Financial incentives through soft loans and investment subsidies were expanded in amount and coverage for selected types of renewable energy projects, in particular biogas in pig farms and factories producing tapioca starch, palm oil, rubber sheet, ethanol and other types of agro-industry, municipal wastes and micro hydro. This has given an enormous boost to a number of marginal projects, particularly biogas and municipal waste projects."},{"index":2,"size":72,"text":"The PEA is a government enterprise with prime responsibility concerned with the generation, distribution, sales and provision of electric energy services to the business and industrial sectors, as well as to the general public in provincial areas, with the exception of Bangkok, Nonthaburi and Samut Prakran provinces. The PEA has expanded electricity supply to all areas covering 73 provinces, approximately 510,000 km 2 , accounting for 99% of the country's total area."}]},{"head":"Technology and processes","index":12,"paragraphs":[{"index":1,"size":295,"text":"TBEC applies a robust, flexible and highly productive Covered Lagoon Bio-Reactor (CLBR) technology suitable for changing volumes and quality of wastewater discharged from industrial factories. Wastewater passes through an anaerobic digestion process through which organic substances such as proteins, carbohydrates and fats are digested by bacteria in a suitable environment and are finally transformed into biogas. The CLBR has uniquely designed mixers, baffles and a thick high-density polyethylene (HDPE) cover with optimized contact with anaerobic bacteria to convert organic matter into biogas. Temperature is a key factor in planning a covered lagoon. Warm climates require smaller lagoons and have less variation in seasonal gas production. Cover materials must be: ultraviolet resistant; hydrophobic; tear and puncture resistant; non-toxic to bacteria and have a bulk density near that of water. The recovered biogas can be used to produce space heat, hot water, cooling or electricity. The biogas is collected in pipes, cleaned and stripped of condensate, dust and hydrogen sulphide and compressed and fed to dedicated biogas engines if used for power generation. The GE Jenbacher engine is designed specifically for gas applications and is characterized by particularly high efficiency, low emissions, durability and high reliability. The engine is designed with a knock control system which increases reliability and availability through control of firing point, output and mixture temperature. The engines gas mixer has been optimized to meet the requirements of modern gas engines and ensure trouble-free operation with biogas. In case of any excess build-up of biogas, the surplus gas will be combusted or flared. The effluent released from the digester is either recycled or sent to a small settling pond where sediment is settled and returned to the digester. The treated waste leaving the treatment system boundary is then pumped to existing water treatment lagoons."},{"index":2,"size":120,"text":"A typical 200 tons-per-day starch factory can produce as much as 25,000 m 3 of methane (4.5 MW) from the cassava wastewater and 16,000 m 3 of methane (2.8 MW) from the cassava pulp. This is equivalent to 40,000 L of heavy fuel oil (HFO) per day or can be used to produce up to 7.3 MW of electricity per hour. Some of the areas of focus for new development are reactor configuration, process control, modelling and optimization for improving biogas yield; use of other feedstock such as solid residual, and energy crops; pre-and post-treatment for digestibility improvement and nutrient recovery; improved biogas clean up processes and upgrading biogas to high value/rich methane gas for fuel cell, vehicle, CNG, etc."}]},{"head":"Funding and financial outlook","index":13,"paragraphs":[{"index":1,"size":133,"text":"The investment costs covering project development, design, construction and start-up system depend on the size, location and duration of contract for individual projects. The major investment costs are plant machinery/equipment with minor cost of building and small cost of engineering services and other infrastructure. It should be noted that land and material costs are covered by concession partners. Historically, a key constraint has been reluctance of Thai domestic financial institutions to finance waste-to-energy products. Most financial institutions still define waste-to-energy business as a high-risk business. Unfamiliarity and trust that carbon credits can be saleable to European countries is part of the explanation. For that reason, partners invested their own money in order to initiate the business in 2003. At present, some Thai financial institutions offer refinance since they now realize the business potential."},{"index":2,"size":66,"text":"The main revenue streams are from the sale of biogas and electricity and construction and maintenance under BOT schemes. Carbon credits are still relatively modest. Overall conditions that effect revenue streams include government policies, seasonality and prices. Seasonality is important as unusual seasons or weather conditions have an impact on inputs to the commodity processing factories that, in turn, produce wastes that are turned into energy. "}]},{"head":"Socio-economic, health and environmental impact","index":14,"paragraphs":[{"index":1,"size":189,"text":"The project will create an indigenous renewable electricity resource, replacing power from coal, diesel and natural gas, and will contribute to the development of the region, as well as national economy by reducing Thailand's deficiency of power and need to import fossil fuels. In terms of environmental benefits, the project reduces existing levels of pollutants in wastewater; air pollution; GHG with positive impact on the health of those living around the plant and mitigates global warming by trapping methane. TBEC hires local labor for the construction and operation of biogas plant. The project will directly create more than 10 new jobs, and thus increase stakeholder incomes. It will improve human capacity and diversity of employment opportunity by training project managers, lab technicians and operators. product-service company as it puts more emphasis on quality and safety. However, the technology is high-priced and requires highly-skilled labor. There is no market yet for treated wastewater, but there is an opportunity to use the treated wastewater for agriculture. Growing electricity demand and application of the technology to other agro-processing plants such as sugar, ethanol and liquor production present opportunities for TBEC to expand."}]}],"figures":[{"text":" CO 2 emission reduction; local jobs in construction of plant; skilled jobs in operation and maintenance; reduced nuisance odors and water "},{"text":"FIGURE FIGURE 100. TBEC BUSINESS MODEL CANVAS "},{"text":" TBEC have hired Waste Solutions Ltd, a New Zealand firm of technology developers and consulting engineers, to design the plants. TBEC adopts a BOOT model, bringing in investment to set up biogas plants that treat wastewater from agro-industry factories that provide land and inputs. TBEC finances, designs, constructs, operates and maintains the plant until BOOT term expires. TBEC recovers its costs by producing electricity and selling it to a provincial electricity authority. Training is provided to help the host company after transfer of project. The business has operated projects in Thailand and in Lao PDR and is developing ones in Myanmar, Cambodia and Vietnam. The TBEC has installed and is operating six projects at starch units and three projects at palm oil mills. Examples of plants installed and operated by TBEC include Rayong, starch plant Operation started in January 2009, and registration with UNFCCC was in September 2010.TBEC raised finance from the Private Energy Market Fund (PEMF) in Finland and Al Tayyar Energy (ATE) in Morocco for setting up these plants. PEMF is a private equity fund for alternative energy development and power conservation. It holds about 70% of TBEC. Al Tayyar Energy (ATE) is a clean power development and investment company founded by HRH Prince Moulay Hicham Ben Abdallah Al Alaoui of Morocco. It has head office in the UAE. The company primarily focuses on bio-energies, such as biofuels, biogas and biomass. It also invests in solar, wind and hydroelectric project companies. (15,000 m 3 /day biogas, 1.4 MW of power); Kalasin, starch plant (30,000 m 3 /day, 2 MW); Saraburi, high (15,000 m 3 /day biogas, 1.4 MW of power); Kalasin, starch plant (30,000 m 3 /day, 2 MW); Saraburi, high fructose syrup from cassava (25,000 m 3 /day and 1 MW in Lao) and Thachang project at palm oil mill fructose syrup from cassava (25,000 m 3 /day and 1 MW in Lao) and Thachang project at palm oil mill and concentrated latex plant (35,000 m and concentrated latex plant (35,000 m  "},{"text":" Table 28 shows the indicative cost structure of operations expressed in terms of approximate percentage of annual investment cost. The financial parameters of the typical project (based on Thachang project) are as follows: The financial parameters of the typical project (based on Thachang project) are as follows: 1) Capacity of plant 2.8 MW 1) Capacity of plant2.8 MW 2) Term of BOOT contract 10 years 2) Term of BOOT contract10 years 3) Investment cost USD 3.9 million 3) Investment costUSD 3.9 million 4) O&M cost USD 0.2 million 4) O&M costUSD 0.2 million 5) Electricity sold to grid per year 9,644 MWh 5) Electricity sold to grid per year9,644 MWh 6) Average tariff per kWh USD 0.076 6) Average tariff per kWhUSD 0.076 7) Escalation in O&M cost per year 2% 7) Escalation in O&M cost per year2% 8) Increase in tariff per year 2% 8) Increase in tariff per year2% 9) Average CERs per year 48,694 tons 9) Average CERs per year48,694 tons 10) IRR (without CERs) 4.44% 10) IRR (without CERs)4.44% 11) IRR (with CERs) 20.60% 11) IRR (with CERs)20.60%  "},{"text":"TABLE 28 . OPERATIONAL AND MAINTENANCE COSTS OF TBEC COST ITEM OPERATIONS COSTS AS A % OF INVESTMENT COST  Equipment (depreciation) Approx. 65% Equipment (depreciation)Approx. 65% Labor Approx. 10% LaborApprox. 10% Maintenance Approx. 15% MaintenanceApprox. 15% Electricity Approx. 5% ElectricityApprox. 5% Building Approx. 5% BuildingApprox. 5%  "}],"sieverID":"8830654f-9603-4054-ba84-900d480364c2","abstract":""}

data/part_3/06eb62d71cc9568baf9f0b47b4803b36.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06eb62d71cc9568baf9f0b47b4803b36","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/de8e82de-00b1-47fa-b173-24928a6fd9aa/retrieve"},"pageCount":11,"title":"Find more information","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":3,"text":"[Type here] 2"}]},{"head":"About AfricaRice, AICCRA project and Afrique-learning","index":2,"paragraphs":[{"index":1,"size":1,"text":"AfricaRice:"},{"index":2,"size":95,"text":"AfricaRice is a leading pan-African rice research organization committed to improving livelihoods in Africa through solid science and effective partnerships. AfricaRice is a research center of CGIAR, which is part of a global research partnership on future food security. It is also an intergovernmental association of African member countries. Today, AfricaRice membership comprises 30 countries. The mission of AfricaRice is to contribute to poverty reduction and food security in Africa through research, development, and partnership activities, aimed at increasing the productivity and profitability of the rice sector to guarantee the sustainability of the agricultural environment."}]},{"head":"AICCRA:","index":3,"paragraphs":[{"index":1,"size":70,"text":"AICCRA (Accelerating Impacts of CGIAR Climate Research for Africa) is a World Bank funded project that helps deliver a climate-smart African future driven by science and innovation in agriculture through the development, validation and wide-scaling of bundles climate information services and climate smart agriculture across Africa. In Mali, AICCRA focuses on rice and crops produced in the same environment with rice such as vegetables, legumes, tubers, roots, trees and fishes."}]},{"head":"Afrique-learning:","index":4,"paragraphs":[{"index":1,"size":100,"text":"Afrique-learning is a cooperative which creates and manages vocational e-learning courses specially designed for African youth. Courses are tailor-made in collaboration with experts in the field with the aim of producing interactive, illustrated, interesting and easy-to-study courses that provide the student with important information in simple and appropriate language. Learning is done independently at the student's own pace; it is assessed and a course certificate is attained following a final test. Courses are available on computer, smartphone or android tablet. They only require a very modest bandwidth and are therefore within the reach of students. Registration and classes are free."}]},{"head":"Introduction to the toolkit concept","index":5,"paragraphs":[]},{"head":"What is the Smart-Valleys toolbox?","index":6,"paragraphs":[{"index":1,"size":33,"text":"As the name suggests, this is a collection of tools. These aim to help the various actors involved in agricultural inland valley development according to the Smart-Valleys approach to carry out their tasks."},{"index":2,"size":28,"text":"Whether it is the technician who is currently instructing a group of farmers, the farmer improving his development works, or the coordinator who designs and coordinates the fieldwork."},{"index":3,"size":23,"text":"Smart-Valleys is an agricultural inland valley development approach for rice production systems in sub-Saharan Africa, based on a participatory, sustainable, and low-cost approach."},{"index":4,"size":50,"text":"The toolkit covers various topics. On the one hand, of course, the practical aspects of the selection and development work in an inland valley. There is then a part on project coordination, which includes both practical assistance in organizing the project and guidelines for good practice in inland valley management."},{"index":5,"size":42,"text":"A holistic approach to the management of inland valleys is presented, which communicates good sustainable practices to different actors. The toolkit is available in French and English, and is applicable to the flat and undulating inland valleys, which are widespread in Mali."}]},{"head":"Why was the tool developed?","index":7,"paragraphs":[{"index":1,"size":51,"text":"The toolkit was developed to fill a gap by combining, for the first time, instructions and guidelines for all stages of an inland valley development project using the Smart-Valleys approach. Practical knowledge from years of experience has been used to document agricultural development processes and didactically convert them into learning materials."}]},{"head":"Who is the toolbox for?","index":8,"paragraphs":[{"index":1,"size":68,"text":"The person(s) responsible for setting up the project and then managing it. We will refer to this group of people under the generic name of \"project managers\". This toolkit will help the project manager to organize and then manage the project according to the objectives, by organizing the work of the supervisors and technicians who will participate in engaging farmers in the sustainable agricultural use of inland valleys."},{"index":2,"size":51,"text":"Supervisors and technicians will find in this toolkit all the technical and practical information they need to organize collaborative work with farmers for the development and management of inland valleys according to the Smart-Valleys approach. The e-learning courses allow them to prepare and the practical guides accompany them in the field."},{"index":3,"size":40,"text":"Finally, some farmers will be able to use the toolkit directly to better develop and manage their inland valleys, even outside the project. State or private extension services can of course use the toolkit to strengthen their knowledge and know-how."},{"index":4,"size":3,"text":"[Type here] 4"}]},{"head":"Components of the Smart-Valleys toolbox","index":9,"paragraphs":[{"index":1,"size":26,"text":"The toolkit includes three types of documents, to be used together: booklets, online courses and guides. Each type is intended for specific actors, for specific purposes."},{"index":2,"size":26,"text":"The booklets provide detailed information on the subject. In addition to essential information, the user receives additional information to better understand the subject and its context."},{"index":3,"size":69,"text":"Online courses help the user to understand the topic and to memorize the fundamental ideas and actions. The information is presented here in a didactic way and learning is supported by interactive tests. The courses mainly help technicians to understand the different components of the Smart-Valleys approach and the corresponding tasks. Once their apprenticeship is completed, the technicians will pass this knowledge on to the farmers during the fieldwork."},{"index":4,"size":68,"text":"Finally, the practical guides are to be used during implementation in the field. Only information essential for practical implementation is presented here, in a way that is easy to use in the field. These are either instructions with technical data or guidelines on how the activity must be carried out. These guides are mainly intended for technicians and farmers who wish to improve their production on their own."},{"index":5,"size":44,"text":"In this booklet, we describe common uses of the Smart-valleys toolkit. The booklets provide an overview for the project manager, the technician gains practical knowledge and basic understanding through online courses, and the technician and farmer use the guides when working in the field."},{"index":6,"size":80,"text":"Each type of tool is therefore intended for specific actors. The farmer, for example, will generally be less interested in how inland valley development work is planned and organized by the project. However, in some circumstances, it may be advisable for the project coordinator to take the online courses himself or for the technician to acquire knowledge about certain parts of the project organization. Think of the toolkit as one source of information that you can customize the use of."}]},{"head":"Practical guides","index":10,"paragraphs":[]},{"head":"Online course","index":11,"paragraphs":[{"index":1,"size":16,"text":"These interactive learning materials are didactic and use tests to reinforce and validate understanding and learning."},{"index":2,"size":22,"text":"Only information essential for practical implementation is presented here, and organized in such a way that it is useful in the field."}]},{"head":"Detailed booklets","index":12,"paragraphs":[{"index":1,"size":15,"text":"Small electronic or printable manuals, providing all the details and context, to ensure in-depth knowledge."}]},{"head":"The producers","index":13,"paragraphs":[{"index":1,"size":32,"text":"Some farmers may wish to learn, on a self-learning basis, about improving the productivity and sustainability of their inland valleys. In order to have a complete overview, the following booklets are recommended:"},{"index":2,"size":7,"text":"• \"Sustainable agricultural use of inland valleys\""},{"index":3,"size":5,"text":"• \"Soil fertility and fertilizers\""},{"index":4,"size":53,"text":"The booklet \"sustainable agricultural use of inland valleys\" deals with the sustainable agricultural use of inland valleys. It shows how the fauna and flora of the inland valleys can be preserved for the farmers benefit. It also covers weed and pest verification for rice cultivation as well as the benefits of crop diversification."},{"index":5,"size":39,"text":"The booklet \"Soil fertility and fertilizers\" will show you different methods to maintain the fertility of the inland valleys soil, which allows for a sustainable exploitation of the inland valleys and will enable good yields in the long term."},{"index":6,"size":51,"text":"The following practical guides are designed to help with fieldwork. What should be the height of the plot bunds? How do I know if the leaves of the mango tree should be used for compost or as erosion protection? Or how do I make a map of my inland valley site?"},{"index":7,"size":13,"text":"You can find it all explained in a few words in these guides:"},{"index":8,"size":5,"text":"• Soil fertility and fertilizers "}]}],"figures":[{"text":" INTRODUCTION TO THE TOOLKIT CONCEPT ........................................................ 2. LIST OF TOOLS .......................................................................................................... 3. THE PROJECT MANAGER .......................................................................................... 4. SUPERVISORS AND TECHNICIANS .......................................................................... 5. THE PRODUCERS ...................................................................................................... "},{"text":"•• Sustainable agricultural use of inland valleys • Inland valley selection for Smart-Valleys development • Selection criteria for an inland valley • Site visit & development plan of an inland valley • Implementation of the development scheme on the land • The building of water verification structures • Management of developed inland valleys For those farmers who can, it is of course recommended that they also take the online courses. Here you can find more information, in particular on the stages of inland valley development: Inland valley selection for Smart-Valleys development • Selection criteria for an inland valley • Site visit & development plan of an inland valley • Implementation of the development plan on the land • The building of water verification structures • Inland valley management [Type here] "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"6b1e4056-177f-4c10-91ee-99d107d1bb17","abstract":""}

data/part_3/06fb9c8ac735053f5ea3adbe93d59888.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06fb9c8ac735053f5ea3adbe93d59888","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/9cb36294-f06c-4ae9-8e17-83c3941e8338/retrieve"},"pageCount":10,"title":"Genomic and Proteomic Analysis of Schizaphis graminum Reveals Cyclophilin Proteins Are Involved in the Transmission of Cereal Yellow Dwarf Virus","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":319,"text":"Barley and cereal yellow dwarf viruses (B/CYDV) in the genera Luteovirus and Polerovirus that cause yellow dwarf disease of monocots are phloem restricted, single-stranded positive-sense RNA plant viruses [1]. They are strictly dependent on aphid vectors for host-to-host transmission, and they are transmitted in a circulative, non-propagative manner [2]. The model for circulative transmission involves aphids ingesting virions while feeding on the phloem sap of infected plants. Virions are acquired into the vector by moving through the hindgut cells and then are released into the hemocoel. Virions circulate in the hemolymph and concentrate at the basal lamina of the accessory salivary gland. Virions are then actively transported across these cells and released into the salivary duct where they can be injected, along with salivary secretions, as the aphid feeds on a plant host. Luteo and poleroviruses causing yellow dwarf disease are believed to follow the circulative pathway through aphid vectors [2]; however, virus transmission is aphid-species specific. All aphids can ingest the various viruses during phloem feeding, but only some of the viruses are transmitted by any single aphid species [3]. Transmission will not occur if the virus fails to cross one of two potential transmission barriers; the hindgut or the accessory salivary gland. Virus particles are transported across both tissue types by a mechanism that resembles receptor-mediated endocytosis [4], with different ligands and receptors involved at each step. Viruses in the Luteoviridae do not replicate in their vector and are transmitted only as virus particles [5]. The virus capsid contains two viral proteins: a 22 kDa major coat protein (CP) and a minor 72 kDa read-through protein (RTP) [6]. These are the only viral proteins required for transmission, and both are required to interact with aphid components to facilitate virus transport through the aphid [7][8][9][10][11]. Chemical cross-linking coupled to mass spectrometry revealed a distinct topological feature in the a polerovirus RTP that is required for virus-aphid interactions [11]."},{"index":2,"size":216,"text":"Little is known about the aphid components responsible for virus transmission. Several candidate proteins have been identified using virus overlay assays [12][13][14] and more recently proteomic approaches [15][16][17]. Two proteins (SaM35 and SaM50), able to bind in vitro the MAV strain of Barley yellow dwarf virus (BYDV), were isolated from the vector Sitobion avenae, but they were not detected in the nonvector aphid Rhopalosiphum maidis [12]. Another 50 kDa protein, able to bind to the GAV strain of BYDV, was detected in two vector species Schizaphis graminum and S. avenae, but not in the nonvector species, Rhopalosiphum padi [14]. None of these proteins were identified using mass spectrometry. Three Myzus persicae proteins that bound the related Beet western yellows virus were identified by mass spectrometry as actin, a receptor for activated C kinase 1 (Rack-1), and Glyceraldehyde-3phosphate dehydrogenase 2 (GAPDH) [13]. Rack 1 has been shown to be involved in the regulation cell surface receptors [18] and GAPDH is an enzyme of the glycolysis pathway that also regulates endocytosis when phosphorylated [19]. Actin is involved in intracellular trafficking, it interacts with endocytic components [20] and is involved in virus transport [21]. These proteins may play a role in virus transmission, but no direct evidence was provided and the protein interaction experiments were performed under denaturing conditions."},{"index":3,"size":206,"text":"Validating the involvement of proteins in the circulative transmission process has posed a significant challenge to the entire vector biology field. Aphids are not amenable to transgenesis. Functional analyses are possible but difficult to achieve. RNA silencing pathways are conserved and even expanded in aphids [22]. RNA interference (RNAi) has been successful [23,24] although silencing is incomplete in these insects. Dissected gut and salivary gland tissues are tiny, making biochemistry studies difficult. No suitable aphid cell culture models are available to study protein function. However, aphids are an ideal vector species to couple genetics and proteomics to probe protein function [15][16][17]. Aphids are cyclic parthenogens; they alternate sexual reproduction with parthenogenetic reproduction. Aphid hybrid lineages generated by sexual reproduction can be maintained parthenogenetically and allow the investigator to phenotype each hybrid genotype for different traits, for instance transmission of different virus strains or virus species. Parthenogenetic reproduction makes aphids highly amenable to proteomics studies because massive quantities of protein can be generated from genetically identical aphids as easily as growing bacterial cultures. Furthermore, the genome sequence of the pea aphid Acyrthosiphon pisum has been published [25] information on key pathways regulating the genetic basis of phenotypic plasticity [26,27] and the aphid EST collection is also expanding."},{"index":4,"size":143,"text":"To help dissect the mechanism of transmission of luteo and poleroviruses, an S. graminum population was developed by crossing two genotypes that differed for their ability to vector the RPV strain of Cereal yellow dwarf virus (CYDV-RPV) and the SGV strain of Barley yellow dwarf virus (BYDV-SGV) [28]. These genotypes do not harbor known secondary endosymbionts, only distinct genotypes of the primary endosymbiont Buchnera spp [16]. The F2 aphid genotypes were characterized for their ability to transmit both viruses. It was found that the ability to transmit each virus segregated independently in the population [29]. Moreover, it was found that the barrier (i.e. hindgut or accessory salivary gland) responsible for preventing virus movement in the nonvector genotypes also segregated; some of the nonvector F2 genotypes had a strong hindgut barrier, others had a strong accessory salivary gland barrier and others had both barriers."},{"index":5,"size":138,"text":"Proteomic studies of this aphid population identified several proteins that were differentially expressed between vectors and nonvectors [16,17]. Among these proteins were two cyclophilins (proteins S28 and S29) identified by 2-D fluorescence difference gel electrophoresis (DIGE) coupled to mass spectrometry to have similarity to the protein encoded by the Acyrthosiphon pisum EST gi 82571971 [17]. The S28 protein was present in all eight genotypes analyzed whereas the S29 protein was only found in protein extracts from the four vector genotypes analyzed. Based on 2-D DIGE, the two proteins had similar molecular weights, but slightly different pIs. A protein of similar molecular weight and pI to S29 was detected following incubation of a total aphid protein extract with purified CYDV-RPV and a virus-specific antibody [17] using a co-immunoprecipitation (co-IP)-DIGE approach; however, this protein was not identified using mass spectrometry."},{"index":6,"size":147,"text":"Cyclophilins are peptidyl-prolyl isomerases proteins (PPIases) [30]. They catalyze the isomerization of peptide bonds from trans form to cis form at proline residues and they facilitate protein folding. The cyclophilins identified by Yang et al. (2008) were related to the Drosophila melanogaster CG2852 protein (NP_611695) and to the human Cyclophilin B protein (NP_000933). Cyclophilin B is localized to the endoplasmic reticulum and extracellular space [31] as well as on the cell surface of mammalian cells [32]. This protein functions in the secretory pathway, possibly by chaperoning membrane proteins or having a role in receptor signaling pathways [33]. A direct role of cyclophilin in B/CYDV movement through aphids may involve chaperoning the virus to various membrane bound vesicles, e.g. endosomes, in either gut or salivary tissues. In this study, we used a combination of genomic, proteomic, and biological approaches to probe the function of cyclophilin in virus transmission."}]},{"head":"Materials and Methods","index":2,"paragraphs":[]},{"head":"Aphid Genotypes and Virus Strains","index":3,"paragraphs":[{"index":1,"size":59,"text":"Virus-free genotypes of S. graminum [28] were maintained parthenogenetically as described previously [34]. Additional biotypes of S. graminum were obtained from Dr. John Burd, USDA, ARS, Still water, OK. Aphid biotypes were determined based on their ability to infest different host plants [35]. CYDV-RPV and the related potato leafroll virus (PLRV) were maintained and purified as described previously [17,36]."}]},{"head":"Virus Transmission Assays","index":4,"paragraphs":[{"index":1,"size":80,"text":"Aphids were allowed a 48 h acquisition access period (AAP) on leaves detached from BYDV-RPV-infected plants inoculated 4 to 5 weeks previously. Viruliferous aphids were transferred from the virus source leaves to 12 recipient noninfected 'Coast Black' oat plants and allowed a 5 day inoculation access period (IAP). Plants were observed for symptom development for 3 to 5 weeks. Virus transmission efficiency was calculated as the percentage of the total number of plants infested with viruliferous aphids that become infected."}]},{"head":"Cyclophilin Sequencing","index":5,"paragraphs":[{"index":1,"size":119,"text":"RNA from each aphid genotype and biotype was extracted using the RNeasy Plant Mini Kit (QIAGEN). The RNA was reverse transcribed using the SuperScript® First-Strand Synthesis System for RT-PCR (Invitrogen). Cyclophilin primers amplifying the complete coding sequence of the A. pisum gi 82571971 EST were designed (F5'ATGATATCTACTTATAAAATCATGACG3' and R5'TTATTCGGTAGCATCAGTTTTG3'). The PCR conditions consisted of a denaturation step at 95 ° C for 2 min, 30 cycles at 95 ° C for 15 sec, 55 ° C for 30 sec and 72 ° C for 1 min, and a final extension step at 72 ° C for 5 min. The PCR products were purified using the QIAquick PCR Purification Kit (QIAGEN) and sequenced using each one of the cyclophilin primers."}]},{"head":"In Silico Analysis","index":6,"paragraphs":[{"index":1,"size":14,"text":"In silico analyses were performed using the ExPASy World Wide Web server (http://ca.expasy.org/tools/pi_tool.html) [37]."}]},{"head":"Statistical Analyses","index":7,"paragraphs":[{"index":1,"size":35,"text":"The Wilcoxon rank-sum test using R software was applied to test differences in CYDV-RPV transmission efficiency between genotypes encoding or not the cyclophilin vector allele. P values less than 0.05 were regarded as statistically significant."}]},{"head":"Cyclophilin In vitro Binding Assay","index":8,"paragraphs":[{"index":1,"size":205,"text":"Both forms of S. graminum cyclophilin were cloned in the expression vector pET101/D-TOPO and expressed in Escherichia coli using the Champion™ pET Directional TOPO® Expression Kit (Invitrogen). The expressed proteins were purified under native conditions using the Ni-NTA Fast Start kit (Qiagen). Co-immunoprecipitation (co-IP) between the expressed cyclophilin proteins and purified CYDV-RPV or PLRV was performed as described in Yang et al. (2008), with the exception that following the washes the coimmunoprecipitated proteins were kept in 0.025 M phosphatebuffered saline containing 0.15 M NaCl (pH 7), boiled in Laemmli buffer and separated on a 12% SDS-PAGE gel. The proteins were transferred onto Immobilon-P membranes (Millipore) using a semi-dry transfer apparatus (Thermo Scientific) for 95 min at room temperature according to the manufacturer's instructions. Filters were incubated 1 h at room temperature with gentle shaking in TTBS (100 mM Tris, 0.9% NaCl, 0.1% Tween) with a 1/1000 dilution of Penta•His Antibody (QIAGEN). After brief washes in TTBS, filters were incubated for 1 h at room temperature with gentle shaking in TTBS with a 1/5000 dilution of goat anti-mouse IgG alkaline phosphatase (AP) conjugated (Sigma). Filters were subsequently washed in TTBS and proteins were detected by the addition of 1-Step NBT/BCIP (Pierce) as per the manufacturer's instructions."}]},{"head":"Virus and Aphid Protein Co-immunoprecipitation","index":9,"paragraphs":[{"index":1,"size":194,"text":"To quantify interactions between cyclophilin and CYDV-RPV, we performed a co-immunoprecipitation (co-IP) experiment coupled to a bottom-up LC-MS/MS analysis. Aphid tissue (2 g of each aphid genotype, two vectors, A3 and WY10-A, and one nonvector C2) were placed into a pre-chilled mortar and covered with liquid nitrogen. Aphid proteins were extracted into 2 mL of 0.1 M phosphate buffer pH 6.7 containing 1% EDTAfree HALT protease inhibitors (Pierce, Rockford, IL) and clarified as described [17]. Partially purified CYDV-RPV was prepared as described [17] with the following modifications. Virus pellets were recovered following a 2 h centrifugation at 40,000 x G in a 30% sucrose cushion and resuspended in 0.1 M phosphate buffer, pH 6.7. Virus was stored at -80° for 24 hr, thawed on ice, and quantified using a Nanovue spectrophotometer (GE Healthcare, Piscataway, NJ). 200 µg of partially purified virus solution was added to each protein extract and rotated at 4° C for 6 hr. An additional reaction containing proteins extracted from biotype WY-10A was used as a negative control with no virus added to enable us to pinpoint the highly abundant aphid proteins that interact with antibodies or beads from further consideration."},{"index":2,"size":193,"text":"Dynal m270 epoxy beads (Life Technologies, Carlsbad, CA) were conjugated overnight at 37° to anti-CYDV-RPV antibodies at an antibody:bead ratio of 10 µg antbody:10 μg beads according to the Cristea and Chait protocol [38]. Aphid-virus protein complexes were added to the conjugated beads for a total volume of 2.2 mL per reaction. Protein complexes were co-immunoprecipitated for 12 hr at 4° C. Magnetic beads were washed six times in a 0.025 M phosphate buffer containing 0.15 M NaCl to remove loosely and unbound proteins. The tubes were changed following each wash to eliminate proteins that nonspecifically bound to the plastic from the elution. Protein complexes were eluted in 0.5 N NH 4 OH and 0.5 mM EDTA, flash frozen in liquid nitrogen and dried using a vacuum centrifugal concentrator. Protein complexes were resuspended in 8 M urea in 100 mM NH 4 HCO 3 . Proteins were reduced using 10 mM DTT, and thiols were sulfenylated using 30 mM methyl methanethiosulfonate. Proteins were hydrolyzed into peptides using trypsin (Promega, Agora, WI) for 12 h. Salts and impurities were removed using mixed mode strong cation exchange reversed phase cartridges (Waters Oasis 1cc MCX cartridge)."}]},{"head":"LC-MS/MS","index":10,"paragraphs":[{"index":1,"size":191,"text":"Each aphid genotype co-IP and control co-IP was analyzed in triplicate. The control co-IP was subjected to the same LC-MS/MS methods as the experiment coIP with virus. Co-IP and control runs were randomized to eliminate any potential artifacts introduced due to run order. Split-less nanoflow chromatography was performed in the vented column configuration using a Waters NanoAcquity LC system (Waters Corporation, Milford, MA). Peptides were reconstituted in 30 µl solvent A. Solvents A and B were 99.9/0.1 water/formic acid and 99.9/0.1 acetonitrile/formic acid, respectively. A flow rate of 2 µL/min (98% A/2% B) flushed sample out of a 5 µL loop and onto a self-packed capillary trap column (100 µm ID × 4 cm). After 10 µL of wash, the six-port valve switched and closed the vent, which initiated the gradient flow (250 nL/min) and data acquisition. A 70 min analysis was used in which solvent B ramped from 2% to 32% over 43 min (2-45 min); from 32% to 80% over 1 min (45-46 min); held constant for 5 min (46-51 min); and then initial conditions were restored (51-52 min) and held constant for the final 18 min (52-70 min)"},{"index":2,"size":123,"text":"A Q-Exactive (Thermo, Fisher, Bremen, Germany) was operated in data dependent mode for mass spectrometric analysis. For each precursor scan, the top 12 most abundant ions were selected for tandem MS. For MS1 scans, a resolving power of 35000 at m/z 200 was used with an automatic gain control (AGC) of 1,000,000 charges and a max ion injection time (IT) of 10 ms. A resolving power of 17,500 at m/z 200 was set with an AGC of 200,000 charges and a max IT time of 55 ms for MS2 analysis. A 90 s exclusion window was used to avoid repeated selection of abundant ions. For selection of ions, peptide-like isotope distributions were preferred with the exclusion of unassigned and 1 + charge states."}]},{"head":"Database Searching","index":11,"paragraphs":[{"index":1,"size":188,"text":"Tandem mass spectra were converted into mascot generic format (MGF) peak list files using msconvertGUI available from Proteowizard (http://proteowizard.sourceforge.net/tools.shtml) [39]. An initial database search of all insect, plant, and bacterial proteins in NCBI revealed the presence of only one plant protein in co-IP datasets. Thus, to increase the coverage of S. graminum proteins, we researched the data using an in-house database created from a collection of 454 sequencing products generated from S. graminum biotype H pooled head and gut mRNA libraries. The genome sequence of CYDV-RPV and cyclophilin B sequences were added to the database. In total, the database had 297,312 sequences. The cyclophilin mRNA sequence is provided here (Figure S1), and all sequences are available in the NCBI Short Read Archive: http:// www.ncbi.nlm.nih.gov/biosample/2265610. All data were searched using Mascot v 2.3.02 (Matrix Science, Boston, MA) as follows. Fixed methylthio on cysteine residues and variable methionine oxidation and deamidation of asparagine and glutamine were used as modifications. The precursor mass measurement accuracy tolerance was set to 30 ppm, and fragment ion tolerance was 0.2 Dalton (Da). Instrument type was not specified. A single missed tryptic cleavage was permitted."}]},{"head":"Label-free Quantification","index":12,"paragraphs":[{"index":1,"size":318,"text":"Two methods of label-free quantification were used, spectral counting and MS1 peak area comparisons, to investigate whether cyclophilin was enriched in the co-IP as compared to the control co-IP with no virus. For spectral counting, Mascot *. dat files were created in Mascot and loaded into Scaffold (version 3_00_05). Peptide and protein probabilities were calculated using PeptideProphet and ProteinProphet algorithms [40]. Protein and peptide FDR was 0.0%. Spectral counts were normalized to the total and compared between co-IP with virus and no virus control. A Fisher's Exact Test was performed to test for spectral count differences between groups. We used Skyline [41] to perform label-free quantification of MS1 ion signals derived from cyclophilin peptides in the co-IP [42]. Skyline is an open source software program that can be downloaded from http:// proteome.gs.washington.edu/software/skyline. We created a comprehensive spectral library including sampling across multiple acquisitions in Skyline that contains all the MS/MS spectra from the co-IP experiments. Search engine parameters were adjusted in Skyline as described above for Mascot searches. The precursor isotopic import filter was set to a count of three (M, M+1, M+2) at a resolving power of 35,000 at 200 m/z. Raw files were then imported directly into Skyline. Extracted ion chromatograms were manually inspected for each peptide. A normalization factor was calculated to account for run-to-run variation in ion abundances. Peak areas from three peptides derived from a protein that showed no enrichment in the co-IP as compared to the healthy control were normalized to the total. A normalization factor was calculated for each peptide. These normalization factors were averaged for each individual LC-MS/MS run. Total peak areas for the cyclophilin peptides of interest from every MS run were normalized by the average normalization factor. Raw and normalized peak areas for the cyclophilin peptides can be found in Dataset S1. A Kruskal-Wallis test was performed to investigate differences between the normalized peak areas for each peptide."}]},{"head":"Results","index":13,"paragraphs":[]},{"head":"Identification of the Transcript Sequences for Both Cyclophilin Proteins","index":14,"paragraphs":[{"index":1,"size":125,"text":"Cyclophilin cDNA was initially amplified from both parent genotypes of the S. graminum population [28] used to first identify the two cyclophilin proteins. A single 660 bp product was amplified from each genotype and subsequently sequenced. Two transcript forms were identified, one from each parent that differed by two nucleotides and that were 90% similar to the A. pisum EST gi 82571971. The first difference between the parent transcripts involved a single nucleotide polymorphism (C to G substitution) at position 95 that results in an amino acid change. The vector parent encodes a glutamine residue (Q) whereas the nonvector parent encodes glutamic acid (E). The second difference involved an A to T substitution at nucleotide 406 that does not result in an amino acid change."},{"index":2,"size":74,"text":"In silico analyses of the proteins encoded by each parent determined that both protein isoforms were similar in molecular weight, but slightly different pIs; the predicted pI for the isoform encoded by the vector parent was more basic than the predicted pI from the nonvector isoform (Table 1). A signal peptide predicted to be cleaved is present in both proteins and the differing amino acid is located in position 2 of the mature forms."}]},{"head":"Cyclophilin cDNA Sequencing from F2 Genotypes Differing in Their Transmission Efficiency","index":15,"paragraphs":[{"index":1,"size":68,"text":"The cyclophilin cDNA was sequenced from 12 F2 genotypes of the S. graminum population that differ in their CYDV-RPV transmission efficiency (Table 2). Three genotypes are efficient vectors and nine genotypes are inefficient vectors. The presence of each allele was assessed using the two differing nucleotides in position 95 and 406: the vector allele was characterized by a C in position 95 and an A in position 406."},{"index":2,"size":119,"text":"The analysis of the cyclophilin cDNA sequence of the three vector genotypes tested (A3, CCS 6 and G11) indicated that both alleles were present in these genotypes. Among the nine F2s that transmit CYDV-RPV less efficiently, seven (C2, CC1, CC2, CCS 5, K2, LL3 and MM1) were found to only possess the nonvector allele, whereas the other two genotypes (K3 and BB1) possessed both forms (Table 2). We tested the influence of the presence of the cyclophilin vector allele on the transmission efficiency of the S. graminum genotypes. The transmission efficiencies were significantly higher for the genotypes encoding the cyclophilin vector allele (Wilcoxon rank-sum test, p=0.04545 using only the F2 genotypes and p=0.01449 if the parental genotypes were included)."}]},{"head":"Analysis of the Cyclophilin Gene in Different S graminum Biotypes","index":16,"paragraphs":[{"index":1,"size":59,"text":"Eleven distinct S. graminum biotypes (NY, B, C, E, F, G, H, I, K, Ks, Flo) collected in the field and characterized by the Burd Lab [43] were analyzed to determine if there was a correlation between the presence of the vector allele of the cyclophilin gene and the ability to transmit CYDV-RPV among wild populations of the aphid."},{"index":2,"size":136,"text":"The NY population has been maintained in the Ithaca laboratory since the late 1950's and is an efficient vector of CYDV-RPV [44]. In addition to the NY biotype, three biotypes, F, G and H were efficient vectors of CYDV-RPV, whereas the remaining seven biotypes transmitted CYDV-RPV with lower efficiency (Figure 1). The analysis of the sequence of the cyclophilin cDNA identified 5 cyclophilin alleles from the various biotypes: 1 encoded the vector isoform and 4 encoded the The observed data is based on the 2D-DiGE analysis published previously [17]. The predicted data was obtained by in silico analysis of the sequenced cDNAs using the Expasy Compute pI/Mw tool (http://ca.expasy.org/tools/pi_tool.html). The difference in mass could be a result of a posttranslational or co-analytical modification or simply because SDS-PAGE is not an accurate way to measure molecular mass."},{"index":3,"size":59,"text":"nonvector isoform (Figure S2). The four efficient vectors, NY, F, G and H, encoded the vector isoform whereas the seven less efficient vectors were homozygous for the nonvector allele (Figure 1). Statistical analysis showed the biotypes encoding the vector allele of cyclophilin transmitted CYDV-RPV with significantly higher efficiency than the biotypes encoding only nonvector alleles (Wilcoxon rank-sum test, p=0.006061)."}]},{"head":"Direct Interaction of Schizaphis graminum Cyclophilin with Poleroviruses","index":17,"paragraphs":[{"index":1,"size":127,"text":"Next we tested ability the S28 and S29 cyclophilin isoforms to interact directly with purified CYDV-RPV virions. We evaluated this by in vitro co-immunoprecipitation between CYDV-RPV virions and cyclophilin proteins synthesized in E. coli. Both S28 and S29 were shown to interact with CYDV-RPV (Figure 2). The binding experiments are not quantitative and the amount of co-immunoprecipitated proteins is not easily compared between treatments. To determine if the S. graminum cyclophilin specifically binds to viruses transmitted by that aphid, the experiment was repeated using Potato leafroll virus (PLRV), a polerovirus related to CYDV-RPV, which is transmitted by M. persicae, but not by S. graminum. No definitive band was observed on the Western blot and a positive interaction between PLRV and S. graminum cyclophilin could not be validated."},{"index":2,"size":288,"text":"To perform a relative quantification of cyclophilin B to CYDV-RPV, we performed a bottom-up LC-MS-MS analysis of a co-IP between CYDV-RPV and a total aphid protein extract. Proteins were extracted from three genotypes of S. graminum proteins and the co-IP was performed as described in Yang et al. (2008). A full description of the aphid-RPV interactome will be described in a forthcoming manuscript. Surprisingly, cyclophilin B was not detected (data not shown). Instead, cyclophilin A was one of 30 proteins that were at least two-fold higher or unique in the co-IP reactions with virus compared to the negative control, p<0.05. Peptides specifically matching to cyclophilin A were detected in A3 and WY10A (vector genotypes) as well as C2, a nonvector genotype with only the nonvector allele (Dataset S2). Spectral counts were two-fold higher in the co-IP compared to the negative control indicating an enrichment of cyclophilin in the co-IP reactions with virus (Table 3). However, the spectral counts were not statistically different between vector (A3 and WY-10A) and the nonvector genotype (C2, Table 3). To further verify an enrichment of cyclophilin in the co-IP reactions, we compared the ion intensity chromatograms from the full scan MS data for two cyclophilin peptides that were selected for tandem MS and that had excellent retention time alignment across the replicates (Figure S3). The normalized total peak areas for these two peptides were significantly higher in the co-immunoprecipitation reactions as compared to the control reaction with no virus (Figure 3, P value = 0.022 and 0.027 using a Kruskal Wallis test, respectively), providing further support for an enrichment of cyclophilin A in the co-IP reactions. These data provide strong evidence that cyclophilin A also interacts either directly, or in complex, with CYDV-RPV."}]},{"head":"Discussion","index":18,"paragraphs":[{"index":1,"size":425,"text":"Proteomic and genomic analyses are not always in agreement due to biological, technical, or analytical factors. The proteomic and genomic analyses of the nonvector parent were in agreement; the S28 protein was the only protein observed [17] and the nonvector allele was the only transcript detected. The proteomic analysis [17] suggested the presence of two different cyclophilin B isoforms in the vector parent; however, the genomic results presented here indicate the vector parent was homozygous for the vector allele. A plausible explanation for the presence of two different protein isoforms in the proteomic analysis is the spontaneous deamination of glutamine that can occur in aqueous conditions [45]. The product of this deamination would be a protein of similar pI than the cyclophilin isoform present in the nonvector parent (S28). The spontaneous deamination of glutamine is a rate limiting reaction, and it could explain the difference in the amounts of both protein forms identified in the vector genotype where a (efficient vector biotype recently collected from a field in Wyoming) were subjected to cryogenic cell lysis and protein extraction. The extracted proteins were co-immonoprecipitated with purified CYDV-RPV using anti-RPV antibodies. Two peptides from cyclophilin were enriched in gentoypes A3, C2 and the field collected biotype WY-10A as compared to the control co-immunoprecipitation with no virus (aphid proteins incubated with beads and antibodies). Peptide FFDMTADGEQLR (2+ precursor m/z 793.369) was higher in intensity than the HTGPGILSMANAGANTNGSQFFTTVK peptide (3+ precursor m/z 912.871). This is not a good indicator of differences in relative abundance between the two peptides, which could result from different ionization efficiencies. However comparison of peak areas for each peptide across the various samples is an accurate way to measure relative abundance of the peptide in each sample. Both peptides showed similar trends in the experimental co-IPs compared to the control. Both peptides were more abundant in the co-IP reactions with virus. Although the peak areas showed an overall lower abundance in biotype WY10-A, which might reflect a lower overall expression of cyclophilin in this biotype as compared to the lab-reared F2 genotypes, this difference was not significant using a Kruskal Wallis test. doi: 10.1371/journal.pone.0071620.g003 much greater amount of the isoform S29 was detected when compared to the S28 [17]. A second explanation for this observation lies in the limitation of 2-D DIGE, the gel-based technology that was used to discover these isoforms. Using 2-D gels, a common problem is the co-migration of proteins with similar molecular weights and pIs [15]. A co-migrating protein with similar pI and MW as S28 could account for this difference."},{"index":2,"size":89,"text":"The proteomic analysis of three F2 vector genotypes identified that both cyclophilin isoforms (S28 and S29) were present. Unlike the parent, the relative amount of S28 was greater than S29 [17] so deamination is unlikely to be responsible for the high amount of S28, but a co-migrating protein could account for this difference. Genomic analysis of two of these three F2 genotypes (A3 and G11, G8 was lost) indicated that both alleles were present, which would account for the high levels of both cyclophilin isoforms observed on the gels."},{"index":3,"size":244,"text":"Surprisingly, none of the F2s analyzed were homozygous for the vector allele. However, because we only have analyzed 12 of the F2s and only 3 are good vectors, we may have a biased population. The correlation of the presence of the vector allele of cyclophilin with efficient CYDV-RPV transmission was extended to a number of field collected populations of S. graminum that can be separated into distinct biotypes [35]. Four of the 11 biotypes were efficient vectors of CYDV-RPV and all encoded the vector isoform of cyclophilin, whereas the seven biotypes showing lower vector efficiency only encoded the nonvector isoform. Genotypes lacking the vector isoform of cyclophilin but transmitting CYDV-RPV with lower efficiency express protein isoforms conferring vector competence [15,16]. In these genetic backgrounds, the nonvector isoform of cyclophilin may be sufficient to allow virus transmission. S. graminum biotypes can be divided into two categories according to the host plant preference: some biotypes are adapted to agronomic crops whereas others colonize wild grass species [46]. Previously, we had reported a correlation between virus transmission phenotype and host adaptation of S. graminum [47] and that the ability to colonize cultivated crops might have come at the expense of the ability to transmit viruses causing yellow dwarf disease. A role of cyclophilin in host adaptation is unknown, but the cyclophilin isoform may serve as a valuable biomarker to rapidly identify risk factors of S. graminium populations as virus vectors and pests of agronomic cereal crops [15]."},{"index":4,"size":345,"text":"Three of these nonvector F2 genotypes, C2, K2 and K3 were used in the proteomic analysis and only the S28 protein was detected. Similar to the nonvector parent that contained only the nonvector allele, a majority of the F2 genotypes with low transmission efficiencies were homozygous for the nonvector allele. Interestingly, the two nonvector genotypes that were identified as having both cyclophilin alleles (BB1 and K3) were found to have a strong salivary gland barrier and were lacking a hindgut barrier (Table 2) [28]. In these genotypes, virus is transported across the gut tissues similar as in the vector parental genotype. The nonvector parent and the F2 genotypes that were homozygous for the nonvector allele have at least a hindgut barrier to CYDV-RPV transmission (Table 2). Cyclophilin has not yet been localized to any particular aphid tissues, but these results lead to the hypothesis that the S29 isoform of cyclophilin may be involved in the efficient transport of CYDV-RPV across the hindgut of S. graminum. Although the accessory salivary gland is the site that determines vector specificity for most aphid-BYDV/CYDV combinations [2], the hindgut can act as a virus specific barrier and CYDV-RPV was shown to be a virus whose transport through the aphid is regulated at the hindgut [4]. Both isoforms of S. graminum cyclophilin B fused to a his tag interacted with CYDV-RPV but did not interact detectably with PLRV (Figure 2). PLRV is a polerovirus related to CYDV-RPV but with different vector specificities. There is one major difference in the circulative pathway PLRV and CYDV-RPV take through the aphid. CYDV-RPV is acquired through the hindgut of the vector S. graminum [9,48] whereas PLRV is acquire through the midgut of M. persicae [49]. The tissue tropism in the vector is determined by one of the virus structural proteins [7], but the virus must interact with different aphid proteins in the hindgut and midgut. If cyclophilin functions during hindgut transport of the virus as the genetic correlation data suggests, this would also provide a plausible explanation for the interaction with CYDV-RPV and not PLRV."},{"index":5,"size":309,"text":"The in vitro his-tagged cyclophilin interacted with CYDV-RPV but we did not detect this interaction using co-IP from total aphid protein homogenate. Yang et al. (2008) reported an interaction between CYDV-RPV and a single protein of the similar molecular weight and pI as cyclophilin B (S29) using co-IP-DIGE, but this protein was never identified to be cyclophilin using mass spectrometry [17]. The identification of a single protein assumed to be S29 as interacting with CYDV-RPV in the Yang et al. (2008) experiment conflicts with the his-tagging experiment (Figure 2) that showed both S28 and S29 interact with CYDV-RPV. Our co-IP experiment with aphid and CYDV-RPV indicates the potential involvement of a third cyclophilin protein, cyclophilin A. One hypothesis is that the protein spot from the co-IP-DIGE reported by Yang et al. 2008 contained cyclophilin A and not either of the two cyclophilin B isoforms or perhaps a mixture of both. The difference in results could be explained by the differences in techniques used and the detection limits of each analytical platform. Indeed the cyclophilin A identified in complex with CYDV-RPV has a predicted pI and MW of 9.45 and 22.8, respectively, very similar to the cyclophilin B isoforms. These new data on cyclophilin A provide a more parsimonious explanation for the discrepancy in the data from the his-tagging experiment reported here and the co-IP-DIGE observations reported previously [17]. Speculative and yet reasonable explanations for why we did not identify cyclophilin B using the co-IP-LC-MS/MS approach include (a) that cyclophilin A outcompeted cyclophilin B for binding CYDV-RPV in the presence of both cyclophilins, (b) the washing procedure removed cyclophilin B from the complex, or (c) that cyclophilin B was not detectable in the complex matrix of the co-IP due to the incubation time that was used. Incubation times are known to have an impact on protein recovery during co-IP [50]."},{"index":6,"size":249,"text":"The cyclophilin B 29 allele and isoform expression is predictive of vectoring capacity in S. graminum but binding of the cyclophilin proteins to CYDV-RPV is not. The reasons for the difference in transmission efficiency in these aphids when cyclophilin A and B from vector and nonvector aphids interact (directly or in complex) with CYDV-RPV are not clear. Both cyclophilins have a signal peptide that is predicted to be cleaved; however, we cannot exclude the possibility that they have different subcellular localization. The differing amino acid between the cyclophilin B isoforms is located in position 2 of the mature form. The glutamine residue present in the vector isoform is neutral whereas the glutamic acid residue in the nonvector isoform is acidic. This difference in charge may be responsible for changes in the tertiary structure of the protein resulting in different affinities for the virions or with other proteins. In spite of the in vitro interactions between cyclophilin A and B and CYDV-RPV, cyclophilin could be involved in virus transmission by another mechanism besides direct interaction with virions. Cyclophilins have been shown in complexes on mammalian cell surfaces despite the lack of domains explaining the association with plasma membranes [32]. Therefore, aphid cyclophilin proteins may be associated with other key plasma membrane proteins that function in virus recognition. In animals, cyclophilin proteins are now widely recognized to play diverse roles in virus-host interactions for vesicular stomatitis virus [51], coronavirus [52], human immunodeficiency virus [53], hepatitis C [54] and vaccina virus [55]."},{"index":7,"size":183,"text":"The precise roles of cyclophilin A or B in CYDV-RPV transmission have not been shown directly. However, the combination of genetic and biochemical data for a role in transmission is the strongest to date for any aphid protein being involved in virus transmission. Luteovirus transmission is a polygenic character governed by few major genes and several minor genes acting in an additive manner. Our results point to a role of these cyclophilin proteins in CYDV-RPV transmission, probably during crossing of the hindgut. The vector isoform of cyclophilin B (S29) does not appear to essential for CYDV-RPV transmission but might play an important role in facilitating the process. Continuing work is focused on localizing cyclophilin A and B in specific aphid tissues and providing evidence of an in vivo interaction of virus and cyclophilin in vector and nonvector aphid genotypes and aphid species. These results will help us to draw the boundary of how cyclophilin regulates yellow dwarf virus transmission. The results also highlight the importance of forging deeper connections between genomic and proteomic variation underlying complex phenotypes such as virus transmission by insects."}]}],"figures":[{"text":"Figure 1 . Figure 1. Transmission efficiency is correlated to presence of vectoring cyclophilin allele in field-collected aphid biotypes. Transmission efficiency is calculated as the number of plants infected with virus out of the number of plants infested with viruliferous aphids (five aphids per plant, 12 plants used). +/-indicates the detection of the vectoring allele. Biotypes NY and H were heterozygous. Biotypes NY, F, G, and H efficiently transmitted CYDV-RPV whereas Biotyoes B, I, and Fl did not transmit at all. Biotypes C, K and Ks transmitted with poor efficiencies. doi: 10.1371/journal.pone.0071620.g001 "},{"text":"Figure 2 . Figure 2. Interaction between the cyclophilin protein and CYDV-RPV and PLRV purified virus. His-tag cyclophilin vector (CV) and nonvector (CNV) isoforms were expressed in vitro in E. coli and co-immunoprecipitated with CYDV-RPV or PLRV. Co-immunoprecipitated proteins were detected with anti-his antibodies. First lane shows the synthesized cyclophilin protein. Interactions were notable between both isoforms and CYDV-RPV but not between PLRV and the vector isoform. doi: 10.1371/journal.pone.0071620.g002 "},{"text":"Figure 3 . Figure 3. Normalized peak areas from two cyclophilin A peptides show enrichment in co-immunoprecipitation experiments using aphid proteins and purified CYDV-RPV. Whole insects of genotypes A3, C2 and biotype WY-10A (efficient vector biotype recently collected from a field in Wyoming) were subjected to cryogenic cell lysis and protein extraction. The extracted proteins were co-immonoprecipitated with purified CYDV-RPV using anti-RPV antibodies. Two peptides from cyclophilin were enriched in gentoypes A3, C2 and the field collected biotype WY-10A as compared to the control co-immunoprecipitation with no virus (aphid proteins incubated with beads and antibodies).Peptide FFDMTADGEQLR (2+ precursor m/z 793.369) was higher in intensity than the HTGPGILSMANAGANTNGSQFFTTVK peptide (3+ precursor m/z 912.871). This is not a good indicator of differences in relative abundance between the two peptides, which could result from different ionization efficiencies. However comparison of peak areas for each peptide across the various samples is an accurate way to measure relative abundance of the peptide in each sample. Both peptides showed similar trends in the experimental co-IPs compared to the control. Both peptides were more abundant in the co-IP reactions with virus. Although the peak areas showed an overall lower abundance in biotype WY10-A, which might reflect a lower overall expression of cyclophilin in this biotype as compared to the lab-reared F2 genotypes, this difference was not significant using a Kruskal Wallis test. "},{"text":"Table 2 . Transmission efficiency of CYDV-RPV by analyzed F2 genotypes of S. graminum aphids and the encoded Cyclophilin alleles.  Transmission  Cyclophilin alleles TransmissionCyclophilin alleles Genotype efficiency Barrier encoded GenotypeefficiencyBarrierencoded Vector parent 92% None Vector allele Vector parent92%NoneVector allele Nonvector parent 0% Salivary gland and gut Nonvector allele Nonvector parent0%Salivary gland and gutNonvector allele A3 100% None Vector allele A3100%NoneVector allele CC6 75% None Vector allele CC675%NoneVector allele G11 83% None Vector allele G1183%NoneVector allele BB1 0% Salivary gland Vector and Nonvector allele BB10%Salivary glandVector and Nonvector allele C2 0% Gut Nonvector allele C20%GutNonvector allele CC1 0% Gut Nonvector allele CC10%GutNonvector allele CC2 8% Gut Nonvector allele CC28%GutNonvector allele CC5 0% Gut Nonvector allele CC50%GutNonvector allele K2 0% Salivary gland and gut Nonvector allele K20%Salivary gland and gutNonvector allele K3 0% Salivary gland Vector and Nonvector allele K30%Salivary glandVector and Nonvector allele LL3 0% Gut Nonvector allele LL30%GutNonvector allele MM1 0% Gut Nonvector allele MM10%GutNonvector allele Transmission efficiency is calculated as the number of plants infected with virus Transmission efficiency is calculated as the number of plants infected with virus out of the number of plants infested with viruliferous aphids (5 aphids per plant, 12 out of the number of plants infested with viruliferous aphids (5 aphids per plant, 12 plants used). Determination of transmission barriers in genotypes with low plants used). Determination of transmission barriers in genotypes with low transmission efficiency is described in [28].  transmission efficiency is described in [28].  "},{"text":"Table 1 . Comparison of the observed and the predicted pI and molecular mass for both cyclophilin isoforms.   Predicted pI from sequenced  Predicted mass from Predicted pI from sequencedPredicted mass from  Observed pI 2D DiGE cDNA Observed mass 2D DiGE sequenced cDNA Observed pI 2D DiGEcDNAObserved mass 2D DiGEsequenced cDNA S29/ CV 9 9.2 26.6 24.2 S29/ CV99.226.624.2 S28/ CNV 8.6 9.06 26.6 24.2 S28/ CNV8.69.0626.624.2  "},{"text":"Table 3 . Cyclophilin spectral counts in the coIP with CYDV-RPV and Schizaphis graminum proteins show more than 2-fold enrichment compared to negative control.     Vector      Nonvector   VectorNonvector  Control   WY10A   A3   C2   ControlWY10AA3C2 Replicate 1 2 3 1 2 3 1 2 3 1 2 3 Replicate123123123123 Spectral Counts 0 2 4 6 5 6 1 7 5 3 7 5 Spectral Counts024656175375 Totals 6   17   13   15   Totals6171315  "}],"sieverID":"ea9e322f-eb13-4a40-827d-e6a83c852526","abstract":"Yellow dwarf viruses cause the most economically important virus diseases of cereal crops worldwide and are transmitted by aphid vectors. The identification of aphid genes and proteins mediating virus transmission is critical to develop agriculturally sustainable virus management practices and to understand viral strategies for circulative movement in all insect vectors. Two cyclophilin B proteins, S28 and S29, were identified previously in populations of Schizaphis graminum that differed in their ability to transmit the RPV strain of Cereal yellow dwarf virus (CYDV-RPV). The presence of S29 was correlated with F2 genotypes that were efficient virus transmitters. The present study revealed the two proteins were isoforms, and a single amino acid change distinguished S28 and S29. The distribution of the two alleles was determined in 12 F2 genotypes segregating for CYDV-RPV transmission capacity and in 11 genetically independent, field-collected S. graminum biotypes. Transmission efficiency for CYDV-RPV was determined in all genotypes and biotypes. The S29 isoform was present in all genotypes or biotypes that efficiently transmit CYDV-RPV and more specifically in genotypes that efficiently transport virus across the hindgut. We confirmed a direct interaction between CYDV-RPV and both S28 and S29 using purified virus and bacterially expressed, his-tagged S28 and S29 proteins. Importantly, S29 failed to interact with a closely related virus that is transported across the aphid midgut. We tested for in vivo interactions using an aphid-virus co-immunoprecipitation strategy coupled with a bottom-up LC-MS/MS analysis using a Q Exactive mass spectrometer. This analysis enabled us to identify a third cyclophilin protein, cyclophilin A, interacting directly or in complex with purified CYDV-RPV. Taken together, these data provide evidence that both cyclophilin A and B interact with CYDV-RPV, and these interactions may be important but not sufficient to mediate virus transport from the hindgut lumen into the hemocoel."}

data/part_3/0727589365854871687023a6b39e206d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0727589365854871687023a6b39e206d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/4401fe26-a16b-4743-9a00-bba9c774e009/retrieve"},"pageCount":45,"title":"BUILDING THE CAPACITY OF LOCAL PARTNERS AND GOVERNMENT STAFF ON CLIMATE SMART AGRICULTURE TECHNOLOGIES AND CLIMATE CHANGE PROGRAMMING Training Workshop Report","keywords":[],"chapters":[{"head":"LIST OF TABLES","index":1,"paragraphs":[]},{"head":"INTRODUCTION","index":2,"paragraphs":[{"index":1,"size":68,"text":"Owing to the increasing impacts of climate change on agriculture and agro-allied sectors, the Alliance of Bioversity International and CIAT organized and facilitated a 4-day workshop under the Accelerating Impacts of CGIAR Climate Research for Africa (AICCRA) Project. The workshop aimed to build the capacity of stakeholders, including local partners and government staff in Kenya, on climatesmart agriculture technologies and mechanisms to integrate climate change into their programming."},{"index":2,"size":31,"text":"The workshop focused on key thematic areas critical in project development and implementation. These areas seek to enhance climate change mitigation and adaptation in agricultural production systems and are as outlined:"},{"index":3,"size":43,"text":"1. Agricultural value chains and the food systems approach 2. Gender and youth inclusion in climate change 3. Global, regional and national responses to climate change impacts 4. Designing and implementing a Climate Smart Agriculture Plan 5. Application of climate risk profiling output"}]},{"head":"BACKGROUND Accelerating the Impacts of CGIAR Climate Research for Africa","index":3,"paragraphs":[{"index":1,"size":55,"text":"Accelerating the Impacts of CGIAR Climate Research for Africa (AICCRA) is an initiative to strengthen access to climate-smart agriculture technologies and climate information services (CIS) in Africa. The World Bank funds the project through the International Development Association (IDA). The IDA grant strengthens research and capacity-building activities of CGIAR centers and initiatives alongside African partners."},{"index":2,"size":107,"text":"Core teams in Kenya, Ethiopia, Senegal, Mali, Zambia, and Ghana support AICCRA projects. Their work is embedded in collaboration on four themes: Knowledge, Innovation, Partnerships, Gender, and Social inclusion. The AICCRA -Kenya team, which includes The Alliance of Bioversity International and CIAT (The Alliance -ABC), International Livestock Research Institute (ILRI), and other partners, work in the country to build the resilience of agriculture and food systems. The project focuses on enhancing the quality of CIS, digital agricultural advisory services, and CSA by ensuring gender and social inclusion. The team aids the Kenyan government in bundling climate-smart technologies and innovation to support the building of climate change resilience."}]},{"head":"The Alliance of Bioversity International and CIAT","index":4,"paragraphs":[{"index":1,"size":54,"text":"As a key partner, the Alliance delivers research-based solutions that harness agricultural biodiversity and sustainably transform food systems to improve people's lives in a climate crisis. The solutions aim to address global challenges -climate change, biodiversity loss, environmental degradation, malnutrition, and poverty. The Alliance incorporates gender, diversity, and inclusion (GDI) in all its initiatives."},{"index":2,"size":92,"text":"Through the AICCRA project in Kenya, the Alliance encourages strategic collaborations with different partners and stakeholders. The development of the Kenya County Climate Risk Profiles for 45 counties is a significant milestone in the project. The Alliance additionally supports the project by training on capacity building on climate resilience and engaging the different stakeholders. Similarly, the Alliance has been at the forefront of supporting Universities to develop curricula responsive to climate change and resilience issues. A complement to these efforts is possible through stakeholderfocused demonstration farms that showcase replicable validated climate-smart technologies."}]},{"head":"About ChildFund","index":5,"paragraphs":[{"index":1,"size":122,"text":"ChildFund is a non-sectarian and not-for-profit development organization working in more than 30 countries worldwide to improve the well-being of about 15.2 million children and families, regardless of race, creed, religion, and gender. ChildFund Kenya works through 13 local partners (LPs) in 26 counties. The thematic areas that the organization focuses on are Child Protection, Household Economic Strengthening, Early Childhood Development, Education, WASH (Water, Sanitation, and Hygiene), Emergency Response, Health, and Nutrition. Their mission is three-fold. They seek to help deprived, excluded, vulnerable children improve their lives and become adults who bring positive changes to their communities. They promote societies that value, protect, and advance the worth and rights of children and enrich supporters' lives through their support of the organization's cause."}]},{"head":"Purpose of the Training","index":6,"paragraphs":[{"index":1,"size":86,"text":"Kenya is vulnerable to climate change (CC) impacts characterized by the increase in average annual temperature, high intensity, and increased frequency of extreme climate and weather events throughout the country, including extended periods of drought, flooding, storms, and landslides, among others. The impacts of climate change have been exacerbated by inadequate knowledge of feasible adaptation and mitigation technologies making the affected communities highly vulnerable to climate change impacts. This state presents significant food security and water availability challenges, especially in Kenya's Arid and Semi-Arid Lands (ASALs)."},{"index":2,"size":128,"text":"Children are usually the most affected by the impacts of Climate Change as they are more vulnerable to chronic hunger and malnutrition due to unavailability or lack of sufficient food. Similarly, there are many unfortunate instances where they are subjected to child labor and early marriages and are forced to miss classes and drop out of school. This situation highlights the need to promote climate adaptation and mitigation strategies among vulnerable communities to protect their livelihoods. The training, therefore, aimed to increase the skills of the partners and stakeholders in the implementation of CSA programs that could boost the resilience of vulnerable communities. The severity of the climate change impacts could also depend on how the vulnerable communities can adapt and mitigate against the effects of climate change."}]},{"head":"The specific objectives were:","index":7,"paragraphs":[{"index":1,"size":1,"text":"i."},{"index":2,"size":20,"text":"To build the capacity of county staff and development partners on climate change adaptation and mitigation in Kenya's drylands ii."},{"index":3,"size":26,"text":"To understand the concepts and impacts of climate change, development of gender and nutrition-sensitive value chains and global, regional, and national responses to climate change iii."},{"index":4,"size":17,"text":"To develop the capacity of county-level partners in designing and implementing Climate Smart Agriculture (CSA) action plans"}]},{"head":"Scope of the Training","index":8,"paragraphs":[{"index":1,"size":55,"text":"The training targeted Local Partner staff in Arid and Semi-Arid Lands (ASALs) in Turkana, Samburu, Isiolo, Marsabit, Baringo, Kajiado, and Machakos. The training focused on soil and water management, developing sustainable and inclusive climate-smart food chains of crops and livestock for increased food production in ASAL areas, and coordinating stakeholders' initiatives and financing of CSA."},{"index":2,"size":16,"text":"The Alliance provided and used a clear training plan that included relevant topics as outlined below:"},{"index":3,"size":48,"text":"• Introduction to Climate Change • Agricultural value chains, The food systems approach, Gender, and nutrition-sensitive value chains The training workshop was officially opened by Child Fund (CF), followed by welcoming remarks. Participants briefly introduced themselves and later highlighted aspects of climate change (CC) based on their expertise."},{"index":4,"size":16,"text":"• CC results from human activities, e.g., industrialization, land use change, deforestation, or fossil fuel burning."},{"index":5,"size":15,"text":"• Community capacity building should be done to build the adaptive capacity of agricultural systems."},{"index":6,"size":28,"text":"• CC affects the socio-economic dimensions through damages to residential and commercial properties because of floods and increased natural resources management degradation due to drought and temperature-related wildfires."},{"index":7,"size":19,"text":"• CC leads to environmental problems, e.g., water pollution, drought, floods, and extreme temperatures impacting human health and well-being."},{"index":8,"size":38,"text":"• Everyone is responsible for climate change, and individual action is required to curb climate change. CC has no border; its effects have the potential to impact every corner of the world, so it must be addressed globally"},{"index":9,"size":32,"text":"• CC exacerbates the poverty level as many people living in poverty are forced to live in high-risk zones and have limited capacity to relocate in the face of extreme weather/climate events."},{"index":10,"size":27,"text":"• CC leads to food insecurity due to changes in weather patterns, such as delayed rainfall, adversely impacting crop and livestock production in many parts of Kenya."},{"index":11,"size":27,"text":"CF noted that climate change gravely affects agricultural production owing to Kenya's overdependence on rainfed agriculture, emphasizing the significance of climate-smart agriculture (CSA), hence the workshop's importance."},{"index":12,"size":1,"text":"Caroline  "}]},{"head":"Dorcas from ABC introduced the workshop objectives and AICCRA work in Kenya","index":9,"paragraphs":[{"index":1,"size":43,"text":"A needs assessment on workshop objectives was conducted through questions in a google document form that participants filled out. The assessment aimed to gauge the understanding of climate change issues among the participants and identify the key areas relevant to the training workshop."}]},{"head":"Session 2: Introduction to climate change","index":10,"paragraphs":[{"index":1,"size":73,"text":"Before introducing the topic, a group activity was conducted to gauge their understanding or knowledge of common terms used in climate change. The activity, termed a matching game involved the distribution of leaflets of papers, one with terminology and the other with a definition. Each group was required to match a particular climate change concept/terminology with its correct description. Five groups were formed to enhance interactive participation and accommodation of all the participants."}]},{"head":"Group activity on climate change concepts and definitions","index":11,"paragraphs":[{"index":1,"size":16,"text":"The climate change definitions and concepts used for the group activity are outlined in table 1. "}]},{"head":"Terminology Definition","index":12,"paragraphs":[]},{"head":"Adaptation","index":13,"paragraphs":[{"index":1,"size":25,"text":"Adaptation is adjusting to actual or expected climate and its effects. In human systems, adaptation seeks to moderate or avoid harm or exploit beneficial opportunities."}]},{"head":"Adaptive capacity","index":14,"paragraphs":[{"index":1,"size":25,"text":"Adaptive capacity is the ability of systems, institutions, humans, and other organisms to adjust to potential damage, take advantage of opportunities, or respond to consequences."}]},{"head":"Climate change","index":15,"paragraphs":[{"index":1,"size":42,"text":"Climate change refers to a change in the state of the climate that can be identified (e.g., by using statistical tests) by changes in the mean and the variability of its properties, which persists for an extended period, typically decades or longer."}]},{"head":"Climate variability","index":16,"paragraphs":[{"index":1,"size":59,"text":"Climate variability refers to variations in the mean state and other statistics (such as standard deviations and the occurrence of extremes) of the climate on all spatial and temporal scales beyond that of individual weather events. Variability may be due to natural internal processes within the climate system (internal variability) or natural or anthropogenic external forcing (external variability) variations."}]},{"head":"Disaster","index":17,"paragraphs":[{"index":1,"size":51,"text":"Severe alterations in the normal functioning of a community or a society due to hazardous physical events interacting with vulnerable social conditions, leading to widespread adverse human, material, economic, or environmental effects that require an immediate emergency response to satisfy critical human needs and that may require external support for recovery."}]},{"head":"Greenhouse gas (GHG)","index":18,"paragraphs":[{"index":1,"size":37,"text":"Greenhouse gases are those gaseous constituents of the atmosphere, both natural and anthropogenic, that absorb and emit radiation at specific wavelengths within the spectrum of terrestrial radiation emitted by the Earth's surface, the atmosphere itself, and clouds."}]},{"head":"Hazard","index":19,"paragraphs":[{"index":1,"size":45,"text":"A hazard is the potential occurrence of a natural or humaninduced physical event or trend or physical impact that may cause loss of life, injury, or other health impacts, as well as damage and loss to property, infrastructure, livelihoods, service provision, ecosystems, and natural resources."}]},{"head":"Mitigation (of climate change)","index":20,"paragraphs":[{"index":1,"size":16,"text":"Mitigation is a human intervention to reduce the sources or enhance the sinks of greenhouse gases."}]},{"head":"Resilience","index":21,"paragraphs":[{"index":1,"size":44,"text":"Resilience refers to the capacity of social, economic, and environmental systems to cope with a hazardous event or trend, or disturbance, responding or reorganizing in ways that maintain their essential function, identity, and structure while also maintaining the capacity for adaptation, learning, and transformation."}]},{"head":"Risk","index":22,"paragraphs":[{"index":1,"size":58,"text":"Risk refers to the potential for consequences where something of value is at stake and the outcome is uncertain, recognizing the diversity of values. Risk is often represented as the probability of occurrence of hazardous events or trends multiplied by the impacts of these events or trends that occur-risk results from the interaction of vulnerability, exposure, and hazard."}]},{"head":"Sensitivity","index":23,"paragraphs":[{"index":1,"size":61,"text":"Climate variability or change affects the degree to which a system or species is adversely or beneficially affected. The effect may be direct (e.g., a change in crop yield in response to a change in the mean, range, or variability of temperature) or indirect (e.g., damages caused by an increase in the frequency of coastal flooding due to sea level rise)."}]},{"head":"Vulnerability","index":24,"paragraphs":[{"index":1,"size":32,"text":"Vulnerability is the propensity or predisposition to be adversely affected. Vulnerability encompasses a variety of concepts and elements, including sensitivity or susceptibility to harm and lack of capacity to cope and adapt."},{"index":2,"size":83,"text":"In this session, the key terms used in the field of climate change and their application were extensively discussed. The climate-related stresses and shocks were differentiated whereby: climate-related stress is long-term trends or pressures that undermine the stability of a system and increase vulnerability within it, e.g., delayed onset of rainfall, while climaterelated shocks are external short-term deviations from long-term trends that have substantial adverse effects on people's current state of well-being or their ability to withstand future shocks, e.g., floods, drought, wildfires."},{"index":3,"size":36,"text":"The climate scenarios and impacts were also presented in the session. Participants were also allowed to identify climate change impacts and how they affect their work area. Some examples of the most common hazards highlighted included:"},{"index":4,"size":91,"text":"• Flash floods, for example, in Kisumu, Narok, and Turkana  Another term defined is the \"Food system,\" which refers to the interconnections between how we produce, process, transport, buy, consume, and dispose of the food we eat and how this affects us as individuals and consumers. The food system includes the governance and economics of food production, its sustainability, the degree to which food is wasted, how food production affects the natural environment, and the impact of food on individual and population health. Dimensions and drivers of food systems were highlighted. "}]},{"head":"Impacts of CC on Food systems","index":25,"paragraphs":[{"index":1,"size":31,"text":"Participants pointed out some of the impacts of CC on the food system, which included: • Food loss is due to the increase in the rate of food spoilage and wastage."},{"index":2,"size":14,"text":"• Health risks due to increased conditions favoring pests and diseases in food products."},{"index":3,"size":12,"text":"• Food production and price volatility because of uncertainties in agricultural production."},{"index":4,"size":15,"text":"• Inappropriate transportation that damages key infrastructure affects the delivery of agricultural goods and services"},{"index":5,"size":8,"text":"Noel Templer presenting on CC and Food systems"}]},{"head":"Nutrition-sensitive value chain","index":26,"paragraphs":[{"index":1,"size":29,"text":"Nutrition sensitive value chain was defined as a food value chain that has been shaped to alleviate constraints in the supply or demand of food related to nutrition problems."},{"index":2,"size":42,"text":"Why do nutrition-sensitive VCs matter? a. They address nutritional problems, primarily in terms of diet quality. b. They add value as they consider the economic value and nutritional value c. Chain because they encompass investments at various stages along the value chain."},{"index":3,"size":99,"text":"The following nutrition-sensitive interventions at different levels were mentioned: 1. Inputs -Introducing labor-saving technologies that save time, money, and energy and can be used in other activities. Improved seeds that are more nutritious or resistant to crop pests or diseases. 2. Production -Improved agricultural practices such as pruning and using greenhouses or other controlled environments may permit crop diversification. 3. Processing and storage -Processing at the cooperative level rather than at the household level, packing horticultural products at the cooperative level could add value, and developing a local market for horticultural crops that do not meet export quality standards."}]},{"head":"Gender, climate change, and agriculture nexus","index":27,"paragraphs":[{"index":1,"size":68,"text":"Ivy Kinyua led the discussion. Gender productivity gaps exist in agriculture due to genderbased discrimination. It has been recorded that women have fewer privileges, entitlements, and endowments. Women mostly face challenges in accessing the available resources. CC affects gender-based issues, therefore the need for gender-responsive approaches. Genderresponsive approaches aim to give women and men the same incentives and opportunities to invest in or adopt climate-smart practices in agriculture."},{"index":2,"size":55,"text":"Youth and agriculture: Many young people are actively engaged in Kenya's agri-food value chains as producers and traders of food, as workers, innovators, entrepreneurs, and as policy actors. Unfortunately, despite their large numbers and diversified roles, youth's economic, social, and political contribution to agri-food systems is frequently underestimated due to a lack of disaggregated data."},{"index":3,"size":39,"text":"The following myths were given about youth and agriculture: 1. The average age of a farmer is over 50 years 2. We need to make agriculture more attractive for youth engagement Why should the youth be involved in agriculture?"},{"index":4,"size":8,"text":"• The youth are receptive to new ideas."},{"index":5,"size":8,"text":"• The youth are digitally knowledgeable and creative."},{"index":6,"size":8,"text":"• The youth are enthusiastic about their future."},{"index":7,"size":56,"text":"In closing the day's activities, participants were divided into 5 groups and engaged in an interactive activity. The groups developed nutrition-sensitive value chains of a crop and livestock. The value chain analysis was based on the following:  The social role covers attitudes and behaviors that most people consider appropriate and acceptable based on prevailing societal norms."}]},{"head":"Gender Analysis","index":28,"paragraphs":[{"index":1,"size":59,"text":"The study or examination of the impact of policies, projects, and programs involving men, women, boys, and girls and trying to mitigate the negative consequences thereof. Gender empowerment It is transforming stereotypes, attitudes, norms, and practices by challenging power relations, rethinking gender norms and binaries, and raising critical consciousness about the root causes of inequality and systems of oppression."}]},{"head":"Gender Equality","index":29,"paragraphs":[{"index":1,"size":12,"text":"A state where everyone benefits from the same support/program involves equal treatment."},{"index":2,"size":88,"text":"Gender Mainstreaming A strategy of making women's and men's concerns and experiences integral in the decision-making, design, implementation, monitoring, and evaluation of policies and programs in all political, economic, and societal spheres. The goal is to achieve equality. Women empowerment Women take charge of their own lives, starting their agendas, gaining skills, increasing self-confidence, solving problems, and developing self-reliance. Gender responsiveness The term refers to where outcomes can be achieved by ensuring that both men and women are included equitably in the activities of a program or project."}]},{"head":"Gender awareness","index":30,"paragraphs":[{"index":1,"size":12,"text":"Fairness of treatment for women and men according to their respective needs."}]},{"head":"Gender-sensitive","index":31,"paragraphs":[{"index":1,"size":50,"text":"Ability to acknowledge gender differences and to develop strategies to address gender norms, roles, and access to resources so far as it is needed to reach project goals. Gender-blind A situation where gender dimensions are ignored or not addressed in a project or research. Gender biases in society are ignored."}]},{"head":"Gender-neutral","index":32,"paragraphs":[{"index":1,"size":46,"text":"This is when gender is not considered relevant to developmental outcomes. Gender transformative This means integrating a gender equality perspective at all stages and levels of policies, programs, and projects. Gender lens A society considers behaviors, tasks, and responsibilities appropriate for men, women, boys, and girls."},{"index":2,"size":37,"text":"A clear distinction was made between gender and sex: Gender is a socio-cultural construct according to the roles and responsibilities of men and women in society, while sex is a biological construct of being male or female."},{"index":3,"size":120,"text":"In understanding societal biases, 2 activities were done. Participants were engaged in the tag game involving green and pink sticky notes placed on the hand or forehead; they were asked to group themselves. By default, groupings were done according to sticky note colors and how well the delegates knew one another (colleagues or friends). In the second activity, the delegates divided themselves into 2 groups and assigned several adjectives to categorize as either masculine or feminine on flip charts. The activity indicated that, generally, humans have unconscious or implicit biases. For instance, independent, competent, decisive, ambitious, and rational adjectives were categorized as masculine, while dependent, incompetent, emotional, unambitious, and irrational were considered feminine. Key takeaway points from the activities were:"},{"index":4,"size":14,"text":"• Unconscious or implicit biases may affect outcomes on diversity, equity, and social inclusion"},{"index":5,"size":16,"text":"• Project managers, implementers, and technical officers need to understand these biases for effective project implementation "}]},{"head":"Climate change impacts","index":33,"paragraphs":[{"index":1,"size":3,"text":"• Crop failure"}]},{"head":"Gender inequality implications","index":34,"paragraphs":[{"index":1,"size":12,"text":"• Strain in household food/water/fuel provision • Increased workload &fuel/water collection time"}]},{"head":"• Higher mortality incidences","index":35,"paragraphs":[{"index":1,"size":8,"text":"• Lack of healthcare access/increased burden on caregivers"},{"index":2,"size":8,"text":"• Forced migration increasing women's, children's etc vulnerability"}]},{"head":"• Loss of lives","index":36,"paragraphs":[{"index":1,"size":25,"text":"• Violence agsinst women seeks to achieve. . The policies, strategies, and legislation provide a roadmap for a course of actions with a specific target/goal. "}]},{"head":"National responses to climate change","index":37,"paragraphs":[{"index":1,"size":50,"text":"A brief discussion on the cobra effect and the lift of the GMO ban in Kenya helped participants understand the national policy priorities in Kenya regarding agriculture. The participants noted that the lift would harm production as farmers are now prohibited from sharing, exchanging, or selling uncertified and unregistered seeds."},{"index":2,"size":50,"text":"The presentation on national responses highlighted that national climate policies should be embedded in the global context. The present county government officials and NGOs partners were urged to follow suit by incorporating climate policies in the development of their project proposals and programs with a special focus on: Global responses "}]},{"head":"Session 3: NDCs, carbon sequestration, and carbon credits","index":38,"paragraphs":[{"index":1,"size":54,"text":"The presentation highlighted that NDCs are building blocks for climate change mitigation and adaptation. These are actions that parties to the Paris Agreement undertake to address climate change. The Parties prepare their respective NDC with updates every 5 years (from 2015) that should be more ambitious than the previous one regarding addressing climate change."}]},{"head":"NDCs in Kenya","index":39,"paragraphs":[{"index":1,"size":73,"text":"Kenya's first NDC submission to the UNFCCC was in 2015, followed by 2020. The 2020 NDCs aim to reduce GHG emissions by 30% relative to the BAU scenario by 2030 and mainstream climate change adaptation and resilience in all sectors. Prioritized GHG gases are carbon dioxide, methane, and nitrous oxide. The agricultural sector is a key contributor to GHG emissions, with livestock accounting for 96.2% and cropland for 3.8%. Priority mitigation activities include:"},{"index":2,"size":12,"text":"• Increasing renewables in the electricity generation mix of the national grid."},{"index":3,"size":11,"text":"• Enhancement of energy and resource efficiency across the different sectors."},{"index":4,"size":14,"text":"• Increasing tree cover of at least 10% of the land area of Kenya. "}]},{"head":"Carbon cycle","index":40,"paragraphs":[{"index":1,"size":24,"text":"The constant movement of carbon from the land and water through the atmosphere and living organisms, which is important for Earth's processes Carbon sink"},{"index":2,"size":11,"text":"Reservoirs that retain carbon and keep it from entering Earth's atmosphere."}]},{"head":"Carbon credit","index":41,"paragraphs":[{"index":1,"size":31,"text":"Carbon offset permits one party to emit a given amount of GHG gas(es). Typically, 1 credit permits the emission of 1 tonne of CO2 or its equivalent of other GHG gases."},{"index":2,"size":76,"text":"The participants were engaged in a brief discussion that pointed out that forests, soils (the largest carbon sink), and oceans are major carbon sinks worldwide. The concept of carbon credit was then introduced. A carbon credit is a tradable certificate or permit representing the right to emit a set amount of carbon dioxide or other GHGs. It represents 1 tonne of CO2 that an organization is permitted to emit. Examples of credits in Kenya were given:"},{"index":3,"size":58,"text":"• Carbon credits from SLMPs in Western Kenya are generated from sustainable land management. The credits represent a reduction in the emission of 24,788 metric tonnes of CO2 The CSA approach moves beyond the farm level to consider factors supporting the successful adoption of interventions while addressing the synergies and trade-offs between productivity, adaptation, and mitigation in agriculture."},{"index":4,"size":6,"text":"The various levels of CSA are:"},{"index":5,"size":38,"text":"• Farm level Ivy conducted an open discussion on the characteristics of a future thinker. Some answers were: Determined, open to possibilities, grounded, willing to test his beliefs, sees the larger picture and enjoys interacting with new data."}]},{"head":"Introduction to foresight","index":42,"paragraphs":[{"index":1,"size":54,"text":"The purpose of this session was to introduce foresight to help understand past trends and how we can embed our climate-smart practices and services. What is foresight? Foresight is looking at the past and presents to envision and prepare for different futures, allowing us to make strategic decisions today. There were three guiding questions:"},{"index":2,"size":6,"text":"• What seems to be happening?"},{"index":3,"size":4,"text":"• What might happen?"},{"index":4,"size":7,"text":"• What do we need to do?"},{"index":5,"size":45,"text":"The foresight process has three core time frames; back into the past, assessing what is happening now in the present, and anticipating the future. The premise of foresight is that the future is still in the making and can be actively influenced or even created."}]},{"head":"Long term planning","index":43,"paragraphs":[{"index":1,"size":39,"text":"It was noted that long-term planning could be challenging due to the time frame that extends across multiple decades and the need to deal with complex socio-economic and biophysical systems. Long-term planning is subject to great uncertainties, such as:"},{"index":2,"size":4,"text":"• Future climate impacts."},{"index":3,"size":5,"text":"• Technological innovation and deployment."},{"index":4,"size":5,"text":"• Policy development and implementation."},{"index":5,"size":5,"text":"• Availability of large-scale solutions."},{"index":6,"size":11,"text":"• Reliability of current data, models, and skills to interpret evidence."},{"index":7,"size":159,"text":"Ivy stated that regardless of the challenges presented above in long-term planning, there is a need to plan for transformational change. Transformative change sometimes requires radically new interventions, policies, and partnerships. It requires disruptive technology, which can be defined as any innovation that dramatically changes how consumers, businesses, and industries operate. It also moves us beyond incremental change and results in major long-term changes in how systems operate. The Key findings from the developed CRPs: i. Production largely depends on erratic rainfall, the opportunity for efficient, lowcost irrigation, dissemination of climate info, and EWS. ii. Low input use, conventional farming methods, the need for upscaling adoption of inputs, integration with ITK. iii. High food poverty and food insecurity rates despite dominance in food crop production; need to boost production for affordable and nutritious food. iv. Low access to water and energy resources, pointing to investment in infrastructure. v. High youth and women involved in agriculture space can be exploited"}]},{"head":"Climate risk profiling","index":44,"paragraphs":[]},{"head":"Potential adaptation options from the CRPs:","index":45,"paragraphs":[{"index":1,"size":33,"text":"• Building agricultural resilience among smallholder farmers through Agricultural Insurance • Upscaling of improved animal breeds, new plant species, and varieties that are commercially sustainable and resistant to different climate risks and hazards."},{"index":2,"size":12,"text":"• Strengthening Climate Information Services (CIS) and agro weather advisories for farmers."},{"index":3,"size":14,"text":"• Continuous participatory Capacity Building on Climate Smart Agriculture technologies, innovations, and management practices."},{"index":4,"size":22,"text":"• Improve market linkages by integrating the value chains, increasing market accessibility, and enabling producers to attract and bargain with large-scale buyers."},{"index":5,"size":12,"text":"Policy and environment -the National climate policies and strategies guiding counties are:"},{"index":6,"size":22,"text":"Challenges facing implementing these policies include inadequate funding, weak coordination between the private and public sectors, and inadequate technical expertise and skills."},{"index":7,"size":119,"text":"Recommendations from the County Risk Profiles 1. Establishing financial literacy and credit access programs in the agriculture sector can improve their ability to adopt climate-smart technologies, innovations, and management practices. 2. Climate projections call for the wide adoption of adaptation strategies in agriculture and climate-proofing infrastructure. 3. Lack of access to agricultural markets affects agriculture's overall profitability and resilience. As a result, the improved market systems can significantly influence the adoption of CSA practices and technologies. 4. Build multi-stakeholder and cross-sectoral relationships, platforms, or partnerships (For knowledge sharing and learning, e.g., National CSA MSP, County CSA MSP) 5. Climate and market uncertainty necessitate initiatives to improve access to information and advisory services to assist actors in making informed decisions. "}]},{"head":"Conclusion","index":46,"paragraphs":[{"index":1,"size":77,"text":"George of CF thanked all participants for preparing the CSA action plans and urged them to finetune them for the 2023 project activities. The awarding of certificates was done by Dorcas (CIAT) and Carol (CF). Benard (MoALFC), Mutunga (ECDP), Lenana, and Tarimo of Matonyok acknowledged the importance of the workshop and thanked the facilitators. Templer and Carol made closing remarks, thanked the participants, and asked them to be ambassadors of advocating for climate resilience in their communities. "}]}],"figures":[{"text":" Climate change terminologies ................................................................................................. Table 2: Gender terminologies ............................................................................................................ Table 3: Climate change impacts on GBV ............................................................................................ Table 4: Terminology definitions ......................................................................................................... Table 5: Sample of strengths, opportunities, and challenges in CSA action plans.............................. "},{"text":" change. Some of the specific objectives for the workshop provided were in line with County goals of strengthening household resilience and disaster risk management: Climate resilience, Gender representation, and Nutrition-sensitive value chains Caroline Ngunge from CF giving the keynote speech on behalf of the Director The Alliance introduced the workshop objectives by first introducing their work and highlighting the thematic areas under which the work hinges, including an overview of AICCRA in Kenya. AICCRA, a World Bank-funded project, aims to accelerate the investment and impacts of CGIAR Climate Research in Africa. Capacity building for climate resilience is critical in the process. AICCRA components include: ▪ Knowledge and services through the development of decision support tools to tailor adaptation intervention and innovation ▪ Partnerships in delivery (The Alliance is a partner) ▪ Climate Smart Agriculture (CSA) technologies promotion and improving access to CIS AICCRA supports projects in several different areas across Kenya, including ASAL areas. Partnerships have been established with local universities, i.e., Taita Taveta, Murang'a, and Chuka universities, and smallholder farmers through the established demonstration sites or baby plots to promote replicable CSA production technologies and approaches. The projects also focus on small and medium enterprises (SMEs). AICCRA partners in Kenya include CIAT, ILRI, and CIP. The following specific objectives of the workshop were: ▪ To build the capacity of county implementers on the impacts of climate change in Kenya's drylands ▪ To understand the impact of climate change on agricultural value chains, gender, and vulnerable groups (women, youth, and children) ▪ To understand the global, regional, and national responses to climate change ▪ To develop county-level climate-smart agriculture (CSA) action plans "},{"text":"Session 3 : Agricultural value chains, the food systems approach, gender, and nutritionsensitive value chain Templer introduced the topic by defining terms. \"Agriculture value chain\" is a set of actors and activities that entail agricultural production from the fields to final consumption. In agricultural value chains, value added is the price paid by an actor subtracted from the price received by the other actor. Value chains can be mapped and analyzed using value chain analysis (VCA) which examines each step from production to consumption. An individual task was conducted where each participant identified a value chain they are working on or might be interested in working with after the training and in which county. Two examples of agricultural value chains mentioned by the participants are indicated below. "},{"text":"Figure 1 : Figure 1: Dimensions and drivers of a food system "},{"text":" Availability to Consumers • Affordability for Vulnerable Households • Time and Energy Constraints for Women • Food Safety, Health, and Environmental Risks to Households • Project constraints • Project enablers WEDNESDAY 26 TH OCTOBER Session 1: Day 1 recap and presentation on Gender and Climate Change by Ivy Kinyua The session was opened by Bernard Kirtur (IP-CF), who facilitated Day 1 recap. The participants were engaged in a circle-with-a-ball game, each stating what they had grasped from Tuesday's session. The positive feedback set a good tone for the day's sessions.Ivy Kinyua facilitating the gender and climate change sessionIvy facilitated the session's topic, \"A Gender inclusive response to a changing climate.\" A brief Q&A session alongside a video presentation provided an understanding of gender concepts, definitions, and terminologies as summarised in the table: "},{"text":"Figure 2 : Figure 2: Global (left) and regional (right) policy interventions Videos on the Paris Agreement were played for clarity on its objectives. The agreement is a binding treaty on climate change by 196 Parties adopted in 2015. The treaty provides technical, financial, and capacity-building support to the Parties especially developing countries. The goal is to hold average increases in global temperature to 2 °C and preferably to 1.5 °C. Accountability is done every 5 years through the parties' Nationally Determined Contributions (NDCs). Other focuses of the treaty include: • Establish net zero emissions (carbon neutrality) • Save and increase forest cover • Increase ability to adapt to climate change "},{"text":" Carbon credits from the Mikoko Pamoja project, community-led mangrove conservation and restoration project in Kwale County (Gazi Bay) since 2010. The total carbon stock of the mangroves was estimated at 20 million Mg CO2. The participants, divided into 4 groups, were engaged in an activity called \"Institutional mapping and synergies for climate change adaptation and mitigation.\" Their organizational project activities were categorized according to policies and level of operations guided by the framework:Group activity: Mapping synergies for climate change adaptation and mitigation NB: The different colors of sticky notes should represent different organizations and their role in climate adaptation and mitigation at the sub-national, national, and regional levels. "},{"text":" Dorcas made the presentation on climate risk profiling. It was noted that CGIAR had developed climate risk profiles for 45 counties in Kenya, excluding Mombasa and Nairobi counties. The link below was shared with the participants to access all the developed CRPs. https://ccafs.cgiar.org/publications/csa-country-profiles Dorcas Jalang'o presenting a brief on CRPs Objectives of CRPs: 1. Provide information on the current climate and possible future climate scenarios. 2. Identify climate-related vulnerabilities and risks for major agricultural value chains. 3. Identify adaptation options that address climate risks/vulnerabilities. 4. Assess the institutional capacity to deliver adaptation programs. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"DAY 1: TUESDAY 25 TH OCTOBER Session 1: Introduction and Welcome remarks  • Gender and Climate Change • Gender and Climate Change • Global, regional, and national responses to Climate Change • Global, regional, and national responses to Climate Change • Nationally Determined Contributions (NDCs); Carbon sequestration and Carbon credits • Nationally Determined Contributions (NDCs); Carbon sequestration and Carbon credits • Climate Smart Agriculture approach • Climate Smart Agriculture approach • Introduction to the foresight and short-term and long-term planning • Introduction to the foresight and short-term and long-term planning • Climate Risk Profiling • Climate Risk Profiling Methodology Methodology The training involved interactive sessions through Q&A, group activities, and presentations. Group The training involved interactive sessions through Q&A, group activities, and presentations. Group activities focused on the following topics: activities focused on the following topics: • Matching game on Climate Change concepts and definitions • Matching game on Climate Change concepts and definitions • Gender, youth, and nutrition-sensitive value chain analysis • Gender, youth, and nutrition-sensitive value chain analysis • Gender inclusion in resource governance and management • Gender inclusion in resource governance and management • Institutional mapping and synergies for Climate Change adaptation and mitigation • Institutional mapping and synergies for Climate Change adaptation and mitigation • Developing CSA action plans • Developing CSA action plans Presentations were done on: Presentations were done on: • International responses to climate change • International responses to climate change • Carbon credits • Carbon credits  "},{"text":"Table 1 : Climate change terminologies  "},{"text":"Table 2 : Gender terminologies Gender Equity A state where individuals are given different support to Gender EquityA state where individuals are given different support to  participate equally. participate equally. Gender liberation A state where inequity is addressed and all systemic barriers are Gender liberationA state where inequity is addressed and all systemic barriers are  removed to allow the involvement of all removed to allow the involvement of all Gender roles  Gender roles  "},{"text":"Table 3 : Climate change impacts on GBV • Stereotypes reflect what is seen or heard daily, not what we consciously believe or • Stereotypes reflect what is seen or heard daily, not what we consciously believe or what we see and hear what we see and hear • Unconscious gender bias stems from traditions, norms, values, culture, and • Unconscious gender bias stems from traditions, norms, values, culture, and experience experience Gender-climate change-agriculture nexus Gender-climate change-agriculture nexus Contrary to the popular opinion that gender-based violence (GBV) affects females only, it was Contrary to the popular opinion that gender-based violence (GBV) affects females only, it was established that it affects both females and males. Climate change impacts contributed to established that it affects both females and males. Climate change impacts contributed to GBV as summarised: GBV as summarised:  "},{"text":"Session 2: Presentation on global, regional, and national responses to climate change by Dorcas Jalango and Ivy Kinyua Policy interventions are crucial to address climate change; hence the session began by describing what a policy is -\" A document that outlines what a government or an individual  "},{"text":" Establishing a temperature goal below 2 °C to 1.5 °C • Enhancing adaptive capacity, strengthening resilience, and reducing vulnerability to climate change • Establishing a link between adaptation, resilience, and mitigation • Making finance flows commitments consistent with low emission and climate-resilient development Kenya has made progress in climate change policy establishment, with the Ministry of Environment and Forestry having the mandate for national policy guidance on climate change. The ministry collaborates with other ministries and institutions, including MoALFC, NEMA, KALRO, KEFRI, and KDB. It was recommended that delegates refer to the Kenya Climate Smart Agriculture Strategy 2017-2026 and Kenya Climate Smart Agriculture Implementation Framework 2018-2027 for projects.  Regional responses Regional responses • Paris Agreement • Agenda 2063 (AU) • Paris Agreement• Agenda 2063 (AU) • Sustainable Development Goals • AU Climate Strategy 2020-2025 • Sustainable Development Goals• AU Climate Strategy 2020-2025 (SDGs) • SADC Vision2030 (SDGs)• SADC Vision2030 • Sendai Framework • RISDP 2020-2030 • Sendai Framework• RISDP 2020-2030  • ECOWAS Climate Strategy 2050 • ECOWAS Climate Strategy 2050  "},{"text":"Table 4 : Terminology definitions • Clean, efficient, and sustainable energy technologies    • Clean, efficient, and sustainable energy technologies • Low carbon and efficient transport systems    • Low carbon and efficient transport systems • Climate-smart agriculture      • Climate-smart agriculture • Sustainable waste management system    • Sustainable waste management system Carbon sequestration Capturing, removal, and storage of carbon dioxide (CO2) from Carbon sequestrationCapturing, removal, and storage of carbon dioxide (CO2) from  the Earth's atmosphere    the Earth's atmosphere carbon footprint Amount of carbon dioxide released into the carbon footprintAmountofcarbon dioxidereleasedintothe  atmosphere because of the activities of a particular individual, atmosphere because of the activities of a particular individual,  organization, or community    organization, or community  "},{"text":"• Landscape system level • Markets system level • Regional, national, and global level Group activity on CSA practices. How is CSA smart? All climate-smart options ultimately enhance resilience to climate change and contribute to food security and development goals. Technologies and practices promoted for climate change adaptation and mitigation are categorized into different smartness criteria: weather and knowledge smart, water smart, nutrient/carbon smart, seed/breed smart, and institution/market smart. Ivy presented on future foresight, climate action, and short-and long-term planning. She started by conducting an online survey (Mentimeter), shown below:  Policy Policy institutions, 39% institutions, 39% Training, 88%  Training, 88%  Economic, 30% Economic, 30% Socio-cultural, Socio-cultural, Enviromental, 10% 16% Enviromental, 10%16% Figure 4: Barriers to CSA adoption  Figure 4: Barriers to CSA adoption Some CSA programs in Kenya were discussed, they included: Some CSA programs in Kenya were discussed, they included: • Schools and colleges Permaculture Programme (SCOPE) • Schools and colleges Permaculture Programme (SCOPE) • Climate-smart water irrigation systems -irrihub.  • Climate-smart water irrigation systems -irrihub. • High iron and zinc bean Kenya  • High iron and zinc bean Kenya • Climate-smart Village -Nyando  • Climate-smart Village -Nyando • Climate-smart seed propagation technologies -KIMPLANTER • Climate-smart seed propagation technologies -KIMPLANTER While wrapping up the presentation, the facilitator introduced the Kenya CSA Multi- While wrapping up the presentation, the facilitator introduced the Kenya CSA Multi- Stakeholder Platform (MSP), which was established to provide an institutional framework for Stakeholder Platform (MSP), which was established to provide an institutional framework for coordinating and harmonizing CSA implementation, among other roles, and was open to the coordinating and harmonizing CSA implementation, among other roles, and was open to the membership. The link below was provided to the attendees if anyone wanted to join, membership. The link below was provided to the attendees if anyone wanted to join, https://docs.google.com/forms/d/1iXRDRsuNN9zavaMzraKoJ34AJDPEXjp1vAeIw_-CSA practice vs. technologies jgvg/viewform?ts=5f6859ef&gxids=7628&edit_requested=true https://docs.google.com/forms/d/1iXRDRsuNN9zavaMzraKoJ34AJDPEXjp1vAeIw_-CSA practice vs. technologies jgvg/viewform?ts=5f6859ef&gxids=7628&edit_requested=true CSA Practices apply a method, e.g., precision farming, intercropping, and mulching. At the CSA Practices apply a method, e.g., precision farming, intercropping, and mulching. At the same time, CSA technologies are the new materials used, such as improved seeds, efficient irrigation equipment, and slow-release fertilizers. Session 2 same time, CSA technologies are the new materials used, such as improved seeds, efficient irrigation equipment, and slow-release fertilizers. Session 2 Activity: What are some examples of CSA technologies that you are implementing? Activity: What are some examples of CSA technologies that you are implementing? What is CSA bundling? Integrating a diverse suite of practices, technologies, and services to What is CSA bundling? Integrating a diverse suite of practices, technologies, and services to enhance farm outcomes through optimization, enhance complementarity, manage trade- enhance farm outcomes through optimization, enhance complementarity, manage trade- offs, and maximize farmer benefits. Farmers have been provided with different CSA offs, and maximize farmer benefits. Farmers have been provided with different CSA technologies, practices, and services to enhance their adaptive capacity in the face of climate technologies, practices, and services to enhance their adaptive capacity in the face of climate change. Bundling addresses all the farmers' requirements by offering various CSA options in change. Bundling addresses all the farmers' requirements by offering various CSA options in a single basket.  a single basket.  "},{"text":" Building resilience and appropriate mitigation actions. Group 4: Communication systems on CSA extension and agro-weather issues A Climate action template to guide the groups was given as shown below:FRIDAY 28 TH OCTOBER Mercy Oyuwer of ChildFund facilitated Day 3 Recap. Representatives of the delegates' groups presented their CSA action plans under the guidance of Templer. In summary, the action plans framework included the following: KCSAS (2017-26) NCFP (2016) Beneficiaries Implementers Resource needed Forest policy (2015) Irrigation policy (2015) • Proposed actions Group 3: Propose d actions • Beneficiaries Which actions do you propose Who benefits from this action Who is responsible for rolling out these actions Resources (financial/policy/huma n capacity. • Implementers • Resources needed • Indicators • Timing of actions • Desired outcomes Indicators Timing of the action How will you measure progress on each How much time do you need to Desired outcome KCSAS (2017-26) NCFP (2016) Beneficiaries Implementers Resource needed Forest policy (2015) Irrigation policy (2015) • Proposed actions Group 3: Propose d actions • Beneficiaries Which actions do you propose Who benefits from this action Who is responsible for rolling out these actions Resources (financial/policy/huma n capacity. • Implementers • Resources needed • Indicators • Timing of actions • Desired outcomesIndicators Timing of the action How will you measure progress on each How much time do you need toDesired outcome NCCAP (2013-17) to meet your goal Environmental mngt act (1999) action complet e this action? NCCAP (2013-17) to meet your goalEnvironmental mngt act (1999)actioncomplet e this action?  Water policy   Water policy  (2012)   (2012)  "},{"text":"Very unsatisfied Unsatisfied Neutral Satisfied Very unsatisfied   Level of expectations met Satisfaction level with overall moderation Level of expectations metSatisfaction level with overall moderation  0    0  00   1     1  2   Not at all 2 4 Very unsatisfied 2Not at all24Very unsatisfied     Not really 13  Unsatisfied Not really13Unsatisfied    12 Undecided   Neutral 12UndecidedNeutral  20   Somewhat   Satisfied 20SomewhatSatisfied     Very much  16 Very satisfied Very much16Very satisfied  Simon Kiseli  M EDCA RMO [email protected] Simon [email protected] 12 Mercy Oyuwer  F WCCP Community mobilizer [email protected] 12Mercy OyuwerFWCCPCommunity [email protected] 13 14 Janet. A. Oiro A. Kiptanui Satisfaction level with methods applied F WCCP M CRCDP M&E Program Coordinator [email protected] [email protected] 13 14Janet. A. Oiro A. Kiptanui Satisfaction level with methods applied F WCCP M CRCDPM&E Program [email protected] [email protected] 15 Robert Chumba 0 M EWANGAN M&E [email protected] 15Robert Chumba0MEWANGANM&[email protected] 16 Cyrus Maina 2 M MOALF-Isiolo SCFT [email protected] 16Cyrus [email protected] 17 18 Damaris Wambua Regina Mwasambo 10  F F 4 CHILDFUND CHILDFUND ECD Specialist Grants compliance specialist [email protected] [email protected] 17 18Damaris Wambua Regina Mwasambo 10F F 4CHILDFUND CHILDFUNDECD Specialist Grants compliance [email protected] [email protected] 19 Lucy Nganga  F CHILDFUND Financial analyst [email protected] 19Lucy NgangaFCHILDFUNDFinancial [email protected] 20 Bernard Kitur  M MOALF-Samburu SCAB [email protected] 20Bernard [email protected] 21 Rantile Richard  M OFSP-SCP M&E [email protected] 21Rantile RichardMOFSP-SCPM&[email protected] 22 Julius Lanyasunya  M OFSP-SCP P. O [email protected] 22Julius LanyasunyaMOFSP-SCPP. [email protected] 23 E. Josephat 19 M SCP PC [email protected] 23E. [email protected] 24 Wilson Kiiru  M Pioneer CDP P. O [email protected] 24Wilson KiiruMPioneer CDPP. [email protected] 25 Morris. M. Waema  M CEV/TOF  [email protected] 25Morris. M. WaemaMCEV/[email protected] 26 Paul Lostua  M MATONYOK Coordinator [email protected] 26Paul [email protected]  "}],"sieverID":"c406a783-45da-4482-8805-e7777510d91c","abstract":""}

data/part_3/07bb2299c3ec3692f267092ca0258d08.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07bb2299c3ec3692f267092ca0258d08","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/bb711131-795f-4c67-9522-eaaed9223390/retrieve"},"pageCount":41,"title":"IFPRI Discussion Paper 02220","keywords":["climate shock","water","energy","interventions","Ethiopia"],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":105,"text":"Ethiopia faces significant climate change vulnerabilities in at least three areas that are crucial to the country's long-term economic development. Firstly, agriculture is a major sector of the economy. It accounts for about 40 percent of national income and over 80 percent of export earnings and employs almost two-thirds of the workforce (World Bank, 2023;Eshetu and Mehare, 2020). The sector is already exposed to climate variability, and this could worsen under climate change. Secondly, hydropower remains a dominant energy source in Ethiopia's power system (Yalew, 2022), and its vulnerability to fluctuations in climate is evident from recurrent shortages (Carlsson et al., 2020;Mekonnen et al., 2022)."},{"index":2,"size":64,"text":"Despite diversification plans into solar and geothermal sources, hydropower is expected to remain a major energy source in the coming decades, posing concerns about the impact of climate change on river flows and generation capacity. Lastly, heat stress could reduce labor and animal productivity whereas flooding would exacerbate the existing infrastructural deficit, particularly in rural areas where many farmers have limited access to markets."},{"index":3,"size":56,"text":"Hydrological variability is one of the most significant climate variables in Ethiopia. For example, the year-to-year variability is stark, particularly in the South and South-Eastern regime, with annual rainfall varying between +36 percent and -25 percent of the mean (MoWIE, 2015;CGIAR, 2018). In fact, droughts have been the greatest and most recurring climate hazards in Ethiopia."},{"index":4,"size":57,"text":"Likewise, statistics suggest an exponential increase in the frequency of natural hazards globally in the last several decades (UNDRR, 2020). Furthermore, low-probability high-impact events appear to be driving economic losses, as 72 percent of the global damage attributable to temperature and water-related anomalies since 1980 emanated from only 6 percent of 'catastrophic' events (Chatzopoulos et al., 2021)."},{"index":5,"size":61,"text":"Gradually, climate change is being principally linked to changes in the occurrence, frequency, and intensity of extreme events (UNDRR, 2020). Increasing vulnerability of agriculture to extremes has been not only demonstrated regionally (Shukla et al., 2021;Schilling et al., 2020;Derbile et al., 2022) but also projected globally (Vogel et al., 2019;Chatzopoulos et al., 2021;Wing et al., 2021;van der Wiel and Bintanja, 2021)."},{"index":6,"size":134,"text":"The increasing need for scientific insights into the consequences of climate extremes is a recent development, as highlighted by Cogato et al. (2019) and Chatzopoulos et al. (2021), with a significant focus found in agricultural outlook reports (FAO, 2015;FAO, 2020). Besides other stressors on agri-food systems, such as population growth, environmental degradation, domestic conflicts, and global shocks like the COVID-19 pandemic and inter-country disputes affecting global supply chains, the risk of extreme events is expected to increase. In fact, considering the potentially grim global future if human actions on climate remain unchecked, some (FAO 2020; UNDRR, 2020) predict an increased risk of hunger, poverty, and the perpetuation of under-development. The stakes are particularly high in lowincome developing countries due to their limited institutional and financial capacity to adapt to the effects of climate change."},{"index":7,"size":251,"text":"In order to unravel the potential impacts of climate induced extreme weather events on the agri-food system, simulating recurrent events is essential (Amorim and Cai, 2015;Chatzopoulos et al., 2021;UNDRR, 2020). Despite substantial advancements in water-energy-economy nexus analysis, many studies overlook critical intersectoral linkages (Vinca et al., 2021). This paper contributes to this knowledge by utilizing a recursive-dynamic economywide model for Ethiopia under simulated recurrent climate shocks from 2020 to 2040. Specifically, we quantify the consequences of recurring drops in catchment flow water availability on key economic indicators like production, consumption, and household welfare at both regional and national scales. Our multi-sector economywide model is informed by data from catchment flow predictions for the country from several climate scenarios at agro-ecological scale, covering two major impact channels: reduced water availability for irrigation and rainfed agriculture, and water stress for energy production. Finally, this study explores benefits of two adaptation policy responses to mitigate some of the impacts of climate change on Ethiopia's economy: investment in irrigation and energy infrastructure. There is also a huge scope for enhancing irrigation water and energy use efficiency in the country. For instance, as per the country's Climate-Resilient Green Economy Strategy, efficient lighting and motors could increase energy use efficiency by up to 12 percent. By doing so, this article expands previous research on simulations of trend events (Kahsay et al., 2017;Komarek et al., 2019;Siddig et al., 2020;Hossain et al., 2023) such as studies on crop-yield effects, and single-case events (Mekonnen et al., 2022;Pauw et al., 2011)  "}]},{"head":"CLIMATE CHANGE IN ETHIOPIA","index":2,"paragraphs":[{"index":1,"size":73,"text":"Ethiopia is primarily an agrarian economy, with over two-thirds of the population earning their livelihoods as smallholder farmers. These farmers typically rely on traditional technologies, practicing centuries old technologies, and so crop yields are low and rural poverty is highconstituting 90 percent of the poor nationwide (World Bank, 2020). With a steadily shifting share of urban population, most workers in the non-farm sector are employed in the agri-food light industries and informal sector."},{"index":2,"size":36,"text":"Coupled with a population growth of 2.4 percent (World Bank, 2023), and endowed with Africa's second biggest population, urban growthat a rate of 4.8 percent (Yalew, 2022)has placed considerable pressure on food security in the country."},{"index":3,"size":176,"text":"Likewise, extreme climate variability poses a significant threat to Ethiopia's economy. Extended dry seasons have often led to production failures and food scarcities. Climatic projections also show that the country will be affected considerably by a rising temperature where mean annual temperature is predicted to increase by between 0.5 and 3.6 o C by 2070 (MoA, 2011) while other estimates (Setegn et al., 2011) push the level to 5 o C. Furthermore, changes in precipitation patterns are expected, with decreases in the northern regions where a significant portion of the population resides, while the sparsely populated southern areas could experience up to a 20 percent increase from the 1990s average (MoA, 2011). Soil moisture deficits are likely to worsen due to increased evapotranspiration in regions where rainfall is projected to decrease. Simultaneously, higher temperatures could reduce soil moisture levels in parts of the country, where average rainfall might increase. For instance, Setegn et al. (2011) predicted a 2 percent decline in soil moisture in the Ethiopian highlands due to rising air temperatures associated with climate change."},{"index":4,"size":110,"text":"On top of the long-term changes in temperature and precipitation, climate change is also associated with increased intensity and frequency of extreme weather conditions. Droughts have been the greatest and most recurring climate hazards in Ethiopia, where the likelihood of these hazards is predicted to increase over the future as the climate changes. The country experienced over 10 major droughts over the last four decades and in the last decade major droughts have occurred in 2001, 2003, 2005/06, 2008/09, 2011and 2015/2016(USAID, 2018;;UNDRR, 2020). Some were the strongest in terms of the number of people affected. The other face of extreme weather conditions in Ethiopia is flooding in the lower basins."},{"index":5,"size":40,"text":"The country has faced significant flooding events over the last four decades, specifically in the years 1988, 1993, 1994, 1995, 1996, and 2006(MoA, 2011)). These floods resulted in loss of life, resources, and property in different parts of the country."},{"index":6,"size":129,"text":"The Ethiopian economy, especially its agricultural sector, faces significant exposure to the impacts of climate change and associated extreme weather conditions. This vulnerability arises from the country's geographic location, agricultural production methods, and limited adaptive capacity due to financial and technical constraints. Extreme weather conditions, such as drought and flooding, can cause environmental degradation and reduce land availability; the increasing seasonality of rainfall might also lead to reductions in water availability (Mekonnen et al., 2022;Setegn et al., 2011;Robinson et al., 2013); and the intensity and frequency of droughts might become costly, especially in terms of loss of livestock capital (Bogale and Erena, 2022;Aragie and Thurlow, 2022). Studies (Carlsson et al., 2020;Robinson et al., 2013) also predict that climate change can diminish factor productivity by impacting land and water quality."},{"index":7,"size":144,"text":"One of the well-documented drought phenomena in Ethiopia is that of the 2003 (Admassu et al., 2007), where the total annual crop production during the year decreased by 21 percent compared with the average of the five previous years. The impact of the drought was particularly devastating for maize and sorghum: The reduction in maize and sorghum production in drought affected lowland areas reached between 70 percent and 100 percent, respectively, of the normal period levels of production. The country's main agricultural export, coffee, was also hit hard with coffee harvests in coffee producing areas in western, southwestern, and eastern parts of the country declining by up to 30 percent due to the drought. In terms of the total number of people at risk, the 2003 drought affected over 12 million people (about 16 percent of the total population at that time) (USAID, 2018)."},{"index":8,"size":187,"text":"Irrigation infrastructure plays a crucial role in mitigating climate change impacts, mainly by stabilizing and enhancing water availability. Currently, only about 5 percent of the total cropland, approximately 1.1 million hectares (Chandrasekharan et al., 2021), is under irrigation in Ethiopia, falling significantly short of the over 3,798,700 hectares of potentially irrigable land (Awulachew et al., 2007). There is also substantial regional variation in access to irrigation (see Figure 1), with the highest share of irrigated (small scale) farmland found in the lowlands of Afar and Gambela, and the lowest in the highlands of Tigray, Amhara, and Oromia. These shares are closely consistent with those regional shares reported in Chandrasekharan et al. (2021). Hydroelectricity is the largest renewable energy source in Ethiopia, accounting for around 95 percent of total renewable energy. However, hydroelectricity production varies with water resources availability and thus climate change. MoWIE (2015) estimates suggest that moderately extreme climatic events could significantly impact the country's electricity generation, possibly leading to a reduction in supply of about 15 percent of the total current demand by 2030 and amounting to an opportunity cost of $1bn in that year."},{"index":9,"size":29,"text":"In a bid to reduce heavy dependence on hydroelectricity, Ethiopia is emphasizing diversification of its energy mix, including solar, wind, and other off-grid energy sources (Mondal et al. 2017)."},{"index":10,"size":1,"text":"-10.0%"},{"index":11,"size":40,"text":"10.0% In the second stage, the use of intermediate inputs occurs in fixed proportions using Leontief technology, while the CES technology determines the formation of value added through primary production factors, with the optimal factor ratio determined by relative prices."},{"index":12,"size":39,"text":"In this economic model, households maximize utility subject to Stone-Geary utility functions over disposable incomes. On the other hand, enterprises, government, and investment demand commodities in fixed proportions. The distribution of factor incomes is based on households' factor endowments."},{"index":13,"size":29,"text":"Households save and pay taxes and the balance is used for consumption spending. The latter is determined through a linear expenditure demand system, which allows for non-unitary income elasticities."},{"index":14,"size":22,"text":"The base version also includes multiple tax instruments and allows for a wide range of factor market clearing conditions and macroeconomic closures."},{"index":15,"size":129,"text":"To better represent the climate-energy-food nexus, the original model production function was modified into a seven-stage nesting structure as in Figure 2. First, various water and energy types are identified and added into the value-added nesting, thereby capturing the close substitutability or complementarity these inputs have with land factor. Specifically, three types of water are considered, disaggregated by use. Two of these are water use for agriculture, separated into surface water and groundwater (Diao et al., 2008;Luckmann et al., 2014). Another water type constitutes water use for industrial and municipality purposes. Second, we assume that energy use in irrigation is differentiated from energy use for other uses to be able to create a neater nesting structure. Depending on data availability, the model can accommodate further water and energy types."},{"index":16,"size":60,"text":"This detailed nested structure controls substitution between inputs, including water and energy. Users can specify the substitution possibilities at each level of the production nest by defining the substitution elasticities (σi) where i is the level of the nest at which the elasticity operates. Typically, ground-water and energy are considered close complementary inputs, given the energy needed to extract water."},{"index":17,"size":20,"text":"Similarly, irrigated land and water are viewed as less substitutable inputs since they are utilized jointly in the production process."},{"index":18,"size":73,"text":"In the modified production structure, a single regionalized activity is responsible for producing a corresponding water resource. By utilizing additional production factors (capital, labor) and intermediate inputs (e.g., energy and consumables), the activity converts the resource into a water commodity. The produced water is then utilized as an input in various activities, whether in the agriculture or nonagriculture sectors. This approach is akin to the methodology utilized in studies like Luckmann et al."},{"index":19,"size":38,"text":"(2014) and Haqiqi et al. (2016). The production of ground water differs from surface water production due to the intensive use of energy for pumping in the former. We adopted a similar functional approach for the energy sector."},{"index":20,"size":64,"text":"In activities that involve water consumption, different types of water commodities are utilized based on the specific input requirements outlined in the database. Irrigated agricultural activities utilize both agricultural land and one or more types of water commodities. It is useful to segment these activities and commodities to distinguish between those that can use a particular type of water and those that do not."},{"index":21,"size":26,"text":"Typically, non-agricultural activities do not involve the use of agricultural land but do utilize a municipal water type-in which case the land-water aggregate collapses to water-aggregate."}]},{"head":"Figure 1. Production structure for modeling the food-energy-climate nexus","index":3,"paragraphs":[{"index":1,"size":3,"text":"Source: Authors compilation"}]},{"head":"The database","index":4,"paragraphs":[{"index":1,"size":79,"text":"The starting database for our application is a SAM for Ethiopia that represents economic transactions in 2018 (Aragie and Thurlow, 2021). It provides data on 80 commodities and activities, 13 production factor accounts, and three tax categories. The SAM furthermore includes 15 household types, first grouped according to rural-urban, and second according to income (five quintiles), which allows for the analysis of distributional effects. Rural households are further classified into farm and non-farm based on their principal income source."},{"index":2,"size":49,"text":"The SAM was modified to well represent the regional features of agriculture in the country. We do so by using data from the 2016/17 Annual Agricultural Sample Survey (AASS) which reports zonal level data on crop and livestock production (CSA, 2017). We use the zone to agro-ecology mapping from "}]},{"head":"Non-hydro Hydro","index":5,"paragraphs":[{"index":1,"size":82,"text":"Using the AASS survey, which reports the size of irrigated land in ha for each crop and zone, in conjunction with the mapping of irrigated and rainfed agriculture in Ethiopia by Chandrasekharan et al. (2021) utilizing remote sensing methods, we segmented land into rainfed and irrigated categories. This classification is further disaggregated by agro-ecology to (i) reflect the spatial variation in the supply and use of strategic inputs, and (ii) be able to link spatially specific recurrent climate shocks to these factors."},{"index":2,"size":58,"text":"The value attributed to irrigated land in the new SAM is about 7 percent of the total land value, aligning closely with the Sub-Saharan Africa (SSA) average of 8 percent (Haqiqi et al., 2016). After introducing additional production factors, activities, and commodities, the adjusted SAM was subjected to a balancing procedure. Annex Table A1 lists selected SAM accounts."},{"index":3,"size":35,"text":"The value of water in the economy remains poorly quantified (D'Odorico et al., 2020). The water sector, accounting for about 1 percent of total GDP, is represented by a single sector in the original SAM."},{"index":4,"size":12,"text":"To disaggregate this account, we used additional data from CSA ( 2017  "}]},{"head":"Scenario design","index":6,"paragraphs":[{"index":1,"size":129,"text":"Regional predictions show noticeable effects of climate change and weather variability on the agricultural and non-agricultural sectors. These effects are propagated through changes in water and energy supply, crop water requirement, and changes in efficiency of production factors. In this study, we focus on the former channels, linking predicted annual catchment flow data obtained from 15 climate scenariosconstituting five climate models and three Shared Socioeconomic Pathways (SSPs)to changes in water and energy production. Since climate variability is more disastrous than the change in long-term mean (Chatzopoulos et al., 2021;Siddig et al., 2020), we calculate the change in catchment flow from the recent trend level for each climate scenario and focused on years in which the predicted water flow is below the trend, i.e., we focused on the negative shocks."},{"index":2,"size":74,"text":"To assess the impact of climate shock on the economy, we establish a baseline scenario where there is no climate change, serving as a reference (Baseline). Additionally, we simulate intervention scenarios focusing on (i) investment in irrigation, affecting irrigation sector productivity, and hence effective access to irrigation, and (ii) investment in power generation, affecting energy sector productivity, and hence energy output. We also examine a scenario depicting combined interventions in irrigation and electricity infrastructure."},{"index":3,"size":54,"text":"Baseline scenario: This is a no climate change or business-as-usual scenario where the current average trend is assumed to continue without any influence from climate change throughout the simulation period . This scenario reflects development trends in the absence of climate change, serving as a relevant comparison basis for evaluating the climate change scenarios."},{"index":4,"size":144,"text":"In the baseline, underlying rates of labor force growth and arable land growth, sectoral productivity growth, world prices, remittances, and foreign and capital inflows are imposed exogenously. In line with the recent slowdown in GDP growth, current short-term projection, and the extended simulation period, we assume a period long (2018-2040) average growth of just under 5 percent. The labor force growth is close to the population growth of 2.4 percent per year (World Bank, 2023), per capita income growing by over 2 percent, which entails a two-third increase in baseline per capita income over this period. Total factor productivity (TFP) trends for individual sectors in agriculture, industry and services are set in conformity with GDP projections for aggregated agriculture, industry, and services sectors. We assume fixed world prices for the country's exports and imports since the country is small enough to alter world prices."},{"index":5,"size":117,"text":"In the equilibrium, we maintain a balanced closure between investment and savings for our long-run simulations. Real investment remains fixed at its initial absolute share of absorption, and private savings rates adjust accordingly to generate the required savings. This approach ensures a stable balance between investment and savings in the economic model. Meanwhile, product market equilibrium requires that the total supply of each good equals total private and public consumption, investment demand and total intermediate use. The dynamic interplay between supply and demand necessitates adjustments in market prices for various commodities, ensuring the preservation of this equilibrium. These fundamental assumptions remain consistent across all subsequent scenarios studied, providing a stable framework for analyzing the evolving economic dynamics."}]},{"head":"Recurrent climate shock scenarios:","index":7,"paragraphs":[{"index":1,"size":85,"text":"In order to assess the impact of the climate scenarios on the Ethiopian economy, a two-step approach was followed in this study. The first step is obtaining the watershed hydrology and retrieving catchment runoff responses to changes in climate variables. This allows us to get an estimate of surface water runoff and thus water availability for the individual catchment unitsagroecological zones in our caseidentified. The second step uses the runoff estimate from the hydrologic model to calculate annual deviations in the runoff by catchment unit."},{"index":2,"size":116,"text":"We obtain catchment runoff response to changes in climate variables from watershed hydrology models that use climate scenarios as input. We specifically use NedborAfstromnings Model (NAM) hydrologic model (DHI, 2011). The catchment flow data relates to a randomly selected list of Representative Concentration Pathways (RCPs) that are diverse enough to represent various climate predictions for Ethiopia. Likewise, we randomly selected climate scenarios relating to three of the five SSPs: (i) SSP1 -Sustainability (Low challenges to mitigation and adaptation), (ii) SSP3 -Regional Rivalry (High challenges to mitigation and adaptation), and (iii) SSP5 -Fossil-fueled Development (High challenges to mitigation, low challenges to adaptation). These three SSP scenarios relate to moderate and less and severe extreme shared socioeconomic trajectories."},{"index":3,"size":83,"text":"A total of 15 climate scenarios, chosen at random, were employed to construct corresponding local climate shock scenarios. However, for clarity, we present and analyze six scenarios that encompass both the mildest and most severe outcomes on the economy. For a comprehensive list of all climate scenarios explored, please refer to Annex Table A2. The identification of climate shock or drought scenarios involved computing a percentage reduction in the predicted catchment flow from 2020 to 2040 compared with the recent historical trend (2001-2020)."},{"index":4,"size":65,"text":"However, we do not capture agricultural and infrastructure damage during floods due to excess catchment flows as these are generally small although they should not be neglected. Notably, this analysis was conducted independently for the five agro-ecological zones found in the country (as outlined in Table 1): D_P_H (drought-prone highlands), M_S_Hc (moisture-sufficient highland-cereal based), M_S_He (moisture-sufficient highland-enset based), D_P_L (drought-prone lowlands), and M_S_L (moisturesufficient lowland)."},{"index":5,"size":121,"text":"This analysis yields a temporal heatmap displaying recurring declines in water flow across agroecological zones of Ethiopia (see Annex Figure 1 for the predicted drops in catchment flow across climate models for the five agro-ecological zones). The heatmap reveals heightened recurrent deviations in water flow during the early and mid-2030s, reflecting the impact of climate change-induced adverse weather events. These events are projected to have a direct detrimental influence on agriculture and the wider economy, particularly through the following two pathways considered in this study: (i) shifts in the productivity of the water and electricity sectors, leading to changes in water and energy outputs, and (ii) changes in the productivity of rainfed land. The arrows in Figure 2 identify these pathways."},{"index":6,"size":301,"text":"In line with Hasan and Wyseure (2018), Mohammed et al. (2022) and Di Falco and Chavas (2008) we assume a direct correlation between reduced water availability and its impact on the productivity of both the water and energy sectors, as well as agricultural land. 1 For instance, Hasan and Wyseure (2018) found that in Ecuador, a 17 percent reduction in streamflow would result in up to a 13 percent decrease in hydropower generation. Moreover, Mohammed et al. (2022) observed a strong correlation (>90 percent) between a combined temperature and precipitation index and crop yield across Hungary. Regarding land productivity, Torres et al. ( 2019) found, in the case of Brazil, that a 30 percent reduction in rainfall would lead to a 10.2 percent drop in farmers' net-revenue. Given that land constitutes a 33.5 percent share of total farm income in Ethiopia (Aragie and Thurlow, 2021), this signifies a proportional decline in rainfed land productivity. In a different context, Di Falco and Chavas (2008) predicted a 13 percent reduction in agroecosystem productivity for a simulated 10 percent permanent reduction in rainfall. 1 In the simulations, the climate induced shock to the water and energy sectors is imposed as multi factor productivity shock at the stage where Water_Land_Energy, Labor, and Capital_Energy inputs are combined, i.e., at the second stage of the production nest. The shock to rainfed agriculture is imposed by altering the productivity of rainfed land, i.e., Land-Rf factor in Figure 2.  (Block et al. 2008;Arndt et al., 2014;Siddig et al., 2020;Vogel et al., 2019), bolstering electricity infrastructure (Arndt et al., 2014;Kahsay et al., 2017), and improving water and energy use efficiency (Mondal et al., 2018;Yalew, 2022). Others (e.g., Arndt et al., 2014 andSilchenko andMurray, 2023) also highlighted the importance of insurance and social protection, research and innovation, and early warning systems."},{"index":7,"size":131,"text":"Given Ethiopia's substantial irrigation potential of more than 3,798,700 hectares (Awulachew et al., 2007), a significant untapped opportunity exists. To unlock this potential, the nation has set forth plans to elevate its medium and large-scale irrigation networks from the current 600,000 hectares to 1.2 million hectares during the ten years development plan period of 2021-2030(PDC, 2021)). This ambitious goal equates to expanding irrigated land one-fold, increasing annually by 11 percent on average. We assume that this is a little ambitious and the country can only expand its water sector capital by 7.5 percent annually until 2040, a rate just over the recent GDP growth. 2 We assume the same level of investment irrespective of the future climate scenarios examined. This intervention centers around expediting the rate at which infrastructure development occurs."},{"index":8,"size":101,"text":"Similarly, Ethiopia's existing hydroelectric power generation capacity stands at 4,300 MW, significantly trailing behind its hydroelectric power generation potential, estimated to be approximately 45,000 MW (Awulachew et al., 2007;Mekonnen et al., 2022;Yalew, 2022). As part of its strategic vision, the country aims to augment its power generation capability to reach 13,500 MW by the year 2040, positioning itself as one of Africa's leading power producers (IEA, 2019;MoWIE, 2015). In particular, it aims at diversifying its renewable energy mix to 20 percent wind and solar, 10 percent geothermal and 70 percent hydropower, from the current hydropower share of 95 percent (Yalew, 2022)."},{"index":9,"size":87,"text":"This trajectory aligns with the anticipated annual growth in electricity demand of 9-14 percent (Mondal et al., 2018;Yalew, 2022). A notable growth in electricity demand is also expected in the agricultural sector (EEP, 2014), mainly for pumping water for irrigation. In our simulations, for impact comparability reasons, we assume a similar level of investment in the hydro and agriculture focused non-hydro energy sources annually as in the irrigation sector. Again, we assume the same level of energy investments across climate scenarios examined, regardless of the predicted severity."}]},{"head":"RESULTS AND DISCUSSION","index":8,"paragraphs":[]},{"head":"Macroeconomic level effects","index":9,"paragraphs":[{"index":1,"size":87,"text":"This section presents effects of recurrent climate shocks on selected macroeconomic indicators. While a total of 15 scenarios corresponding to 15 climate prediction scenarios were run, the results presented in this section focus on scenarios representing less extreme and more extreme outcomes: ssp126_mp, ssp126_uk, ssp370_mp, ssp370_uk, ssp585_mp, and ssp585_uk. For a comprehensive view of GDP effects across all climate scenarios considered, refer to annex Table A3. Notably, the _uk scenarios demonstrate less extreme macroeconomic outcomes, whereas the _mp models depict more extreme outcomes among the reported scenarios."},{"index":2,"size":249,"text":"In the absence of climate change (i.e., under the no climate variability scenario), Ethiopia's cumulative GDP at market price and at factor cost would reach US$3,044.4 and US$2,922.8 billion for the period between 2020-2040 (Table 2). Meanwhile, model results indicate that predicted changes in precipitation and temperature, translated into the economic model as changes in the performance of water and energy sectors and the productivity of rainfed agriculture (land) makes the Ethiopian GDP at market price worse off, with declines ranging from 2.9 percent (or US$88.4 billion cumulative GDP) to 17.6 percent (or US$534.4 billion cumulatively) for the 2020-2040 period. This confirms findings from previous studies (Robinson et al., 2013;CGIAR, 2018) that estimate that climate change could shrink Ethiopia's economy by more than 10 percent by the mid-century compared to a no-climate change baseline. Our GDP effect estimatesimplying a 1.5 percent annual loss on averageare closely in line with the 1.7 percent loss predicted by Pauw et al. (2011) on Malawi. The effect on GDP at factor cost mirrors the effect on GDP at market price. The impacts are more pronounced for the three _mp scenarios. Table 2 also shows a substantial adverse effect on exports across all scenarios compared to the effect on imports. This is due to the direct and significant impact of the analyzed shocks on the agricultural sector, which contributes substantially-over 80 percent-to the country's export revenues. The worst scenario, i.e., ssp370_mp, implies a 7-percentage point average reduction in export growth over the simulated period."}]},{"head":"Table 2. Change in macroeconomic indicators (2020-2040), in billion 2018 USD","index":10,"paragraphs":[{"index":1,"size":189,"text":"Note: Scenarios reported are with less extreme and more extreme outcomes However, when factoring in interventions in the irrigation and energy sectors in response to climate variability, the accumulated GDP at factor cost experiences an increase of approximately 0.9 percent, equivalent to around US$26.6 billion, in comparison to the GDP under the corresponding climate shock scenario (see Panel D in Table 2). This is equivalent to a 5-34 percent reduction in the cumulative loss in  Table 3 presents a heatmap illustrating the specific years with lower, moderate, or higher effects of recurrent climate shocks on real GDP in Ethiopia across the considered climate scenarios. These effects spread between light greydemonstrating lower effects of climate shocks on climateto dark greydemonstrating a greater effect on GDP. The table shows that the late 2020s and mid-to late 2030s will witness severe economic impacts on the country. Once again, the heatmap of annual effects highlights that the _mp scenarios depict are more extreme impacts. The severity of these losses is attributed to the predicted year-on-year shortfall in water runoff and precipitation compared to the current trend recorded for each region and climate scenario. "}]},{"head":"Sectoral and regional level effects","index":11,"paragraphs":[{"index":1,"size":150,"text":"Panel A of Table 4 reports the percentage change in the cumulative value of regional GDP relative to the business-as-usual (i.e., no recurrent climate shock) scenario between 2020 and 2040, focusing on the agricultural sector. The climate scenarios that exhibit the most significant impact on national GDP also result in substantial cost for the agricultural sector, both regionally and at the national level. Arguably, the weight of the economic loss is concentrated in agriculture, constituting about 50 percent of the cumulative loss under the most extreme scenario and 45 percent of the loss under the least extreme scenario despite the sector contributing around 25 percent of the cumulative GDP during the period. The reduction in share of agriculture is owing to a gradual shift in the economic structure over the two-decade period considered in the analysis in addition to the impact of the recurrent shocks examined on the sector itself."},{"index":2,"size":76,"text":"Cumulatively, agricultural GDP under the _mp climate scenarios is about a fifth less compared to the sector's GDP without the shock. This magnitude of estimated loss in agriculture is higher than the 15-18 percent real GDP loss reported in Kahsay et al. (2017) for Nile basin countries. The effect is particularly severe in moisture-sufficient enset-based highlands (M_S_He) and moisture-sufficient lowlands (M_S_L) of Ethiopia. See Figure 1 on the geographic distribution of the agroecological zones in Ethiopia."},{"index":3,"size":160,"text":"The succeeding panels in Table 4 depict the point changes from the percentage changes reported in panel A, reflecting the impacts of interventions analyzed. These panels underscore the significance of irrigation and energy interventions in averting some adverse effects of climate variability induced by climate change. As shown in the corresponding panels of Table 3, implementing combined irrigation and electricity interventions at the simulated levels would dampen the adverse effects on agriculture by 1.1-1.4 percent. Most of these gains are again achieved through investments in irrigation. At a regional level, the gains from these interventions are particularly marked in drought-prone lowlands of Ethiopia, where irrigated agriculture plays a dominant role (see Figure 1). The economic impact of irrigation would be more pronounced if the second season effect was accounted for. However, the modeling framework adopted in this study does not operate at seasonal/sub-annual levels, and thus is unable to fully reflect the production increase from irrigation in the lean season."},{"index":4,"size":12,"text":"The study also showed a slight complementarity between energy and irrigation interventions."},{"index":5,"size":74,"text":"However, the extent of this interconnection is somewhat diminished by the apparent shift from nonhydropower sources to the relatively abundant hydroelectric power as the hydroelectric capacity expands due to the simulated development in infrastructure. This complementarity would also become more pronounced if groundwater usage in agriculture, which relies on energy as a complementary input, were to grow from its current nascent stage, and if groundwater extraction were widely recognized as a climate adaptation strategy. "}]},{"head":"Household consumption effects","index":12,"paragraphs":[{"index":1,"size":80,"text":"A recent World Bank study (World Bank, 2020) notes that about 90 percent of the poor in Ethiopia are concentrated in rural areas, where agriculture serves as the primary source of livelihood. To evaluate the impact of climate shock scenarios on different household groups, we assess the percentage change in cumulative consumption spending (2020-2040) compared to the baseline (no climate change scenario), as presented in Table 5. The outcomes are segmented by household location (rural and urban) and poverty level."},{"index":2,"size":123,"text":"The analysis demonstrates that scenarios with more severe impacts on GDP correspond to more severe effects on household consumption spending, and vice versa. Further, model results indicate a relatively stronger effect on consumption than the effect on GDP. This phenomenon can be attributed to climatic variability directly and strongly affecting agricultural products, which form a significant portion of consumption expenditure in Ethiopia and many other developing nations. This aligns with the findings of Siddig et al. (2020), who observed similar stronger effect on household consumption (-7.6 percent) compared to the effect on cumulative GDP (-2.8 percent) over the period from 2018 to 2050 in the case of Sudan. In rural areas, the impact on consumption is similar for both poor and non-poor households."},{"index":3,"size":85,"text":"However, in urban areas, real consumption for the urban poor is significantly affected compared to their non-poor counterparts. This is because the incomes of urban poor households are closely tied to value chains within the agri-food system, which are highly exposed to the adverse impacts from climate shocks. Hossain et al. (2023) also observed this stronger effect on the urban poor is the case of Bangladesh. At the national level, the cost of climate shocks in terms of forgone consumption remains substantial for the poor."},{"index":4,"size":91,"text":"Investing in irrigation and electricity infrastructure to mitigate the adverse impacts of climate change would slightly reduce losses in consumption spending; this effect is comparable to the reduction in GDP impact from these interventions. Most of the recovery in consumption (almost two-thirds) is attributable to the irrigation intervention. However, non-poor households in rural areas benefit the most from improved irrigation development, as they are more likely to cultivate high-value irrigated crops. On the other hand, energy development benefits both rural and urban households equally and appears to have a distribution-neutral impact."},{"index":5,"size":108,"text":"Energy and irrigation interventions do not merely affect consumption, but can also enable the production of high-value, nutritious foods such as fruits and vegetables that require higher amounts and more frequent water. Fruits and vegetables are tipped to help diversify consumption towards healthy diets (Baye et al., 2022;Pauw et al., 2023). Fodder irrigation (Bizumana et al., 2023) is also emerging in the country and, if fully tapped, could help mediate recurrent livestock death linked to droughts, ultimately increasing access to animal source food. Although well-designed small-scale irrigation programs have the potential to increase farmers income and productivity and bridge seasonal production gaps, they are not yet sufficiently developed. "}]},{"head":"CONCLUSION AND POLICY RECOMMENDATION","index":13,"paragraphs":[{"index":1,"size":140,"text":"Examining the economic impacts of climate change is a complex task due to its numerous channels of influence and substantial levels of uncertainty in climate change impact and adaptation assessments. In this study, we assessed (i) the economywide effects of recurrent climate shocks on the Ethiopian economy until 2040, and (ii) also examined the impacts of water and energy interventions in averting some of the effects of climate change. To address the inherent uncertainty, we adopted several distinct climate change projections that encompass a wide range of predicted alterations in Ethiopia's catchment flow and water availability at an agro-ecological scale. We did so by using a modified economywide model calibrated to a modified 2018 SAM for Ethiopia that reflects regionally disaggregated agricultural operations and spatial differences in access to and use of strategic inputs, such as water use for irrigation."},{"index":2,"size":113,"text":"Our results indicate that recurrent climate shocks will substantially reduce Ethiopia's cumulative GDP in 2020-2040 relative to a 'no climate change' baseline. Estimates of these damages range from 2.9 to 17.6 percent of baseline cumulative GDP, depending on which climate projection is considered. Climate projections under _mp scenarios are identified to have a severe effect across Ethiopia. Arguably, the weight of the economic loss relative to the size of the sector is concentrated in agriculture, constituting close to 50 percent of the cumulative loss under the most extreme scenario, i.e., nearly double the share of the sector in cumulative GDP in 2020-2040 and 45 percent of the loss under the least extreme scenario."},{"index":3,"size":63,"text":"Climate's adverse effects are also diverse across agro-ecologies of Ethiopia, where enset-based moisturesufficient highlands (M_S_He) and moisture-sufficient lowlands (M_S_L) are the worst affected. The effect on the non-agricultural sector also remains considerable. This result therefore suggests the strong linkage effect of climate impact channels specifically targeting the agricultural sector and also underscores the importance of accounting for multi-sector impact channels of climate uncertainty."},{"index":4,"size":41,"text":"Results further show dissimilar effects across households in Ethiopia. Poorer households in urban areas and rural households in general are the worst affected. Incorporating distributional and spatial analyses is crucial to pinpoint vulnerable segments of society and formulate effective adaptation strategies."},{"index":5,"size":87,"text":"Our analysis suggests that investments in irrigation infrastructure to smooth out the irregular availability of water for agriculture and robust energy development strategy, including increased reservoir capacity for hydroelectricity generation are likely to be effective at reducing the damages from climate variability in Ethiopia. Irrigation infrastructure emerges as the most effective given its role in agriculture and the sector's contribution to overall GDP. In addition to the interventions assessed in this study, other response options such as increased resource use efficiency should be considered for further analysis."},{"index":6,"size":124,"text":"The results of this analysis should be interpreted in light of the following. We focused on water shortages due to belove average catchment flow associated with climate change, although climate change is also associated with above average abundant rainfall and catchment flow in some years. Whereas our scenario design would potentially exert downward bias since we focus on negative shocks only, there is also some aspect of climate change disasterssuch as floodingthat we did not account for. Our modeling framework would benefit from the introduction of a reservoir system that helps to smooth out water availability between years of abundant rainfall and drought years. A probabilistic assessment of years of extreme conditions and magnitude of shocks is another avenue in improving the scenario design."},{"index":7,"size":33,"text":"Further, the actual cost of the investments -but only the associated expansion in strategic capital -is not internalized in the model. This implies that the direct, indirect, and fiscal implications are unaccounted for."}]}],"figures":[{"text":"CONTENTS1 INTRODUCTION ................................................................................................................................... 2 CLIMATE CHANGE IN ETHIOPIA ..................................................................................................... 3 METHOD OF ANALYSIS ..................................................................................................................... 3.1 The economywide model .............................................................................................................. 3.2 The database .................................................................................................................................. 3.3 Scenario design ............................................................................................................................ 4 RESULTS AND DISCUSSION ....................................................................................................... "},{"text":" such as studies on one time drought effects by reflecting the recurrent nature of climate extremes. The remainder of this article is organized as flows. Section 2 describes the climate change projections for Ethiopia and summarizes the nature of recurrent climate shocks in the country. Section 3 describes the economywide model and the design of the climate change simulations. Section 4 presents our results, and we conclude in Section 5 by discussing climate change's implications for economic development in Ethiopia and identifying areas for further research. "},{"text":"Figure 1 . Figure 1. The share of irrigated farmland across Ethiopia "},{"text":" Extreme climate variability affects the local economy, primarily by disrupting the reliable availability of water and energy resources. These disruptions have profound effects on the production and productivity of the agricultural sector, ultimately influencing the entire economy. To comprehensively understand the economywide effects of recurrent climate shocks, we employ a multi-sector recursive dynamics Computable General Equilibrium (CGE) model for Ethiopia. This CGE model is based on a Social Accounting Matrix (SAM) and features a combination of nonlinear and linear relationships governing the behavior of the model's agents. Details on the structure and equations of the original model used in this study are found inDiao and Thurlow (2012). This model assumes a two-stage production process with activities following either Constant Elasticity of Substitution (CES) or Leontief technologies. In the first stage, intermediate input and value added generate the output of each activity based on CES technology. "},{"text":" ) andChandrasekharan et al. (2021) on irrigation outreach in Ethiopia and from D'Odorico et al. (2020)  andMekonnen and Hoekstra (2011) on various aspects of water use. The calculation of the value of irrigation water use by sector and agro-ecology involves a two-step process. First, the cost of a cubic meter of water per ton of production ($/m 3 /ton) is determined by multiplying the respective sector's water footprint (m 3 /ton) and the global estimate on crop-specific irrigation water values in $/m 3 (D'Odorico et al., 2020). Then, this cost is multiplied by total production in tons to obtain the value of irrigation water use for each sector and agroecology. The water footprint is also agro-ecology specific and is derived fromMekonnen and Hoekstra (2011) using each administrative region's weight in each agro-ecology. The global estimate on cropspecific irrigation water values ($/m³) is from D'Odorico et al. (2020).Thus, the water sector in the SAM is split into various products separated by use: agricultural use, and industrial and municipal use (by households). Water use in agriculture is also further separated into the five agro-ecological zones (see Figure3)including drought-prone highlands, moisture-sufficient highland-cereal based, moisture-sufficient highland-enset based, and drought-prone lowlandsdepending on their shares in total irrigated land. There is a general absence of data on the magnitude and spatial distribution of ground water use in agriculture. However, we recognize the underdeveloped nature of ground water use in Ethiopia, and hence assume that the contribution of ground water in total water use in agriculture is only 8%. We also separate energycontributing to 0.4 percent of GDPinto two major sources: hydro and non-hydro, both of which are further identified by final use in agriculture and the nonagricultural sector. With electricity consumption currently going principally to residential (46 percent), services (27 percent) and industry (26 percent) (Yalew, 2022), the share of agriculture is negligible. "},{"text":"Figure 2 . Figure 2. Agro-ecological zones in Ethiopia "},{"text":" GDP over the period considered depending on the severity of the climate change impacts across the scenarios, with the _mp scenarios demonstrating the least percentage reduction in losses. Most of this reduction in GDP loss is registered when investments in irrigation are considered. This stronger adaptation effect of irrigation investment compared with other interventions aligns with findings fromKahsay et al. (2017),Arndt et al. (2014) andSiddig et al. (2020). Not only does GDP recover when water and energy sector interventions are implemented, exports and imports also improve associated with the gain in GDP. "},{"text":"Figure 1. Predicted drops in catchment flow: all scenarios, 5 AEZs ..... 4.1 Macroeconomic level effects ....................................................................................................... 4.2 Sectoral and regional level effects ............................................................................................... 4.3 Household consumption effects................................................................................................... 5 CONCLUSION AND POLICY RECOMMENDATION ..................................................................... The share of irrigated farmland across Ethiopia ............................................................................ Figure 2. Production structure for modeling the food-energy-climate nexus ............................................... Figure 3. Agro-ecological zones in Ethiopia .............................................................................................. Annex ........................................  "},{"text":"Table 1 . Heatmap of the recurrent drop in water flow framework, we include separate water sectors producing water for agricultural and municipal-industrial purposes to reflect differences in water quality between uses. Additionally, we identified region-specific sectors that generate irrigation water, reflecting variations in irrigation availability across different parts of the country and the current inability to transfer water between agroecological zones. This setup is instrumental in accurately capturing the region-specific effects of climate shocks. Meanwhile, we assume that climate induced change in energy supply affects all regions equally since much of electricity in Ethiopia, except few decentralized rural energy systems, is distributed to homes, businesses, and other consumers from a central hub. Climate model Zone 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 2030 2031 2032 2033 2034 2035 2036 2037 2038 2039 2040 Climate model Zone202020212022202320242025202620272028202920302031203220332034203520362037203820392040  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp126_gf M_S_He                     ssp126_gfM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp126_ip M_S_He                     ssp126_ipM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp126_mp M_S_He                     ssp126_mpM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp126_mr M_S_He                     ssp126_mrM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp126_uk M_S_He                     ssp126_ukM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp370_gf M_S_He                     ssp370_gfM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp370_ip M_S_He                     ssp370_ipM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp370_mp M_S_He                     ssp370_mpM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp370_mr M_S_He                     ssp370_mrM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp370_uk M_S_He                     ssp370_ukM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp585_gf M_S_He                     ssp585_gfM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp585_ip M_S_He                     ssp585_ipM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp585_mp M_S_He                     ssp585_mpM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp585_mr M_S_He                     ssp585_mrM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  D_P_H                     D_P_H  M_S_Hc                     M_S_Hc ssp585_uk M_S_He                     ssp585_ukM_S_He  D_P_L                     D_P_L  M_S_L                     M_S_L  "},{"text":"Table 4 . Change in cumulative regional GDP (2020-2040), in billions of 2018 USD   Baseline cumulative       Baseline cumulative  value (2020-2040) ssp126_mp ssp126_uk ssp370_mp ssp370_uk ssp585_mp ssp585_uk value (2020-2040)ssp126_mp ssp126_uk ssp370_mp ssp370_uk ssp585_mp ssp585_uk   Change in cumulative value from baseline scenario, 2020-2040 Change in cumulative value from baseline scenario, 2020-2040 A) Recurrent climate shock       A) Recurrent climate shock Agriculture GDP 773.7 -25.6% -8.8% -29.4% -5.0% -24.7% -11.8% Agriculture GDP773.7-25.6%-8.8%-29.4%-5.0%-24.7%-11.8% D_P_H 205.4 -24.0% -8.2% -26.3% -4.4% -21.2% -4.3% D_P_H205.4-24.0%-8.2%-26.3%-4.4%-21.2%-4.3% M_S_Hc 412.9 -23.9% -6.8% -28.4% -2.1% -23.4% -16.6% M_S_Hc412.9-23.9%-6.8%-28.4%-2.1%-23.4%-16.6% M_S_He 123.8 -34.7% -16.7% -39.2% -15.8% -35.8% -9.3% M_S_He123.8-34.7%-16.7%-39.2%-15.8%-35.8%-9.3% D_P_L 14.2 -18.1% -7.0% -20.0% -5.8% -17.2% -5.1% D_P_L14.2-18.1%-7.0%-20.0%-5.8%-17.2%-5.1% M_S_L 17.4 -25.4% -8.7% -29.2% -4.2% -22.2% -9.5% M_S_L17.4-25.4%-8.7%-29.2%-4.2%-22.2%-9.5% National GDP 2,922.8 -14.9% -5.0% -17.2% -2.8% -14.3% -6.7% National GDP2,922.8-14.9%-5.0%-17.2%-2.8%-14.3%-6.7%   Percentage point change from climate shock scenario, 2020-2040 Percentage point change from climate shock scenario, 2020-2040 B) Irrigation investment under climate shock      B) Irrigation investment under climate shock Agriculture GDP 773.7 0.8% 0.9% 0.7% 1.0% 0.8% 0.9% Agriculture GDP773.70.8%0.9%0.7%1.0%0.8%0.9% D_P_H 205.4 0.8% 0.9% 0.7% 1.0% 0.8% 1.0% D_P_H205.40.8%0.9%0.7%1.0%0.8%1.0% M_S_Hc 412.9 0.8% 1.0% 0.8% 1.1% 0.9% 1.0% M_S_Hc412.90.8%1.0%0.8%1.1%0.9%1.0% M_S_He 123.8 0.5% 0.5% 0.4% 0.5% 0.5% 0.4% M_S_He123.80.5%0.5%0.4%0.5%0.5%0.4% D_P_L 14.2 1.9% 1.7% 1.9% 1.7% 1.9% 1.8% D_P_L14.21.9%1.7%1.9%1.7%1.9%1.8% M_S_L 17.4 0.5% 0.5% 0.5% 0.5% 0.5% 0.5% M_S_L17.40.5%0.5%0.5%0.5%0.5%0.5% National GDP 2,922.8 0.6% 0.7% 0.6% 0.7% 0.6% 0.7% National GDP2,922.80.6%0.7%0.6%0.7%0.6%0.7% C) Electricity investment under climate shock      C) Electricity investment under climate shock Agriculture GDP 773.7 0.4% 0.4% 0.4% 0.4% 0.4% 0.4% Agriculture GDP773.70.4%0.4%0.4%0.4%0.4%0.4% D_P_H 205.4 0.4% 0.4% 0.4% 0.4% 0.4% 0.4% D_P_H205.40.4%0.4%0.4%0.4%0.4%0.4% M_S_Hc 412.9 0.4% 0.4% 0.4% 0.4% 0.4% 0.4% M_S_Hc412.90.4%0.4%0.4%0.4%0.4%0.4% M_S_He 123.8 0.3% 0.3% 0.3% 0.3% 0.3% 0.3% M_S_He123.80.3%0.3%0.3%0.3%0.3%0.3% D_P_L 14.2 0.5% 0.5% 0.5% 0.5% 0.5% 0.5% D_P_L14.20.5%0.5%0.5%0.5%0.5%0.5% M_S_L 17.4 0.4% 0.4% 0.4% 0.5% 0.4% 0.5% M_S_L17.40.4%0.4%0.4%0.5%0.4%0.5% National GDP 2,922.8 0.3% 0.3% 0.3% 0.3% 0.3% 0.3% National GDP2,922.80.3%0.3%0.3%0.3%0.3%0.3% D        D  "},{"text":") Irrigation and electricity improvement under climate shock  Agriculture GDP 773.7 1.2% 1.3% 1.1% 1.4% 1.2% 1.3% Agriculture GDP773.71.2%1.3%1.1%1.4%1.2%1.3% D_P_H 205.4 1.1% 1.3% 1.1% 1.3% 1.2% 1.4% D_P_H205.41.1%1.3%1.1%1.3%1.2%1.4% M_S_Hc 412.9 1.2% 1.5% 1.2% 1.5% 1.3% 1.3% M_S_Hc412.91.2%1.5%1.2%1.5%1.3%1.3% M_S_He 123.8 0.8% 0.8% 0.8% 0.9% 0.8% 0.7% M_S_He123.80.8%0.8%0.8%0.9%0.8%0.7% D_P_L 14.2 2.3% 2.2% 2.4% 2.1% 2.4% 2.2% D_P_L14.22.3%2.2%2.4%2.1%2.4%2.2% M_S_L 17.4 0.9% 1.0% 0.9% 0.9% 0.9% 1.0% M_S_L17.40.9%1.0%0.9%0.9%0.9%1.0% National GDP 2,922.8 0.9% 0.9% 0.9% 1.0% 0.9% 0.9% National GDP2,922.80.9%0.9%0.9%1.0%0.9%0.9% Note: Scenarios reported are with less extreme and more extreme outcomes.    Note: Scenarios reported are with less extreme and more extreme outcomes.  "},{"text":"Table 5 . Change in cumulative consumption spending (2020-2040), in billions of 2018 USD   Baseline cumulative       Baseline cumulative  value (2020-2040) ssp126_mp ssp126_uk ssp370_mp ssp370_uk ssp585_mp ssp585_uk value (2020-2040)ssp126_mp ssp126_uk ssp370_mp ssp370_uk ssp585_mp ssp585_uk   Change in cumulative value from baseline scenario, 2020-2040 Change in cumulative value from baseline scenario, 2020-2040 A) Recurrent climate shock       A) Recurrent climate shock All households 1,996.2 -16.9% -5.8% -19.6% -3.3% -16.4% -7.8% All households1,996.2-16.9%-5.8%-19.6%-3.3%-16.4%-7.8% Poor 414.6 -17.7% -6.3% -20.3% -3.7% -17.2% -8.4% Poor414.6-17.7%-6.3%-20.3%-3.7%-17.2%-8.4% Non-poor 1,581.6 -16.7% -5.6% -19.4% -3.2% -16.1% -7.6% Non-poor1,581.6-16.7%-5.6%-19.4%-3.2%-16.1%-7.6% Rural households 1,414.4 -17.6% -6.1% -20.3% -3.5% -17.0% -8.2% Rural households1,414.4-17.6%-6.1%-20.3%-3.5%-17.0%-8.2% Poor 397.4 -17.4% -6.2% -19.9% -3.6% -16.9% -8.3% Poor397.4-17.4%-6.2%-19.9%-3.6%-16.9%-8.3% Non-poor 1,017.0 -17.7% -6.0% -20.4% -3.5% -17.1% -8.1% Non-poor1,017.0-17.7%-6.0%-20.4%-3.5%-17.1%-8.1% Urban households 581.8 -15.3% -5.0% -17.9% -2.9% -14.7% -6.8% Urban households581.8-15.3%-5.0%-17.9%-2.9%-14.7%-6.8% Poor 17.2 -24.1% -8.2% -27.9% -4.7% -23.3% -11.1% Poor17.2-24.1%-8.2%-27.9%-4.7%-23.3%-11.1% Non-poor 564.6 -15.0% -4.9% -17.6% -2.8% -14.5% -6.7% Non-poor564.6-15.0%-4.9%-17.6%-2.8%-14.5%-6.7%  "},{"text":"Percentage point change from climate shock scenario, 2020-2040 B) Irrigation investment under climate shock  All households 1,996.2 0.4% 0.5% 0.4% 0.5% 0.4% 0.5% All households1,996.20.4%0.5%0.4%0.5%0.4%0.5% Poor 414.6 0.3% 0.4% 0.3% 0.4% 0.3% 0.3% Poor414.60.3%0.4%0.3%0.4%0.3%0.3% Non-poor 1,581.6 0.5% 0.5% 0.4% 0.6% 0.5% 0.5% Non-poor1,581.60.5%0.5%0.4%0.6%0.5%0.5% Rural households 1,414.4 0.4% 0.5% 0.3% 0.5% 0.4% 0.4% Rural households1,414.40.4%0.5%0.3%0.5%0.4%0.4% Poor 397.4 0.3% 0.4% 0.2% 0.4% 0.3% 0.3% Poor397.40.3%0.4%0.2%0.4%0.3%0.3% Non-poor 1,017.0 0.4% 0.5% 0.4% 0.5% 0.4% 0.5% Non-poor1,017.00.4%0.5%0.4%0.5%0.4%0.5% Urban households 581.8 0.6% 0.6% 0.5% 0.6% 0.6% 0.6% Urban households581.80.6%0.6%0.5%0.6%0.6%0.6% Poor 17.2 0.7% 0.8% 0.6% 0.8% 0.7% 0.7% Poor17.20.7%0.8%0.6%0.8%0.7%0.7% Non-poor 564.6 0.6% 0.6% 0.5% 0.6% 0.6% 0.6% Non-poor564.60.6%0.6%0.5%0.6%0.6%0.6% C) Electricity investment under climate shock      C) Electricity investment under climate shock All households 1,996.2 0.2% 0.2% 0.2% 0.2% 0.2% 0.2% All households1,996.20.2%0.2%0.2%0.2%0.2%0.2% Poor 414.6 0.2% 0.2% 0.2% 0.2% 0.2% 0.2% Poor414.60.2%0.2%0.2%0.2%0.2%0.2% Non-poor 1,581.6 0.2% 0.2% 0.2% 0.2% 0.2% 0.2% Non-poor1,581.60.2%0.2%0.2%0.2%0.2%0.2% Rural households 1,414.4 0.2% 0.2% 0.2% 0.2% 0.2% 0.2% Rural households1,414.40.2%0.2%0.2%0.2%0.2%0.2% Poor 397.4 0.2% 0.2% 0.2% 0.2% 0.2% 0.2% Poor397.40.2%0.2%0.2%0.2%0.2%0.2% Non-poor 1,017.0 0.2% 0.2% 0.2% 0.2% 0.2% 0.2% Non-poor1,017.00.2%0.2%0.2%0.2%0.2%0.2% Urban households 581.8 0.3% 0.2% 0.3% 0.2% 0.3% 0.2% Urban households581.80.3%0.2%0.3%0.2%0.3%0.2% Poor 17.2 0.3% 0.3% 0.4% 0.4% 0.3% 0.3% Poor17.20.3%0.3%0.4%0.4%0.3%0.3% Non-poor 564.6 0.3% 0.2% 0.3% 0.2% 0.3% 0.2% Non-poor564.60.3%0.2%0.3%0.2%0.3%0.2% D) Irrigation and electricity improvement under climate shock     D) Irrigation and electricity improvement under climate shock All households 1,996.2 0.6% 0.7% 0.6% 0.8% 0.7% 0.7% All households1,996.20.6%0.7%0.6%0.8%0.7%0.7% Poor 414.6 0.5% 0.6% 0.4% 0.6% 0.5% 0.6% Poor414.60.5%0.6%0.4%0.6%0.5%0.6% Non-poor 1,581.6 0.7% 0.8% 0.7% 0.8% 0.7% 0.7% Non-poor1,581.60.7%0.8%0.7%0.8%0.7%0.7% Rural households 1,414.4 0.6% 0.7% 0.5% 0.7% 0.6% 0.7% Rural households1,414.40.6%0.7%0.5%0.7%0.6%0.7% Poor 397.4 0.4% 0.6% 0.4% 0.6% 0.5% 0.5% Poor397.40.4%0.6%0.4%0.6%0.5%0.5% Non-poor 1,017.0 0.6% 0.7% 0.6% 0.8% 0.6% 0.7% Non-poor1,017.00.6%0.7%0.6%0.8%0.6%0.7% Urban households 581.8 0.8% 0.8% 0.8% 0.9% 0.8% 0.8% Urban households581.80.8%0.8%0.8%0.9%0.8%0.8% Poor 17.2 1.0% 1.1% 1.0% 1.2% 1.0% 1.1% Poor17.21.0%1.1%1.0%1.2%1.0%1.1% Non-poor 564.6 0.8% 0.8% 0.8% 0.9% 0.8% 0.8% Non-poor564.60.8%0.8%0.8%0.9%0.8%0.8%  "}],"sieverID":"bcb364ce-da4e-403e-a5dc-a6595d15d840","abstract":"The International Food Policy Research Institute (IFPRI), established in 1975, provides research-based policy solutions to sustainably reduce poverty and end hunger and malnutrition. IFPRI's strategic research aims to foster a climate-resilient and sustainable food supply; promote healthy diets and nutrition for all; build inclusive and efficient markets, trade systems, and food industries; transform agricultural and rural economies; and strengthen institutions and governance. Gender is integrated in all the Institute's work. Partnerships, communications, capacity strengthening, and data and knowledge management are essential components to translate IFPRI's research from action to impact. The Institute's regional and country programs play a critical role in responding to demand for food policy research and in delivering holistic support for country-led development. IFPRI collaborates with partners around the world."}

data/part_3/07f643649635f00035b4d47c14166b79.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07f643649635f00035b4d47c14166b79","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/51d37fc7-13a0-441c-99e6-f3488bd94d91/retrieve"},"pageCount":6,"title":"Maritime pine","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":183,"text":"Maritime pine (Pinus pinaster Aiton) morphologically is similar to other species of the genera. The species display several adaptations to forest fires: early flowering (in some populations cones can be observed in 4-year-old seedlings), presence of seroti-nous cones, and a thick bark. Compared with other Mediterranean pines, Maritime pine has large cones (8-22 cm long) usually in groups of 2 or 3, and long needles (10-25 cm). Clear morphological differences exist among the different populations, resulting in the subdivision of the species into two subspecies (atlantica and pinaster), and into several geographical races (atlantica, mesogeensis, corteensis, maghrebiana, renoui, etc.), but a complete revision of the species does not exist. The species can be found in quite different environments: from sea level to 2100 m elevation in the High Atlas (Morocco); from areas with more than 1400 mm of annual rainfall and no dry season, to others with 350 mm and more than 4 dry months. The soil conditions are variable; mainly in acid soils, but also in basic soils and even in sandy and poor soils, where not many commercial species can grow."}]},{"head":"Pinus pinaster","index":2,"paragraphs":[]},{"head":"EUFORGEN","index":3,"paragraphs":[{"index":1,"size":92,"text":"These Technical Guidelines are intended to assist those who cherish the valuable Maritime pine genepool and its inheritance, through conserving valuable seed sources or use in practical forestry. The focus is on conserving the genetic diversity of the species at the European scale. The recommendations provided in this module should be regarded as a commonly agreed basis to be complemented and further developed in local, national or regional conditions. The Guidelines are based on the available knowledge of the species and on widely accepted methods for the conservation of forest genetic resources."},{"index":2,"size":94,"text":"Maritime pine is a broadly distributed conifer in the western Mediterranean Basin, in Southern Europe and Africa, and the Atlantic coast in Portugal, Spain and France. The island distribution of the species is limited to Corsica, and to a very limited extent, northern Sardinia. There is a marginal stand in Pantelleria island, close to the Tunisian shore. Two main factors have affected the present natural distribution of the species, resulting in a high degree of fragmentation: the discontinuity and altitude of the mountain ranges causes isolation of even close populations, and the human impact."},{"index":3,"size":68,"text":"At present, the species is broadly distributed by forestation in different countries (within and outside the natural range). The differentiation of autochthonous and non-autochthonous stands is, in many cases, controversial. We can find regions with either a large or a limited human impact. This combination presents a unique opportunity to understand some aspects of forest management and its impact on the genetic resource conservation of broadly distributed conifers."},{"index":4,"size":115,"text":"Maritime pine is one of the most important forest species in France, Portugal and Spain. The main uses of the species are related to wood and resin production, recreation and soil protection. It can be considered a fastgrowing species (especially in the Atlantic region where rotation ages of 40-50 years are common). The main uses in these regions are pulp and paper production, construction, chipboards, floor boards and palettes. In the other regions, the rotation ages vary from 80 to 120 years, and trees produce either highquality (Corsica, some mountains areas in Central Spain), or lowquality timber, especially owing to the existence of very crooked trees (Castillian plains and several southern populations in southern Spain)."},{"index":5,"size":62,"text":"One of the most traditional uses of the species is resin tapping. Maritime pines produce resin of high quality. The importance of this product has decreased over time, but recently the production has increased slightly in some regions (Castillian plains in Spain, Portugal). The development of new tools and extraction methods, combined with breeding programmes, could be of importance for this product."},{"index":6,"size":32,"text":"The ability of the species to grow in very poor soils, and under prolonged drought, is one of the reasons for its use in afforestation programmes for wood production or soil protection."}]},{"head":"Distribution","index":4,"paragraphs":[{"index":1,"size":47,"text":"Importance and use inus pinaster Pin Because of its high commercial value, there have been many studies dealing with the genetics of Maritime pine. This species is one of the model species used worldwide for the discovery of genes related to wood quality and water stress resistance."},{"index":2,"size":113,"text":"Large genetic differences among populations have been reported at regional and wide-range spatial scales using various genetic markers (terpenes, isozymes, DNA markers) and common garden experiments. Especially important is the large genetic variation found between provenances in traits of importance for the adaptation of the species (drought and frost tolerance, insect resistance) and others of large importance for the use of the species (growth, stem form, polycyclism, branching habit). In general, clear geographic areas can be defined in terms of genetic diversity using different types of genetic markers, and within these areas, different adaptations are found. A clear geographic structuration of the diversity is found with the different genetic markers and adaptive traits."},{"index":3,"size":18,"text":"The main threats to the genetic diversity in maritime pine are similar to those of other Mediterranean species."},{"index":4,"size":11,"text":"Forest fires. Mainly isolated stands or small populations have been affected."},{"index":5,"size":15,"text":"Fires have traditionally played an important role in modeling the genetic architecture of the species."},{"index":6,"size":59,"text":"Land uses and plant cover changes. Transformation of forest land to agricultural or pasture areas has been a general trend in the Mediterranean region. Forest stands have been ploughed to introduce more productive species, or water-demanding crops have been introduced close to some pine forests. However, at present, the main threat comes from conversion of forested to residential areas."},{"index":7,"size":46,"text":"Introduction of exotic species or genomes. Hybridization of maritime pine with other species is quite limited. The main threat is the introduction of material from exotic provenances close to natural populations. Because of advanced breeding programmes, selected material is widely planted in some countries (e.g. France)."}]},{"head":"Threats to genetic diversity","index":5,"paragraphs":[]},{"head":"Genetic knowledge us pinasterPinus ime pinePinus pinasterMaritime pinePinus pinasterMaritime pinePinus pinasterMaritime","index":6,"paragraphs":[{"index":1,"size":41,"text":"Pollen flow in this species is quite extensive and could impact local resources, leading to loss of local adaptivity, for example in sand dune areas where P. pinaster has a very important ecological role against habitat destruction by wind and waves."},{"index":2,"size":58,"text":"Overexploitation. There is little information on the effect of silvicultural practices on the genetic resources of the forest species. In conifers, the effect seems to be of scant importance under normal forestry practices. The adoption of criteria and indicators of sustainable forest management in most European countries would diminish the importance of this factor in the near future."}]},{"head":"Global climatic change.","index":7,"paragraphs":[{"index":1,"size":122,"text":"Most of the models predict a reduction and changes in the pattern of rainfall in the Mediterranean area, where P. pinaster is mainly found. We can expect a shift northward in its range, leading to changes in pollen flow, seed dispersal, recolonization dynamics and new possibilities for gene exchange with resources from breeding programmes. Seed source selection. Taking into consideration the important differences in growth, stem form and adaptation of the different populations, seed source selection has to be carefully analyzed based on the results of provenance trials. Selection is dependent on the main objective of the plantation (protection, wood production, etc.), and in most countries descriptions of the base material are available to assist in selecting the most suitable for afforestation."},{"index":2,"size":125,"text":"In situ conservation areas. These are the best means of preserving the adaptive potential of the species in the long term. Given the breeding system of the species, special care has to be taken to establish conservation stands of sufficient size to reduce the effect of inbreeding and external contamination. As in other conifers, areas greater than 20 ha are necessary to ensure enough regeneration to maintain the genetic variability of the species. A network of conservation areas covering the most contrasting areas in the distribution range of the species would be a method to preserve the natural stands of the species. At present there are many activities in different countries that could be considered as a starting point for the conservation of the species. "}]},{"head":"Pinus pinaster P","index":8,"paragraphs":[]}],"figures":[{"text":" Pests and diseases. A good example is the reduction in the natural area of Maritime pine in the Southern French Maures and Esterel mountain regions, caused by Matsococcus feytaudy. This insect caused the destruction of approx. 200 000 ha of P. pinaster forests in the 1960s. Resistant material, both local and from Spain and Morocco, is currently tested to understand the genetic determinism of the resistance and to reintroduce the resource. The presence of a nematode (Bursaphelenchus xylophilus) in Portugal is a risk not completely evaluated until now. "},{"text":" Ex situ conservation. This form of conservation is based on different activities, such as clonal pinaster Pinus p pinePinus pinasterMaritime pinePinus pinasterMaritime pinePinus pinasterMaritime p Guidelines for genetic conservation and use banks, seed banks and plantations using seeds from the threatened populations. Clonal banks are mainly used in populations with large economic (or ecological) value. Seed banks are very effective methods of preserving the adaptiveness of the target populations, because of the heavy seed production in Maritime pine, and the possibility of conserving the seed (or pollen) for a prolonged period of time. "},{"text":"  "},{"text":"  "},{"text":"Maritime pinePinus pinasterMaritime pinePinus pinasterMaritime pinePinus pinaste Distribution range of maritime pine www.euforgen.org More information  inus pinaster Pin inus pinaster Pin These Technical Guidelines were These Technical Guidelines were produced by members of the produced by members of the EUFORGEN Conifers Network. EUFORGEN Conifers Network. The objective of the Network is to The objective of the Network is to identify minimum genetic conser- identify minimum genetic conser- vation requirements in the long vation requirements in the long term in Europe, in order to reduce term in Europe, in order to reduce the overall conservation cost and the overall conservation cost and to improve the quality of stan- to improve the quality of stan- dards in each country. dards in each country. Citation: Alía, R. and S. Martín. Citation: Alía, R. and S. Martín. 2003. EUFORGEN Technical 2003. EUFORGEN Technical Guidelines for genetic conserva- Guidelines for genetic conserva- tion and use for Maritime pine tion and use for Maritime pine (Pinus pinaster). International (Pinus pinaster). International Plant Genetic Resources Insti- Plant Genetic Resources Insti- tute, Rome, Italy. 6 pages. tute, Rome, Italy. 6 pages. Drawings: Pinus pinaster, Claudio Drawings: Pinus pinaster, Claudio Giordano. © IPGRI, 2003. Giordano. © IPGRI, 2003. ISBN 92-9043-570-4 ISBN 92-9043-570-4 EUFORGEN Secretariat c/o IPGRI EUFORGEN Secretariat c/o IPGRI Via dei Tre Denari, 472/a Via dei Tre Denari, 472/a 00057 Maccarese (Fiumicino) 00057 Maccarese (Fiumicino) Rome, Italy Rome, Italy Tel. (+39)066118251 Tel. (+39)066118251 Fax: (+39)0661979661 Fax: (+39)0661979661 [email protected] [email protected]  "},{"text":"erMaritime pinePinus pinasterMaritime pinePinus pinasterMaritime pinePinus pinaster EUFORGEN Selected bibliography   "}],"sieverID":"707d6384-e40f-4075-b0be-6ca057d088c0","abstract":""}

data/part_3/07ffb79d94d8ff2ecfbfbb20b6fb72f9.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07ffb79d94d8ff2ecfbfbb20b6fb72f9","source":"gardian_index","url":"https://publications.iwmi.org/pdf/h031379.pdf"},"pageCount":4,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":138,"text":"Shilp Verma IWMI, India [ ] [email protected] 'More Crop per Drop' aims at enhancing production per unit of water use. While farm-level benefits of microirrigation technologies have widely been studied and illustrated, there is still a large question looming on whether their adoption can actually lead to water saving at the system level. In the classical model of irrigation efficiency, all water applied is treated as consumed or lost while the integrated basin view of irrigation efficiency views only the effective evapo-transpiration as the irrigation loss. In either case, increased water efficiency at farm/individual level would not lead to water saving at the system level unless higher farm efficiencies are achieved all across the system. Thus, unless the adoption of microirrigation is scaled up, it would not make any significant contribution to alleviating groundwater depletion and related problems."},{"index":2,"size":74,"text":"Even after more than three decades of promotion by various government and non-government agencies, the spread of micro-irrigation in India is miniscule. The limited growth of micro-irrigation technologies in India can, to a large extent, be explained by the apparent gap between what has been marketed and where the demand lies. Over the years, agencies have been promoting microirrigation as a 'new concept in agriculture' through a \"package solution\" with the following salient features: "}]},{"head":"1.Shifting Micro-Irrigation Technologies from Investment Mode to Input Mode:","index":2,"paragraphs":[{"index":1,"size":92,"text":"There is a need to view micro-irrigation technologies as recurring but much lower input costs rather than capital investments that offer returns over the next 8-10 years. If the small farmers are to be targeted, policy makers in promoting agencies must understand that they would be hesitant in making huge-capital investments in new technologies unless they are very sure of their results. Even when they are convinced about the returns, they might not be in a position to incur the huge capital costs due to poor access to good quality credit options."},{"index":2,"size":218,"text":"The market for Micro Irrigation products is experiencing its second major shift today. From the highly sophisticated custom built drip irrigation solutions for the large farmers, the technology shifted towards Package Solutions provided in the form of drip-kits popularised by IDE in the form of bucket-drip-kits and micro-tube-kits and the recent family-drip-kits being offered by Netafim. Today, there is a need to transfer the technology into the hands of the users. The farmers are demanding components of drip-kits like pipes, drippers etc which they can assemble on their own. Moreover, there is a strong notion among the farmers as well as in the micro-irrigation industry that drip is a technology more suitable for big farmers. A buried strip drip system in the USA costs about US$ 1,200 per acre (about the market value of an acre of irrigated land). Pepsee systems are low-cost alternatives of drip irrigation systems and are made up of low density polythene ranging from 65-130 microns, essentially used for making ice candy locally called 'Pepsee'. The initial investment for Pepsee systems is 42 percent less than the same for micro-tubes and 78 percent less than the same for conventional drips. At an initial investment of less than US$ 100, Pepsee systems offer the perfect 'Stepping Stone' for adoption of more sophisticated water saving technologies."}]},{"head":"2.From Custom-Solutions to a Package Solution to","index":3,"paragraphs":[{"index":1,"size":29,"text":"Farmer-Assembled Systems: Figure 9 Figure 10 IWMI-Tata WATER POLICY PROGRAM Elecon, Anand-Sojitra Road Vallabh Vidyanagar, 388120, Gujarat, India Telephone: 91-2692-229311-12-13 Fax : 91-2692-229310 E-mail: Website: [email protected] http://www.iwmi.org/iwmi-tata HEADQUARTERS [email protected]"}]},{"head":"REGIONAL OFFICE FOR ASIA","index":4,"paragraphs":[{"index":1,"size":5,"text":"[email protected] CHINA [email protected] NEPAL [email protected]"}]},{"head":"REGIONAL OFFICE FOR AFRICA","index":5,"paragraphs":[{"index":1,"size":5,"text":"[email protected] KENYA [email protected] GHANA [email protected]"}]},{"head":"REGIONAL OFFICE FOR INDIA","index":6,"paragraphs":[{"index":1,"size":1,"text":"[email protected]"}]},{"head":"REGIONAL OFFICE FOR PAKISTAN, CENTRAL ASIA AND MIDDLE EAST","index":7,"paragraphs":[{"index":1,"size":3,"text":"[email protected] UZBEKISTAN [email protected] "}]},{"head":"REGIONAL OFFICE FOR","index":8,"paragraphs":[]},{"head":"Sustainable Groundwater Management","index":9,"paragraphs":[{"index":1,"size":1,"text":"The "}]},{"head":"IWMI-Tata Water Policy Program","index":10,"paragraphs":[{"index":1,"size":18,"text":"The IWMI-Tata Water Policy Program was launched in 2000 with the support of Sir Ratan Tata Trust, Mumbai."},{"index":2,"size":59,"text":"The program presents new perspectives and practical solutions derived from the wealth of research done in India on water resource management. Its objective is to help policy makers at the central, state and local levels address their water challenges in areas such as sustainable groundwater management, water scarcity, and rural poverty by translating research findings into practical policy recommendations."}]}],"figures":[{"text":" [1] water saving; [2] good pay back period and internal rate of return; [3] customized and highly sophisticated technology; [4] higher yields and better quality of output; and [5] labor saving. The farmers, on the other hand, have different priorities and they demand solutions and technologies that would provide them: [1] assured returns; [2] lower costs; [3] simple technology; [4] generic applicability; and [5] higher and better yields with lesser pumping hours. This gap between what the consumers demand and what is being currently marketed can broadly be addressed through the following policy prescriptions: "},{"text":"Table of Contents  Page Author Affiliation Title PageAuthorAffiliationTitle 2 Tushaar Shah IWMI-India The Challenge of Groundwater Governance in Asia 2Tushaar ShahIWMI-IndiaThe Challenge of Groundwater Governance in Asia 6 Aditi Mukherji IWMI-India Groundwater Socio-ecology of South Asia: Results of 6Aditi MukherjiIWMI-IndiaGroundwater Socio-ecology of South Asia: Results of    a Survey of 2630 Tubewell Owners in Pakistan, India, Nepal a Survey of 2630 Tubewell Owners in Pakistan, India, Nepal    and Bangladesh and Bangladesh 7 Asad Qureshi IWMI-Pakistan Protecting Food and Livelihoods Security through 7Asad QureshiIWMI-PakistanProtecting Food and Livelihoods Security through    Conjunctive Water Management: The Challenge of Conjunctive Water Management: The Challenge of    Groundwater Governance in Pakistan Punjab Groundwater Governance in Pakistan Punjab 9 M Mainuddin IWMI-SE Asia Poverty Alleviation versus Mass Poisoning: The Dilemma 9M MainuddinIWMI-SE AsiaPoverty Alleviation versus Mass Poisoning: The Dilemma    of Groundwater Irrigation in Bangladesh of Groundwater Irrigation in Bangladesh Technocratic Approaches   Technocratic Approaches 11 Shilp Verma IWMI-India More Crop per Drop: Can Micro-Irrigation Help 11Shilp VermaIWMI-IndiaMore Crop per Drop: Can Micro-Irrigation Help    Alleviate the Groundwater Depletion? Alleviate the Groundwater Depletion? 12 Dinesh Kumar IWMI-India Micro-management of Groundwater: IWMI's 12Dinesh KumarIWMI-IndiaMicro-management of Groundwater: IWMI's    Experiment in North Gujarat Experiment in North Gujarat 13 Shamjibhai Antala Saurastra Lok Manch Can Mass Movement for Decentralized Water Harvesting and Recharge 13Shamjibhai Antala Saurastra Lok Manch Can Mass Movement for Decentralized Water Harvesting and Recharge    help Cope with Groundwater Depletion? Lessons from Western India help Cope with Groundwater Depletion? Lessons from Western India Regulatory Approaches   Regulatory Approaches 15 Chetan Pandit Ministry of Water Sustainable Groundwater Management: Should India 15Chetan PanditMinistry of WaterSustainable Groundwater Management: Should India   Resources, GoI pursue Aggressive Regulation? Resources, GoIpursue Aggressive Regulation? 16 Jinxia Wang Center for Chinese Sustainable Groundwater Management: How 16Jinxia WangCenter for Chinese Sustainable Groundwater Management: How   Agricultural Policy, Effective has Groundwater Regulation been in North Agricultural Policy, Effective has Groundwater Regulation been in North   CAS China Plains? CASChina Plains? 18 Christopher Scott IWMI-India Sustainable Groundwater Management: Have Property 18Christopher ScottIWMI-IndiaSustainable Groundwater Management: Have Property    Rights Reforms helped in Mexico? Rights Reforms helped in Mexico? 19 Eran Feitelson Hebrew University Sustainable Groundwater Management: Has 19Eran FeitelsonHebrew University Sustainable Groundwater Management: Has   of Jerusalem Regulation worked in Israel, the Mecca of Water Management? of JerusalemRegulation worked in Israel, the Mecca of Water Management? 20 Marcus Moench ISET Need to Search for Adaptive Approaches 20Marcus MoenchISETNeed to Search for Adaptive Approaches 21 Tushaar Shah IWMI-India Strategic Approaches to Indirect Management of the 21Tushaar ShahIWMI-IndiaStrategic Approaches to Indirect Management of the    Groundwater Economy Groundwater Economy  "},{"text":"The Challenge Is Asia Meeting the Challenge? Search for Strategic Approaches V. MORE CROP PER DROP: CAN MICRO-IRRIGATION HELP ALLEVIATE GROUNDWATER DEPLETION?   "},{"text":" goal of IWMI's research in groundwater is to contribute to achieving sustainable use and management of groundwater in ways that promote food and livelihood security for the poor women and Men in Asia and Africa. Under IWMI's strategic plan 2000-2005, ongoing research under this theme has five priorities: [1] Assessment of the extent of groundwater use, its economic value and contribution to agrarian wealth creation; [2] Understanding Basin level impacts of local water harvesting and recharge; [3] Exploring linkages between groundwater irrigation and rural poverty; [4] Analyzing approaches to conjunctive use of surface and groundwater; and [5] Identifying practical approaches to sustainable groundwater management through comparative analysis of institutions and policies.  "}],"sieverID":"760256e1-9a9b-4135-a4c4-8398b31daf8f","abstract":""}

data/part_3/08964e2fc4be19d6d965a7497039eaa4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08964e2fc4be19d6d965a7497039eaa4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/89cd0e10-eac3-4910-9bf7-3fbadac9c4da/retrieve"},"pageCount":3,"title":"Editorial: Genomic Selection: Lessons Learned and Perspectives","keywords":["genomic selection (GS)","plant breeding","selection gain","breeding schemes","genotype-by-environment interaction"],"chapters":[{"head":"Editorial on the Research Topic Genomic Selection: Lessons Learned and Perspectives","index":1,"paragraphs":[{"index":1,"size":60,"text":"Genomic selection (GS) has been one of the most prominent Research Topics in breeding science in the last two decades after the milestone paper by Meuwissen et al. (2001). Its huge potential for increasing the efficiency of breeding programs attracted scientific curiosity and research funding. Many different statistical prediction methods have been tested, and different use cases have been explored."},{"index":2,"size":61,"text":"We organized this Research Topic to look both back and forward. The objectives were to review the developments of the last 20 years, to provide a snapshot of current hot topics, and potentially also to define areas on which more (or less) focus should be put in the future, thereby supporting readers with formulating and prioritizing their ideas for future research."},{"index":3,"size":95,"text":"Several questions were brought up when organizing this Research Topic including: How did GS change breeding schemes? Which impact did GS have on realized selection gain? What, considering the context of particularities of different crops, may be optimal breeding schemes to leverage the full potential of GS? What has been the impact of and what is the potential of hybrid prediction, statistical epistasis models, deep learning and other methods? What are the long-term effects of GS? Can predictive breeding approaches also be used to harness genetic resources from germplasm banks in a more efficient way?"},{"index":4,"size":59,"text":"Having closed our Research Topic, we are happy to present a solid collection of 21 contributions from 149 authors which reviews the past work around GS, presents new insights, and points at topics with potential for future research. The 21 contributions consist of 12 original research articles, a method paper, two review contributions, five opinion articles and a perspective."},{"index":5,"size":37,"text":"Concerning original research, the main topics that have been addressed were \"genetic architecture\" and \"genetic architecture enhanced prediction methods, \" \"shortening the breeding cycle, \" \"genotype x environment interaction, \" \"sparse-testing, \" and \"genomic selection in polyploids.\""},{"index":6,"size":154,"text":"Additionally to considerations around GS for major staple crops, Ferrão et al. \"propose a strategy for using genomic selection in blueberry, with the potential to be applied to other polyploid species of a similar background.\" In particular, the authors highlight that \"the use of additive effects under a linear mixed model framework (GBLUP) showed the best balance between efficiency and accuracy.\" The topic of GS in tetraploids has also been considered by Wilson et al. for the case of potato. Moreover, Liu et al. investigated prediction methods based on genes known to be relevant for fiber length in cotton. Pégard et al. considered GS for poplar in the context of forest tree breeding and highlight \"that genomic evaluation performance could be comparable to the already well-optimized pedigreebased evaluation under certain conditions [. . . ] Genome-based methods showed advantages over pedigree counterparts when ranking candidates at the within-family levels, for most of the families.\""},{"index":7,"size":13,"text":"The other eight original research contributions were related to wheat, maize and rice."},{"index":8,"size":35,"text":"Bonnett et al. addressed the application of GS in a wheat breeding pipeline. In particular, the authors considered the performance of selected material when applying genomic selection with different prediction methods in an early generation."},{"index":9,"size":127,"text":"The topic of modeling environmental effects and genotypeby-environment interactions (GEI) was addressed by several authors. Westhues et al. included environmental predictors in GS using gradient boosting. Based on \"data collected by the Maize Genomes to Fields\" initiative, the authors found that \"Accuracy in forecasting grain yield performance of new genotypes in a new year was improved by up to 20% over the baseline model by including environmental predictors with gradient boosting methods.\" Genotype-by-environment interactions were also considered Ma and Cao addressed the dissection of grain yield of maize and compared the predictive ability of different approaches, in particular when incorporating markers associated with the traits of interest as a fixed effect in the statistical model. Finally, Cao et al. addressed genomic prediction of resistance to Tar Spot."},{"index":10,"size":75,"text":"As a contribution of a method article, Schrauf et al. discussed how to compare different genomic prediction models by cross validations. The authors \"emphasize the importance of paired comparisons to achieve high power in the comparison between candidate models, as well as the need to define notions of relevance in the difference between their performances. Regarding the latter, \" the authors \"borrow the idea of equivalence margins from clinical research and introduce new statistical tests.\""},{"index":11,"size":31,"text":"As review contributions, Fritsche-Neto et al. reviewed GS in small scale maize hybrid programs and Simeão et al. described the current status and future application of GS in tropical forage grasses."},{"index":12,"size":252,"text":"Concerning opinion articles, Crossa et al. presented their view on the \"Modern Plant Breeding Triangle, \" comprising genomics, phenomics, and environomics. Martini et al. highlighted the challenges that prediction approaches face when aiming at harnessing genetic resources, that is predicting diverse material which may not be sufficiently represented in the training set. Covarrubias-Pazaran et al. outlined how public breeding programs could be strengthened by focusing on quantitative genetics principles, and by sharing data resources including genomic data and breeding values predicted from experimental evaluations from different organizations. Another opinion contribution was provided by Gholami et al. who compared the adoption of GS across different breeding institutions, in more detail dairy cattle breeding and public and private plant breeding programs. The authors highlight that differences in the organizational structure of plant and animal breeding institutions, as well as differences in the cost-benefit structures of the use of GS in private and public plant breeding may have been the cause for differences in the adoption of GS. Gianola contributed with his reflections on trends and developments in statistical genetics addressing for instance the \"deconstruction of genetic architecture\" and highlighting that \"quantitative genetics provides just a linear (local) approximation to complexity with little (if any) mechanistic value.\" Moreover, the author emphasized the principal of parsimony in genetic models and that a bias of a statistical method does not need to be a problem but that \"practically all machine learning methods (e.g., random forests) provide biased predictions that, on average, will be better than unbiased machines.\""},{"index":13,"size":52,"text":"In the direction of what Gianola called the \"linear (local) approximation, \" Powell et al. argue that \"The implicit capture of non-stationary effects of alleles requires the G2P map to be re-estimated across different contexts\" and discuss the \"development and application of hierarchical G2P maps that explicitly capture non-stationary effects of alleles.\""},{"index":14,"size":130,"text":"The rough outline of the content of our Research Topic emphasizes that GS is now well-established across many plant species. Moreover, five out of 12 research articles were related to GEI indicating the relevance of this topic in current research. Plant breeding programs may have more need to estimate GEI because a program's purpose is to develop improved varieties which is inherently tied to the target environments. Was our Research Topic able to answer all the questions originally formulated? We do not think so. For instance, additional contributions on the optimal use of GS for different crops, but also a more detailed retrospective analysis of realized selection gain after the introduction of GS, or the relevance of epistasis models, hybrid prediction and new machine learning models would have been desirable."},{"index":15,"size":39,"text":"We hope that our Research Topic supports readers with the priorization of their own ideas for future investigation, and we look forward to a potential second volume, maybe 25 years after the milestone paper by Meuwissen et al. (2001)."}]}],"figures":[{"text":" by Tomar et al. who investigated the predictive ability of a multi-environment genomic prediction model for yield in spring wheat. Atanda et al. and He et al. considered the modeling of GEI with the focus on applications in sparse-testing, and Rembe et al. investigated the impact of GEI on reciprocal recurrent genomic selection. "}],"sieverID":"151da2e8-5132-4419-a95a-44b35c1b138f","abstract":""}

data/part_3/08b3cf9a9e0b0a0fd4d463792a20d264.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08b3cf9a9e0b0a0fd4d463792a20d264","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f998a667-fb57-4dfb-adf4-27b9a7ea9068/retrieve"},"pageCount":9,"title":"Genetic Differentiation among Maruca vitrata F. (Lepidoptera: Crambidae) Populations on Cultivated Cowpea and Wild Host Plants: Implications for Insect Resistance Management and Biological Control Strategies","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":213,"text":"Host plant adaptation by herbivorous insects has resulted in monophagous species that are highly specialized on a single host, whereas polyphagous insect species have evolved to feed upon a wide array of different host plants (e.g., [1][2][3]). Host plants may have a major role in the differentiation and diversification of herbivorous insects, and are important in our current understanding of global biodiversity and niche exploitation by insect populations [4][5][6]. The diversity of ecosystems, which polyphagous species encounter, makes the study of genetic variation based on host plants important for the understanding of adaptation and niche formation. Within a single species, genetic variation can arise among subpopulations that utilize different host plants through variation in oviposition or feeding preferences, rates of development on different host plants, as well as subsequent survivorship, fecundity and mating preferences of adults [7]. Mating barriers and reduced gene flow have been predicted among individuals from insect species that show adaptation to different host plants [8][9], and resulted in assortative mating within populations [10]. In addition to broader implications in species formation, assortative mating based on host plant preference can impact the practical application of insect pest management strategies, such as the release of biocontrol agents and the implementation of insect resistance management (IRM) strategies based on genetically modified crops."},{"index":2,"size":260,"text":"The legume pod borer, Maruca vitrata Fabricius (Lepidoptera: Crambidae) is a polyphagous insect pest of grain legumes that has a wide distribution throughout tropical and subtropical regions worldwide. Feeding damage caused by larval M. vitrata to cowpea crops occurs on flower buds, flowers and seed pods. This insect species develops without diapause and uses multiple alternative host plants during the dry season in West Africa when cowpea crops are not in cultivation [11][12][13]. Larval M. vitrata feeding has been documented on over 50 alternative host plants [11], [13][14], and most often found on cultivated and wild host plants from the family, Fabaceae [15][16]. Pterocarpus santalinoides L'He ´r. ex DC., P. phaseoloides and Centrosema pubescens (except cv. Belalto) are used for oviposition and subsequent larval development during the long dry season, whereas Lonchocarpus sericeus and L. cyanescens (Schumach and Thonn.) Benth. are similarly used during the main rainy season, and Tephrosia platycarpa Guill. and Perr. during the short rainy season [13]. The reservoirs of M. vitrata maintained on alternative host plants results in difficulties for cultural and chemical insecticides control. As proposed by [17], the possible Asian origin of M. vitrata may contribute to the lack of corresponding native natural enemies capable of regulating its populations in those alternative host plant habitats in West Africa, and thus might also lead to heavy infestations observed on cowpea crops. Efforts to introduce biological control candidate species have had limited success, and yet unrecognized biotic factors such as M. vitrata alternative host plant differentiation, could hinder the effective spread of introduced control agents [18]."},{"index":3,"size":340,"text":"Protein crystalline (Cry) toxins produced by the gram-positive soil bacterium Bacillus thuringiensis (Bt) show insecticidal activities against many Lepidopteran insects. Transgenic cowpea that express the Bt toxin Cry1Ab are being developed for the protection of this crop for use in West African cropping systems [19]. Although transgenic Bt-cowpea offers a promising approach to crop improvement, sustainability of the technology will likely depend on the mitigation of resistance development in M. vitrata populations and availability of suitable alternative host plants to act as refuges. Specifically, the high-dose refuge model is the most widely accepted IRM strategy [20], and has been implemented as an effective resistance management plan to delay the development of resistance to Bt in target pest insect populations [21]. The highdose component of this IRM strategy requires that crops express levels of Bt toxin sufficient to kill 100% of homozygous susceptible and heterozygous larvae. Refuges are non-Bt plants in proximity to Bt crops on which the targeted pests can also complete development [21]. In theory, refuge plants are able to produce a large population of adults that will mate randomly with any potential homozygous resistant individual that might complete development on a Bt crop plant. By shear stochastic sampling, rare homozygous resistant individuals that emerge from Bt fields are most likely to mate with a refuge plant-derived homozygous susceptible individual. This increases the probability that any resistant insects emerging from the Bt crops are more likely to mate with a susceptible adult emerging from the refuges, thereby generating heterozygous progeny that are not capable of surviving exposure to the high dose of Bt toxin expressed by transgenic crop in order to delay or prevent an increase in resistance allele frequency within target insect populations [22]. Wild-growing alternative host plants can also serve as natural refuges for target pests, and have been reported as effective refuges for IRM of transgenic crops [23]- [27]. In the case of M. vitrata, there are several alternative host plants which are available throughout the cowpea growing season and which might act as natural refuges."},{"index":4,"size":52,"text":"Assessing the suitability of alternative hosts as effective refuge plants for Bt-cowpea will be important for developing IRM programs for M. vitrata in West Africa. However, it is not clear when Bt-cowpea will be used broadly in West Africa, which highlights the need to enhance the efficacy of current pest control solutions."},{"index":5,"size":331,"text":"The control of M. vitrata in West Africa currently relies on the use of cultural and chemical control methods and increasingly on the use of biological control agents. Alternative host plant use and any potential genetic differentiation among populations based on this biological phenomenon may also impact how biocontrol agents are deployed [28]. The lack of alternative hosts may be a contributing factor in the observation that, although many biological control introductions result in establishment, most are unsuccessful in reducing pest densities [29]. Therefore, most managers of agricultural systems seek to manipulate habitat complexity to encourage the conservation and enhancement of natural enemies in the hopes of improving pest suppression (see reviews by [30][31][32]). A key factor that enhances predator and parasitoid populations in complex landscapes is the availability of nectar and pollen subsidies. Many natural enemies, particularly hymenopteran parasitoids, lacewings, syrphid flies, and tachinid flies are herbivorous as adults and require carbohydrates for successful reproduction. A literature review by [33] showed that the successful establishment of certain parasitoids in cropping systems depends on the presence of weeds that provide nectar for the adult female wasps. Laboratory and field studies have also demonstrated positive impacts on parasitoid fecundity, lifespan, or searching efficiency as a result of floral resources in bordering noncrop areas [34]- [37]. However, although alternative host plants have been reported to enhance parasitoid and predator efficiency in conservation biological control strategies, extensive populationlevel data are still needed for deployment of biocontrol agents to be effective. The application of population genetic data to biological control of M. vitrata will provide better information on how many distinct genotypes exist on the different host plants and the effect this can have on the parasitoid population over time. The use of population structure data will therefore enable the identification of the genetic differentiation of M. vitrata on cultivated cowpea and available alternative host plants and the effective host plants that can be planted alongside the cultivated cowpea in order to maximize parasitoid efficiency."},{"index":6,"size":134,"text":"Genetic variation among M. vitrata larvae on four host plants including cowpea in West Africa was assessed using haplotype sequencing of the mitochondrial cytochrome c oxidase-1 gene (cox1) fragment, as well as genotyping using a set of microsatellite markers previously developed by [38]. Levels of genetic and haplotype variation, population structure, and gene flow were estimated among M. vitrata collected from different host plants in southern regions of Benin. The results of this research are important for assessing the effectiveness of alternative host plants for use as a refuge for Bt-cowpea crops, and to potentially identify the most appropriate host plant to apply biocontrol agents. These data will be used to enhance ongoing efforts to reduce the impact of M. vitrata feeding damage and to improve yields in cowpea cropping systems of West Africa."}]},{"head":"Materials and Methods","index":2,"paragraphs":[]},{"head":"Ethics Statement","index":3,"paragraphs":[{"index":1,"size":85,"text":"For all the insect samples used in the study, no permission was required for the insect sampling and collection. Insect sampling and collection was performed with our collaborators at the International Institute of Tropical Agriculture (IITA), Benin. Permission was not required because the insects used for the study are common insect pests on legumes, and IITA Benin has a Memorandum of Understanding (MOU) with the government of Benin for conducting research on these insect pests. The insects used for this study are not endangered species."}]},{"head":"Insect Sampling and DNA Extraction","index":4,"paragraphs":[{"index":1,"size":190,"text":"Larval M. vitrata were collected from cultivated cowpea (Vigna unguiculata), and three alternative host plants -P. phaseoloides (dry season host), T. candida (short rainy season host), and L. sericeus (main rainy season host), in three divisions representing 6 departments in Southern Benin in 2012 (Figure 1). The divisions were Mono-Couffo, Zou-Collines and Oue ´me ´-Plateau. Within each division, we collected from different locations to lessen the possibility that the same female individual laid larvae collected. Forty-nine, 50 and 49 individual M. vitrata samples were collected from V. unguiculata in Oue ´me ´-Plateau, Zou-Collines, and Mono-Couffo, respectively. Forty-seven and 45 individual M. vitrata samples were collected from L. sericeus in Oue ´me ´-Plateau, and Zou-Collines, respectively. Fifty-two, 52 and 58 individual M. vitrata samples were collected from T. candida in Oue ´me ´-Plateau, Zou-Collines, and Mono-Couffo, respectively, and 49, 49 and 48 individual M. vitrata samples were collected from P. phaseoloides in Oue ´me ´-Plateau, Zou-Collines, and Mono-Couffo respectively. Genomic DNA was extracted from the insect samples using DNeasy animal tissue kit and following manufacturer instructions (Qiagen, Valencia, CA). The DNA concentrations were adjusted to 10 ng/ml and used for genotyping."}]},{"head":"Microsatellite Genotypes","index":5,"paragraphs":[{"index":1,"size":185,"text":"Microsatellite markers C0241, 7_02K06, C0444, C32008 and 01_B12 were used for genotyping M. vitrata samples (Table 1), amplified in multiplex PCR reactions and detected as previously described by [38]. The microsatellite markers were obtained as previously described in [38] and the DNA sequence libraries submitted to GenBank under the accession numbers from JN685509 to JN685580. The mean number of alleles per locus, observed heterozygosity and expected heterozygosity were calculated for genotypes by location and by host plant within each location using Arlequin v3.5.1.3 [39]. The potential occurrence of null alleles and other genotyping errors (stuttering and allele drop out) were tested using the program Micro-Checker v2.2.3 [40], and null alleles were suspected at a given locus when Micro-Checker rejected Hardy-Weinberg Equilibrium (HWE) and excess homozygosity was evenly distributed among allelic size classes. Null allele-corrected pairwise F ST estimates were calculated for all populations by applying the ENA correction in the FreeNA package ( [41][42]; available at http://www1.montpellier.inra.fr/ URLB/). Uncorrected F ST values were estimated following [43], whereas corrected F ST estimates were made when null allele were predicted following the expectation maximization (EM) algorithm [44]."},{"index":2,"size":242,"text":"Analysis of molecular variance (AMOVA), global F-statistics [45] and pairwise F ST estimates were calculated also using Arlequin v3.5.1.3 [39]. Four different analyses were performed based on assumed partitioning of the population based on host plant and/or geographic location; analysis 1: variation among host plants (pooled across all locations), analysis 2: variation among geographic locations (pooled for all host plants), analysis 3: differentiation between host plant within each geographic location, and analysis 4: differentiation between geographic location for each host plant group. Significance for each comparison was corrected for Type I error by application of the B-Y method [46]. The program STRUCTURE v2.3.4 uses a model-based clustering to predict population structure using genotypic marker data from individual samples, where the model assigns proportions of individual genotypes to one of K populations [47]. STRUC-TURE analysis of microsatellite genotype data was run using an initial burn-in of 100,000 iterations followed by 100,000 iterations, and ten replicates with each potential value of K (range 1 to 10) were run with an assumed population admixture model. STRUCTURE runs were performed using LOCPRIOR command, where genotypes were defined based on host plant at each geographic location. The 'real' value of K (number of potential unique populations represented by the M. vitrata genotypes) was estimated as described by [48] using the program Structure harvester ( [49]; available at http://taylor0.biology.ucla.edu/ structureHarvester/). A graphical display of individual co-ancestry (Q-matrix) data was generated from STRUCTURE output using the program Distruct [50]."},{"index":3,"size":50,"text":"Isolation by distance (IBD) model of genetic differentiation was tested by comparing F ST (1 -F ST ) with the logarithm of geographic distances, and significance evaluated using Mantel tests with 10,000 randomizations of the data. All IBD analyses were conducted using the IBDWS ( [51]; available at http://ibdws. sdsu.edu/,ibdws/)."}]},{"head":"Mitochondrial Haplotypes","index":6,"paragraphs":[{"index":1,"size":104,"text":"Oligonucleotide primers HC02198 59-TAA ACT TCA GGG TGA CCA AAA AAT CA-39 and LCO1490 59-GGT CAA CAA ATC ATA AAG ATA TTG G-39 [52] were used for PCR amplification of ,650 bp mitochondrial cytochrome c oxidase I (cox1) DNA barcode region. All PCR, SacI PCR-RFLP and DNA sequencing reactions were performed according to [53], except cycle sequencing using BigDye TM reactions (Applied Biosystems, Foster City, CA), which were performed at the Iowa State University DNA Sequencing and Synthesis Facility, Ames, IA where data was trimmed for PHRED scores ,20. The haplotype data were submitted to GenBank under the accession numbers from KJ175700 to KJ176247."},{"index":2,"size":131,"text":"DNA sequence data were aligned for each individual using CLUSTALX 1.8 [54]. Haplotype differentiation of sequence data was estimated among 1) host plant or 2) geographic location from which samples were collected using Q-statistics, which is an approximation of F-statistics, based on haplotype frequencies [46], [55]. The Q-statistics and AMOVA estimates were obtained using Arlequin as described previously, except the Kimura 2-parameter model was used for Q-statistic calculation with an empirical estimated gamma parameter = 0.05. AMOVA was used to partition haplotype variance between 1) host plants across geographic locations (sample sites) or 2) geographic location across different host plants. Pairwise Q ST estimates were made between host plant groups using Arlequin and significance for multiple tests within each comparison determined following application of the B-Y method [46] as described above."}]},{"head":"Results","index":7,"paragraphs":[]},{"head":"Microsatellite Genotypes","index":8,"paragraphs":[{"index":1,"size":503,"text":"The observed heterozygosity (H O ) across all loci ranged from 0.02 to 0.89 while the expected heterozygosity ranged from 0.02 to 0.67. Nineteen of the 55 exact tests across host plants and geographic locations showed significant deviation from HWE. Two of the markers were monomorphic (CO241 on L. sericeus at Zou-Collines and 7_02K026 on P. phaseoloides at Oue ´me ´-Plateau) (Table S1). MicroChecker analysis indicated that markers 7_02K06 and C0241 showed evidence of null allele presence in all populations that were tested. There was no evidence of stuttering or allele drop out in any of the microsatellite markers. Results of genetic differentiation estimates among M. vitrata were based on four sets of analyses; analysis 1: variation among host  plants (pooled across all locations), analysis 2: variation among geographic locations (pooled for all host plants), analysis 3: differentiation between host plants within each geographic location, and analysis 4: differentiation between geographic locations for each host plant group. Analysis 1. When microsatellite genotypes were divided into four groups based on the host plants from which M. vitrata larvae were collected, the global estimates of subpopulation differentiation across all loci were low but significant based on uncorrected (F ST = 0.06) and ENA-corrected microsatellite genotype data (F ST ENA = 0.05; Table 2). AMOVA results indicated that 93.03% of the genetic variation for M. vitrata was within host plant group while 5.71% was estimated among host plants (remaining data not shown). Pairwise F ST estimates of host plant differentiation based on uncorrected and ENAcorrected microsatellite data across all loci ranged from 0.01 to 0.09 (Table 3), and indicated that all comparisons were significant. Analysis 2: In comparison, microsatellite genotypes based on geographic location resulted in uncorrected F ST estimates of 0.02 (F ST ENA = 0.02; Table 2). Additionally, Mantel tests showed an absence of IBD through no detectable correlation between genetic and geographic distances (R 2 = 20.12, P = 0.49; remaining results not shown). Analysis 3: Analysis of host plant variation with a single location effectively removed a potential confounding influence of geographic variation on host plant differentiation. Subsequent pairwise F ST estimates ranged from 20.01 to 0.28, and significant differentiation was predicted for 11 of 15 comparisons at B-Y Method adjusted significant thresholds (Table 4). Analogously, Analysis 4 evaluated variation between geographic locations for M. vitrata collected from the same host plant, which predicted significant differentiation in 5 of 10 comparisons at B-Y adjusted significant thresholds (Table 5). STRUCTURE analysis indicated that there were 2 populations among all the samples on the different host plants and across locations (Figure 2). A maximum value of 7.41 was generated for mL''(K)/sL(K) at K = 2, which represented the ''real'' population number (K) that STRUCTURE predicted from microsatellite dataset. The estimated co-ancestries were partitioned into these two distinct clusters among the M. vitrata microsatellite genotypes, and were partitioned among host plant groups from 3 geographic locations (Figure 2). Cluster 1 (orange) was proportionately most common among M. vitrata samples from V. unguiculata at Oue ´me"},{"index":2,"size":13,"text":"´-Plateau and Mono-Couffo, Benin as well as from T. candida at Mono-Couffo, Benin."}]},{"head":"Mitochondrial Haplotypes","index":9,"paragraphs":[{"index":1,"size":235,"text":"The mitochondrial cox1 gene fragment that was PCR amplified in this study was also previously used to investigate haplotype variation among M. vitrata in West Africa by [53]. Alignment of novel coxI sequence data from 548 individuals collected from 4 different host plants at 3 different geographic locations resulted in a 619 bp consensus sequence which showed a mean nucleotide diversity of 0.001960.0014 (mean number of pairwise sequence differences 1.1760.76). Results of AMOVA showed that 94.15% of the haplotype variation was within populations based on host plant from which larvae were collected, whereas 4.80% of the variation was among populations (remaining data not shown). A global estimate of haplotype differentiation among host plant groups was also low (Q ST = 0.05) but significant (P,0.001). Pairwise Q ST estimates which was analogous to analyses 1 to 4 used for microsatellite data (see previous section), ranged from 20.01 to 0.20 (Table 6), and showed significant differentiation for 11 of 55 comparisons at the B-Y adjusted significance threshold of 0.01 (Table S1). For example, these results showed significant variation between Q ST estimates between T. candida and both V. unguiculata and L. sericeus at Oue ´me ´-Plateau, Benin. Also, M. vitrata collected from V. unguiculata at Oue ´me ´-Plateau, Zou Collines and Mono Couffo, Benin showed no significant mitochondrial haplotype variation (P$0.148), but M. vitrata collected from T. candida showed significant variation between all 3 geographic locations (P#0.002)."}]},{"head":"Discussion","index":10,"paragraphs":[{"index":1,"size":224,"text":"Microsatellite markers developed from species of Lepidoptera can have high frequencies of non-PCR amplifying ''null'' alleles that potentially result in the overestimation of homozygosity, and have been reported in population genetic studies from a range of taxa [56], [57]. Microsatellite markers from Lepidopteran insects and molluscs have been reported to have particularly high frequencies of null alleles (review in [41]). Associations between null alleles and highly variable flanking regions have been repeatedly demonstrated (see [41]). Recent evidence suggests that null alleles at some microsatellite loci may be affected by movement of transposable elements [58]. Indeed, two of the microsatellite loci (7_02K06 and C0241) showed the presence of null alleles, but the molecular basis for the non-PCR amplification of alleles was not investigated. Regardless of the cause, resulting F ST estimates from this study were corrected using the ENA algorithm, which has previously been shown to allow for accurate analysis of population genetic microsatellite data. Both ENAcorrected as well as uncorrected F ST estimates from microsatellite data analyses provided congruent results that suggested significant Table 4. Estimates of Maruca vitrata subpopulation differentiation from pairwise F ST between host plant groups at each geographic location (below diagonal) and significance of corresponding comparisons (P-values) as indicated above the diagonal (Oueme-Plateau, B-Y corrected a = 0.020; Zou-Collines, B-Y corrected a = 0.020; Mono-Couffo, B-Y corrected a = 0.027)."}]},{"head":"Oueme-Plateau","index":11,"paragraphs":[{"index":1,"size":346,"text":"Zou levels of genetic variation exist between M. vitrata collected from the different host plants, but this variation is not consistently present among comparisons at different geographic locations. Larval M. vitrata are a major pest of cultivated cowpea, V. unguiculata, in the tropics and subtropics, and are difficult to control through applications of chemical insecticides because sprays cannot contact larvae that have burrowed into the flowers and pods. The development and implementation of cowpea that expresses the Bt Cry1Ab toxin holds the promise to effectively control M. vitrata feeding damage, but the evolution of resistance in several species of Lepidoptera to Bt toxin has also raised concerns regarding the longevity of this technology [59]. Prior to release of cowpea varieties to farmers in West Africa, an understanding of the biology, ecology and population structure is fundamental in making sound and effective IRM decisions, which may prolong the field efficacy of this Bt technology. Significant levels of genetic differentiation were previously estimated among M. vitrata collected from V. unguiculata in the West African countries of Niger, Nigeria and Burkina Faso using data from SNPs [53] and microsatellite markers [38]. Genetic differentiation among M. vitrata populations was positively correlated with geographic distance [53]. Additionally, mitochondrial haplotypes were previously shown to be differentiated among M. vitrata collected from cowpea in the West African nations of Nigeria, Niger and Burkina Faso, with 2 distinct haplotype groups being predicted [53]. Winged insects that are capable of long distance flight (reviewed by [60]) are typically genetically homogenous [61][62][63], where admixture effectively results in a single random mating population that lacks any significant gene flow barriers [64]. M. vitrata persist in southern coastal repositories during the dry season and undergo a seasonal range expansion as the population migrates to northern regions when climatic conditions become more favorable at the onset of the rainy season [12], [65]. This pattern of seasonal migration may cause genetic structuring due to the Wahlund effect or other unknown population genetic factors [53], [38], but the influence of a number of other potential confounding factors was not previously investigated."},{"index":2,"size":271,"text":"IRM programs for Bt-cowpea in West Africa will likely use a high-dose/refuge strategy, where refugia of non-transgenic plants will be essential for maintaining a reservoir of susceptible alleles. The high-dose/refuge strategy is considered central to managing resistance to Bt toxins, but the level of gene flow and random mating within and between populations of target insects is also important for the spread of susceptible genotypes in the population [22], [66]. Refugia can be comprised of cultivated non-transgenic crop plants or perhaps any other host plants that can support significant population sizes for the targeted insect pest species. Weedy species that are alternative hosts to arthropod pests may also serve as an effective form of refugia. Models based on studies of maize cropping systems suggest that increased habitat diversity, including weedy vegetation, could reduce the rate of spread of rotation-resistant western corn rootworm [67]. Studies have also reported that the utilization of wild host plants can be effective refuges within IRM strategies for transgenic crops [23][24][25][26][27]. Although M. vitrata are known to feed on multiple non-cowpea plants, the level of gene flow between individuals feeding on cowpea and these other plants remains unknown, and may affect the efficacy of IRM strategies. Many species of Lepidoptera are polyphagous and are opportunistic insects that feed on multiple alternative host plants, but instances of differential rates of development are proposed to result in reduced gene flow due to temporal variation in adult mating periods, such that assortative or structured mating systems have evolved [68][69]. Breakdown of Table 5. gene flow between sympatric populations of a species has been hypothesized to cause host race formation [8]."},{"index":3,"size":254,"text":"Low but significant levels of genetic differentiation was estimated from microsatellite marker and mitochondrial haplotype data between M. vitrata collected from cultivated cowpea (V. unguiculata) and alternative native host plants P. phaseoloides, L. sericeus and T. candida. Analogous sampling of M. vitrata from alternative hosts was not conducted in previous studies [53]  [38], and provided new insights into possible genetic structure in West Africa. Results of the current study might suggest little host plantrelated M. vitrata population structure from initial analyses of microsatellite (F ST = 0.05) and haplotype data (Q ST = 0.04). Also in contrast to previous results by [53] and [38], genetic variation in this current study was shown to be low between the 3 collection sites and not correlated with geographic distance. This might be due to our sampling that was restricted to just the southern region of Benin. Additional analyses which potentially removed the confounding influence of geographic variance showed significant pairwise genetic differentiation between M. vitrata collected from all of the different host plants at Oue ´me ´-Plateau, but this pattern was not consistent at the Zou-Collines or Mono-Couffo locations. Similar inconsistent results were observed among pairwise comparisons of M. vitrata from different geographic locations but collected from the same host plant. These findings were supported by analysis with the program STRUCTURE, where co-ancestry represented by Cluster 2 (blue) was prevalent among M. vitrata collected from all different host plants, with the exception of individuals collected from V. unguiculata at Oue ´me ´-Plateau and T. candida at Mono-Couffo."},{"index":4,"size":46,"text":"With respect to the high dose-refuge strategy, the apparently weak and inconsistent genetic differentiation of M. vitrata on different host plants might suggest that high levels of gene flow would occur between susceptible individuals on wild alternative hosts and rare resistant individuals that survive on Bt-cowpea."},{"index":5,"size":600,"text":"Although not conclusive, our findings might also suggest that the wild hosts surveyed in this study may serve as effective refuge plants in any eventual implementation of Bt-cowpea in West Africa. Lack of consistent host plant differentiation among M. vitrata across multiple geographic locations might also suggest that the females have not become ''tuned'' for oviposition on specific host plants, such that host-races are not likely to have formed. More likely, complex temporal interactions between plant phenologies and attraction of female M. vitrata for oviposition may play a role in determining host plant usage and subsequent levels of gene flow at a specific locality in a specific year. Thus variation in local environments could influence oviposition and/or subsequent larval development on host plants, such that random and significant perturbations on genetic distribution might be detected. Alternatively, climatic conditions have been shown to support basal insect population sizes during conditions previously thought to be restrictive [70], such that some alternative noncultivated hosts might harbor reservoirs of M. vitrata during the dry season. Sampling of these presumable small reservoir populations in this study might have inadvertently skewed our estimates of within population differentiation, and could complicate any future population genetic studies where these confounding factors are not taken into account. Regardless, our data might not suggest that random mating will occur between rare resistant moths emerging from Bt-cowpea and susceptible moths derived from non Btcowpea or native host plant refuges. The rate of development among Bt resistant individuals has been documented, such that assortative mating might be possible due to temporal delay in emergence of subsequent adults. In such a scenario, the mating period of reproductive adults may show limited overlap and could result in reduced gene flow. Under the assumptions of the highdose/refuge strategy, temporal delays between adult emergence from Bt-cowpea, non Bt-cowpea and alternative host plants will affect the probabilities at which the rare resistant individuals mate with susceptible adults, and could lead to the rapid increase in  homozygous resistant genotypes within the pest insect population if significant temporal delays are encountered. The interactions between insect pests, their natural enemies, and the natural vegetation often leads to more efficient biological control, not only because of the increased availability of refugia and alternative prey for natural enemies during off-seasons, but also because of the higher diversity in the natural vegetation (e.g. [71][72]). [73] reported that the availability of alternative host plants positively affects parasitism rates, and should consequently reduce overall pest densities. Because of the semi-migratory habit of M. vitrata, [74] suggested two different levels from which to consider possible biological control interventions. The first option during the cropping season in cowpea fields, would be the inundative release of locally available, mass-reared trichogrammatids, preferably in conjunction with the use of pheromone trapderived thresholds [75], particularly in areas where M. vitrata does not have suitable alternative host plants during the dry season, but rather invades the cowpea fields like a migrant pest (e.g., coming from the south, as it is the case for the Kano region, see [12]). The second option would be more appropriate in areas where alternative host plants are abundant and constitute a major factor influencing the dynamics of M. vitrata populations. In this case, inoculative releases of larval parasitoids such as Therophilus javanus or T. marucae (Hymenoptera: Braconidae) will be targeting M. vitrata populations on those host plants, with the objective of reducing overall pod borer populations at the landscape level. Based on the results obtained in the present study, the second option would seem more appropriate in the introduction and release of biocontrol agents against M. vitrata."}]}],"figures":[{"text":"Figure 1 . Figure 1. Map showing collection sites in southern Benin (red circles -Mono-Couffo, blue circles -Zou-Collines, and green circles -Oue ´me ´-Plateau). doi:10.1371/journal.pone.0092072.g001 "},{"text":" Estimates of Maruca vitrata subpopulation differentiation from pairwise F ST between locations from the same host plant (below diagonal) and significance of corresponding comparisons (P-values) as indicated above the diagonal (V. unguiculata, B-Y corrected a = 0.027; L. sericeus, B-Y corrected a = 0.05; T. candida, B-Y corrected a = 0.027; P. phaseoloides, B-Y corrected a = 0.027). Zou-Collines Mono-Couffo Oueme-Plateau Zou-Collines Mono-Couffo Oueme-Plateau Zou-Collines Mono-Couffo Oueme-Plateau Zou-Collines Mono-Couffo Oueme-Plateau -.1371/journal.pone.0092072.t005 "},{"text":"Figure 2 . Figure 2. Partitioned co-ancestries among microsatellite-defined M. vitrata genotypes generated using the program STURUTURE with the LOCPRIOR command. For each, the estimated co-ancestry was derived from the Q-matrix for each individual and represented as vertical lines showing the proportion of the K = 2 segments that made up the individual genotype. Genotypes identified from the host plants V. unguiculata, L. sericeus, P. phaseoloides and T. candida across the locations are defined [OPV -Oue ´me ´-Plateau (V. unguiculata), ZCV -Zou-Collines (V. unguiculata), MCV -Mono-Couffo (V. unguiculata), OPL -Oue ´me ´-Plateau (L. sericeus), ZCL -Zou-Collines (L. sericeus), OPP -Oue ´me ´-Plateau (P. phaseoloides), ZCP -Zou-Collines (P. phaseoloides), MCP -Mono-Couffo (P. phaseoloides), MCT -Mono-Couffo (T. candida), ZCT -Zou-Collines (T. candida) and OPT -Oue ´me ´-Plateau (T. candida)]. doi:10.1371/journal.pone.0092072.g002 "},{"text":"Table 1 . Maruca vitrata primer sequences used for microsatellite amplification reactions.    Size Size Locus Primer (dye label) and sequence (59-39) Repeat (bp) LocusPrimer (dye label) and sequence (59-39) Repeat(bp) C32008 E F-(MAX)AAAAAGCGCTTATATGTTTGTTATAGT (CATA) 3 163 C32008 EF-(MAX)AAAAAGCGCTTATATGTTTGTTATAGT(CATA) 3 163  R-GAAATTTTTAACGGAGATACAATCA   R-GAAATTTTTAACGGAGATACAATCA 7_02K06 A F-(FAM)ATTTGTCAGAATGGTATCTTACGT (GAT) 6 151 7_02K06 A F-(FAM)ATTTGTCAGAATGGTATCTTACGT(GAT) 6151  R-CCTCTGGGTCATAATTATATTGTTCA   R-CCTCTGGGTCATAATTATATTGTTCA C0444 E, 1 F-(FAM)AAAGGAACTACGCCGTCAGG (CAA) 8 102 C0444 E, 1 F-(FAM)AAAGGAACTACGCCGTCAGG(CAA) 8102  R-GTTGAGCGATCTTGGCACAG   R-GTTGAGCGATCTTGGCACAG C0241 E F-(TAM)GACGAAACAAGGCCTACCAG (GAT) 9 165 C0241 EF-(TAM)GACGAAACAAGGCCTACCAG(GAT) 9165  R-GGTACTTCYGACGTTGTTCG   R-GGTACTTCYGACGTTGTTCG 01_B12 F-(TAM)CGGGATGTTACATATACCCAGCA (CA) 12 119 01_B12F-(TAM)CGGGATGTTACATATACCCAGCA(CA) 12119  R-CGTACCAATTCATTGAGACTCTCTT   R-CGTACCAATTCATTGAGACTCTCTT E, EST-derived primer pair; A, anonymous genomic sequence-derived primer E, EST-derived primer pair; A, anonymous genomic sequence-derived primer pair; 1, PCR multiplexed primers.   pair; 1, PCR multiplexed primers.  "},{"text":"Table 2 . Global and locus-by-locus estimates of subpopulation differentiation using uncorrected (F ST ) and ENA-corrected microsatellite genotype data (F ST ENA ) between four host plant groups (V. unguiculata, P. phaseoloides, L. sericeus, and T. candida) or geographic location in Benin (Oue ´me ´-Plateau, Zou-Collines and Mono-Couffo). Locus Host plant groups Geographic location LocusHost plant groupsGeographic location  F ST F ST ENA F ST F ST ENA F STF STENAF STF STENA Global 0.056 0.054 0.016 0.024 Global0.0560.0540.0160.024 C0241 0.003 0.013 0.002 0.018 C02410.0030.0130.0020.018 7_02K06 0.109 0.111 0.055 0.077 7_02K060.1090.1110.0550.077 01_B12 0.123 0.111 0.012 0.019 01_B120.1230.1110.0120.019 C32008 0.011 0.011 0.006 0.005 C320080.0110.0110.0060.005 C0444 20.001 0.002 20.002 0.002 C044420.0010.00220.0020.002 doi:10.1371/journal.pone.0092072.t002   doi:10.1371/journal.pone.0092072.t002  "},{"text":"Table 3 . Pairwise estimates of subpopulation differentiation across all microsatellite loci with and without ENA-correction (F ST ) (below diagonal) and significance of corresponding comparisons (P-values) as indicated above the diagonal.  V. unguiculata L. sericeus T. candida P. phaseoloides V. unguiculata L. sericeus T. candida P. phaseoloides V. unguiculataL. sericeusT. candidaP. phaseoloidesV. unguiculataL. sericeusT. candidaP. phaseoloides  Uncorrected    Corrected    UncorrectedCorrected V. unguiculata - 0.001* 0.010* ,0.001* - 0.001* ,0.001* ,0.001* V. unguiculata-0.001*0.010*,0.001*-0.001*,0.001*,0.001* L. sericeus 0.09 - ,0.001* ,0.001* 0.13 - ,0.001* ,0.001* L. sericeus0.09-,0.001*,0.001*0.13-,0.001*,0.001* T. candida 0.02 0.03 - 0.010* 0.01 0.09 - 0.010* T. candida0.020.03-0.010*0.010.09-0.010* P. phaseoloides 0.04 0.03 0.01 - 0.04 0.13 0.01 - P. phaseoloides0.040.030.01-0.040.130.01-  "},{"text":"Table 6 . Pairwise estimates of mitochondrial cox1 haplotype differentiation among Maruca vitrata collected from different host plants (Q ST ) (below diagonal) and significance of corresponding comparisons (P-values) as indicated above the diagonal. Significance determined at a B-Y adjusted significance threshold of a # 0.020.  V. unguiculata L. sericeus T. candida P. phaseoloides V. unguiculata L. sericeus T. candida P. phaseoloides V. unguiculata - 0.010* ,0.001* 0.020* V. unguiculata-0.010*,0.001*0.020* L. sericeus 0.02 - ,0.001* ,0.001* L. sericeus0.02-,0.001*,0.001* T. candida 0.02 0.01 - ,0.001* T. candida0.020.01-,0.001* P. phaseoloides 0.01 0.04 0.06 - P. phaseoloides 0.010.040.06-  "}],"sieverID":"75a6428d-7bfd-4093-bf21-5452ab66e06c","abstract":"Maruca vitrata Fabricius (Lepidoptera: Crambidae) is a polyphagous insect pest that feeds on a variety of leguminous plants in the tropics and subtropics. The contribution of host-associated genetic variation on population structure was investigated using analysis of mitochondrial cytochrome oxidase 1 (cox1) sequence and microsatellite marker data from M. vitrata collected from cultivated cowpea (Vigna unguiculata L. Walp.), and alternative host plants Pueraria phaseoloides (Roxb.) Benth. var. javanica (Benth.) Baker, Loncocarpus sericeus (Poir), and Tephrosia candida (Roxb.). Analyses of microsatellite data revealed a significant global F ST estimate of 0.05 (P#0.001). The program STRUCTURE estimated 2 genotypic clusters (co-ancestries) on the four host plants across 3 geographic locations, but little geographic variation was predicted among genotypes from different geographic locations using analysis of molecular variance (AMOVA; among group variation 20.68%) or F-statistics (F ST Loc = 20.01; P = 0.62). These results were corroborated by mitochondrial haplotype data (Q ST Loc = 0.05; P = 0.92). In contrast, genotypes obtained from different host plants showed low but significant levels of genetic variation (F ST Host = 0.04; P = 0.01), which accounted for 4.08% of the total genetic variation, but was not congruent with mitochondrial haplotype analyses (Q ST Host = 0.06; P = 0.27). Variation among host plants at a location and host plants among locations showed no consistent evidence for M. vitrata population subdivision. These results suggest that host plants do not significantly influence the genetic structure of M. vitrata, and this has implications for biocontrol agent releases as well as insecticide resistance management (IRM) for M. vitrata in West Africa."}

data/part_3/08bce50047e84bbd0f984fefefae2914.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08bce50047e84bbd0f984fefefae2914","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ca5478df-101a-48c3-b628-f78964f5b9f3/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":47,"text":"W omen, children and other marginalized groups in dry areas typically rely on small ruminants for their nutrition and livelihoods. This project aims to transform the lives of goat keepers in India and Mozambique by turning their subsistence level goat production into a viable and profitable enterprise."},{"index":2,"size":84,"text":"Goat value chains are complex and comprise many different sets of people and organizations with diverse interests and incentives. The goal of this two-year project (2011)(2012) is to improve performance of small ruminant value chains in India and Mozambique so they sustainably increase the household incomes and food security and, reduce the vulnerability of poor goat keepers, especially women. The project will develop and test organizational and technical models for value chain development using multi-stakeholder mechanisms and processes like innovation platforms and producer hubs."},{"index":3,"size":123,"text":"Innovation platforms provide spaces for value chain actors to interact, communicate and act to improve performance of the value chain and the resulting benefits to the actors. The producer hubs are mechanisms through which collective marketing of goats and inputs of goods and services can be achieved in a cost-effective manner. These mechanisms will contribute to building capacity of value chain actors, with women playing key roles in these processes. Using an appropriate and focused Monitoring and Evaluation framework, the project will document the participatory approaches used and lessons learned and generate research evidence towards the development of goat value chain models that benefit the poor. Lessons learned and opportunities for scaling up and out will be communicated to policymakers and development practitioners."}]},{"head":"Project sites","index":2,"paragraphs":[{"index":1,"size":33,"text":"The target zones are the semi-arid areas of India and Mozambique. The specific project areas are Udaipur district (Rajasthan) and Dumka district (Jharkhand) in India and; Inhassoro district (Northern Inhambane province) in Mozambique."}]},{"head":"Beneficiaries","index":3,"paragraphs":[{"index":1,"size":81,"text":"The main target groups are poor goat keepers, especially women, other marginalized groups like scheduled castes and tribes in India; households living with HIV/AIDS and Female Headed Households in Mozambique. These include small-scale agro-pastoralists who cultivate small plots of land, as well as the landless. In both cases, a high degree of dependence on common property resources is a key feature. In addition to goat keepers, beneficiaries include other goat value chain actors such as small-scale traders, input and service providers."}]},{"head":"Partners","index":4,"paragraphs":[{"index":1,"size":54,"text":"The International Livestock Research Institute (ILRI) will be responsible for the overall project implementation and leading the research. BAIF Development Research Foundation in India and CARE International in Mozambique will lead the development aspects and local administration in their respective project sites. The project will collaborate with national researchers and other local development partners."},{"index":2,"size":35,"text":"The project will forge linkages with community development projects supported by the International Fund for Agricultural Development in India and Mozambique with a view to facilitating the exchange of experiences and mutual sharing of lessons."}]}],"figures":[{"text":"  "}],"sieverID":"67152dac-85fa-46df-92ba-4d2671c3a0cc","abstract":""}

data/part_3/0932305ad94698020f385a3644afdddc.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0932305ad94698020f385a3644afdddc","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/fe3d5d7a-3c2c-419a-b8cf-a487b64c2cf2/retrieve"},"pageCount":1,"title":"Cartographie du risque d'infl uenza aviaire de sous-type","keywords":[],"chapters":[],"figures":[],"sieverID":"679181d0-4c41-4163-874c-e1650703c70e","abstract":""}

data/part_3/09d351009197759c54f9ff4f19468950.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09d351009197759c54f9ff4f19468950","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f770438f-322b-497c-a4c1-c3aafd25077b/retrieve"},"pageCount":9,"title":"CGIAR Initiative on One Health communication plan","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":25,"text":"The CGIAR 2030 research and innovation strategy is being implemented through a series of research initiatives designed to create lasting impact in five key areas:"},{"index":2,"size":6,"text":"• nutrition, health and food security;"},{"index":3,"size":6,"text":"• poverty reduction, livelihoods and jobs;"},{"index":4,"size":7,"text":"• gender equality, youth and social inclusion;"},{"index":5,"size":6,"text":"• climate adaptation and mitigation; and"},{"index":6,"size":5,"text":"• environmental health and biodiversity."},{"index":7,"size":78,"text":"One of these research initiatives, Protecting human health through a One Health approach (One Health Initiative), aims to improve the prevention and control of antimicrobial resistance, foodborne diseases and zoonoses in seven target countries: Bangladesh, Côte d'Ivoire, Ethiopia, India, Kenya, Uganda and Vietnam. Launched in January 2022 for an initial three years, the One Health initiative will be implemented in collaboration with national and regional partners including academia, national agricultural research systems, non-governmental organizations and the private sector."},{"index":8,"size":11,"text":"The initiative's research activities will take place through five work packages:"},{"index":9,"size":2,"text":"• zoonoses;"},{"index":10,"size":3,"text":"• food safety;"},{"index":11,"size":3,"text":"• antimicrobial resistance;"},{"index":12,"size":7,"text":"• environment (water and wildlife interfaces); and"},{"index":13,"size":5,"text":"• economics, governance and behaviour."}]},{"head":"Objectives","index":2,"paragraphs":[{"index":1,"size":28,"text":"This communication plan covers the first year of the initiative (January to December 2022). As this is the start-up phase of the initiative, the main communication objectives are:"},{"index":2,"size":3,"text":"• creating awareness;"},{"index":3,"size":4,"text":"• sharing information; and"},{"index":4,"size":5,"text":"• connecting teams and collaborating."},{"index":5,"size":2,"text":"Guiding principles "}]},{"head":"Key messages","index":3,"paragraphs":[{"index":1,"size":32,"text":"Objective of the initiative: This initiative uses a One Health approach to reduce antimicrobial resistance, improve food and water safety, and manage zoonotic diseases, leading to better human, animal, and environment health."},{"index":2,"size":28,"text":"The challenge: Working across multiple sectors and disciplines, a One Health approach is best to effectively tackle the complex global challenges of antimicrobial resistance, foodborne diseases and zoonoses."},{"index":3,"size":49,"text":"• Antimicrobial resistance causes 1.2 million deaths annually and is projected to kill 10 million people every year by 2050. • The magnitude of the global burden of foodborne diseases is comparable to that of HIV/AIDS, malaria or tuberculosis, and most of this burden is in low-and middle-income countries."},{"index":4,"size":89,"text":"• About 600 million people fall ill and 475,000 die each year after eating contaminated food, and unsafe food costs low-and middle-income economies USD 110 billion in lost productivity and medical expenses annually. • Livestock generate 85% of global animal faecal waste, leading to environmental degradation and human exposure to antimicrobial residues and waterborne pathogens. • More than 60% of human infectious diseases come from animals and yet health systems often do not prioritise endemic zoonoses, especially in poor countries which bear 98% of the global burden of zoonoses."}]},{"head":"Activities","index":4,"paragraphs":[{"index":1,"size":43,"text":"In collaboration with national and regional partners, the initiative will generate evidence for decision-making, evaluate impacts of the One Health approach, and scale up innovations into national policies and programs in seven target countries (Bangladesh, Côte d'Ivoire, Ethiopia, India, Kenya, Uganda and Vietnam)."},{"index":2,"size":127,"text":"• The antimicrobial resistance work package will reduce the burden of antimicrobial resistance by promoting the prudent use of antimicrobials in crop, fish and livestock production systems. • The food safety work package will reduce the burden of foodborne disease in traditional food value chains, with a focus on animal-source foods and other perishables. • The water work package will improve waste and water management in livestock and aquaculture systems to reduce antimicrobial residues and zoonotic pathogens. • The zoonoses work package will pre-empt the emergence and spread of zoonoses at the interface of wildlife, livestock and people. • The economics, governance and behaviour work package will investigate the drivers of people's behaviour within food systems and the impact of policies and governance approaches on this behaviour."},{"index":3,"size":102,"text":"• Email: Email will be used as the main channel for internal and external communication, information sharing and collaboration. • Microsoft Teams: Microsoft Teams will be used primarily for team collaboration activities including work planning, meetings and sharing of updates and working documents among members of the work packages and the initiative management unit. • SharePoint: A SharePoint site, linked to Microsoft Teams, will be used for sharing and curation of internal documents e.g. meeting notes, reports, concept notes etc. • Meetings: In-person and/or hybrid meetings for team planning and stakeholder engagement will be held in accordance with the prevailing COVID-19 regulations. "}]},{"head":"Resources","index":5,"paragraphs":[]},{"head":"Monitoring and evaluation","index":6,"paragraphs":[{"index":1,"size":61,"text":"Regular monitoring and evaluation will be carried out to track the status of implementation of the communication plan. Both qualitative and quantitative indicators will be evaluated, as summarized in the table below. Objective This initiative uses a One Health approach to reduce antimicrobial resistance, improve food and water safety, and manage zoonotic diseases, leading to better human, animal, and environment health."}]},{"head":"Challenge","index":7,"paragraphs":[{"index":1,"size":28,"text":"Activities Outcomes Working across multiple sectors and disciplines, a One Health approach is best to effectively tackle the complex global challenges of antimicrobial resistance, foodborne diseases and zoonoses."},{"index":2,"size":43,"text":"In collaboration with national and regional partners, the initiative will generate evidence for decision-making, evaluate impacts of the One Health approach, and scale up innovations into national policies and programs in seven target countries (Bangladesh, Côte d'Ivoire, Ethiopia, India, Kenya, Uganda and Vietnam)."},{"index":3,"size":32,"text":"As a result of this work, countries will adopt the One Health approach in policy planning and implementation to reduce the burdens of antimicrobial resistance, unsafe food and water, and zoonotic diseases."}]},{"head":"Supporting facts/data/arguments","index":8,"paragraphs":[]},{"head":"•","index":9,"paragraphs":[{"index":1,"size":19,"text":"Antimicrobial resistance causes 1.2 million deaths annually and is projected to kill 10 million people every year by 2050."}]},{"head":"•","index":10,"paragraphs":[{"index":1,"size":28,"text":"The magnitude of the global burden of foodborne diseases is comparable to that of HIV/AIDS, malaria or tuberculosis, and most of this burden is in low-and middle-income countries."},{"index":2,"size":33,"text":"• About 600 million people fall ill and 475,000 die each year after eating contaminated food, and unsafe food costs low-and middle-income economies US$ 110 billion in lost productivity and medical expenses annually."},{"index":3,"size":22,"text":"• Livestock generate 85% of global animal faecal waste, leading to environmental degradation and human exposure to antimicrobial residues and waterborne pathogens."},{"index":4,"size":34,"text":"• More than 60% of human infectious diseases come from animals and yet health systems often do not prioritize endemic zoonoses, especially in poor countries which bear 98% of the global burden of zoonoses."}]},{"head":"•","index":11,"paragraphs":[{"index":1,"size":26,"text":"The antimicrobial resistance work package will reduce the burden of antimicrobial resistance by promoting the prudent use of antimicrobials in crop, fish and livestock production systems."}]},{"head":"•","index":12,"paragraphs":[{"index":1,"size":26,"text":"The food safety work package will reduce the burden of foodborne disease in traditional food value chains, with a focus on animal-source foods and other perishables."}]},{"head":"•","index":13,"paragraphs":[{"index":1,"size":22,"text":"The water work package will improve waste and water management in livestock and aquaculture systems to reduce antimicrobial residues and zoonotic pathogens."}]},{"head":"•","index":14,"paragraphs":[{"index":1,"size":20,"text":"The zoonoses work package will pre-empt the emergence and spread of zoonoses at the interface of wildlife, livestock and people."}]},{"head":"•","index":15,"paragraphs":[{"index":1,"size":28,"text":"The economics, governance and behaviour work package will investigate the drivers of people's behaviour within food systems and the impact of policies and governance approaches on this behaviour."}]},{"head":"•","index":16,"paragraphs":[{"index":1,"size":25,"text":"Countries will be able to use evidence from this research initiative in their national antimicrobial resistance action plans to reduce antimicrobial use and antimicrobial resistance."},{"index":2,"size":29,"text":"• This work will facilitate government and private sector support for voluntary upgrading of informal food business operators serving 174,000 consumers towards their integration into food safety regulatory structures."},{"index":3,"size":34,"text":"• National One Health policies can draw on this research to recognize the role of water in the transmission of pathogens and antimicrobial resistance and adopt proposed solutions for improved waste and water management."},{"index":4,"size":37,"text":"• This work will enable countries to adopt decision-support tools for emerging infectious diseases, and as a result at least 100,000 livestock-dependent people will benefit from strategies that integrate human and animal health services to control zoonoses."},{"index":5,"size":33,"text":"• National One Health policies can draw on this work when considering gendered constraints and incentives of smalland medium-scale food system actors, trade-offs across policy goals, and the magnitude and distribution of impacts."}]}],"figures":[{"text":"  "},{"text":" The initiative proposal was developed by scientists from four CGIAR research centres -the International Food Policy Research Institute (IFPRI), the International Livestock Research Institute (ILRI), the International Water Management Institute (IWMI) and WorldFish -in collaboration with external research partners from Centre Suisse de Recherches Scientifiques en Côte d'Ivoire, EcoHealth Alliance and the University of Liverpool.  "}],"sieverID":"19392356-c105-45e6-82fa-b649b8a4e3b0","abstract":""}

data/part_3/09f5c6555d932e0fb7ad80aec67b7643.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09f5c6555d932e0fb7ad80aec67b7643","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/16649214-d0e6-4fd1-826f-34e622c80abb/retrieve"},"pageCount":4,"title":"Sheep and goat marketing in Nyando Climate-Smart Villages of western Kenya What do the farmers gain?","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":124,"text":"The Nyando Basin covering two counties of western Kenya, namely Kericho and Kisumu has been adversely affected by climate change. Prolonged droughts, followed by heavy and unpredictable rainfall that causes flooding has led to land denudation, crop and livestock losses (IPCC, 2007;Onyango et al., 2012;Kinyangi et al., 2015). To address the adverse effects of climate change, and improve incomes for smallholder farmers, the CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS) and the International Livestock Research Institute (ILRI) introduced improved indigenous breeds of goats and sheep to farmers grouped into clusters within the Climate-Smart Villages (CSVs) (Ojango et al., 2016). The aim was to cross selected Galla goat and Red Maasai sheep with the small local East African breeds for resilience."},{"index":2,"size":47,"text":"From the initial 100 breeding units of Galla goat and Red Maasai sheep in 2012, their crosses represent about one third of the sheep and goats in the villages in 2018. These improved sheep and goats are currently a source of income for meeting various household needs."},{"index":3,"size":48,"text":"Linking smallholder farmers to markets is key to sustain a long-term breeding program for the Climate-Smart Villages. In order to understand the livestock marketing process and the interactions among market actors, we studied the local markets for the animals and their products and outlined the existing value chain."}]},{"head":"Method","index":2,"paragraphs":[{"index":1,"size":87,"text":"Data collection was done through face to face interviews with traders in the market place on the main market days. The market centres are Sondu, Katito, Nyakwere, Ahero, and Kipsitet. Traders from the five markets were interviewed on their business activities, main livestock species traded, availability of credit facilities, and specific aspects of sheep and goat trading. The traders also provided information on the traits they looked for when purchasing sheep and goats, and the different types of buyers of sheep and goat products in the marketplace."}]},{"head":"Results","index":3,"paragraphs":[{"index":1,"size":46,"text":"A large number of sheep and goats were traded each week on specific market days in the five different markets where farmers from Nyando CSVs sell their livestock. The different market actors identified in those markets, and the interrelationships among them are presented in Figure 1. "}]},{"head":"Market actors and their roles","index":4,"paragraphs":[{"index":1,"size":97,"text":"Producers: Smallholder farmers are the main suppliers of sheep and goats for sale in these markets. The farmers, however, have limited information on the markets available for their animals and the possible prices the animals would fetch. Sheep and goats from the farmers seem to be sold in an ad hoc manner using channels that provide very limited information on the demands, preferences and price flexibilities of the buyers. Farmers get information on prices for their animals when they arrive at the market. This places them at a disadvantage because information generally comes from intermediary market actors."},{"index":2,"size":47,"text":"Four different types of intermediary actors were identified in the markets of Nyando (Figure 1): wholesale and local traders, collectors, and brokers. The intermediary actors buy and bulk animals then re-sell them at higher prices either within the same markets or to buyers from other external markets."},{"index":3,"size":63,"text":"CCAFS is promoting Galla goats that are adapted to drylands, have good growth rate and mature earlier by up to six months compared to local breeds, and are docile and easy to handle. Photo: S. Kilungu (CCAFS) Female Galla goats have good milking ability, long productive life, and continue to breed and rear kids for up to 10 years. Photo: V. Atakos (CCAFS)"},{"index":4,"size":89,"text":"Traders: Two types of traders were identified, wholesalers and retailers. Wholesalers are involved in livestock trade on a fulltime basis and trade in more than one species. The wholesalers are important actors in the value chain as they purchase large numbers and transport the livestock to other urban markets, thus expanding the market for the farmers. They have good knowledge on the quality and quantity of animals required by consumers and are willing to purchase animals at higher prices. Many wholesalers obtained sheep and goats through other intermediary traders."},{"index":5,"size":44,"text":"Retail traders generally specialize in one species of livestock and are also engaged in a second enterprise such as crop farming. They buy animals from other traders within the market, then sell them either one at a time or in groups to end users."},{"index":6,"size":92,"text":"Collectors: These are a group of stakeholders who are not active at the main marketing points but purchase animals directly from farmers. Collectors use their knowledge of the villages and their social relationships with the farmers to purchase animals, which they fatten over time, then sell them to retailers and wholesalers. They have extensive knowledge of the farming communities and are an important source of breeding stock for the smallholder farmers. The number of collectors serving the different markets is not clear, however, several traders indicate that they obtain animals from them."},{"index":7,"size":137,"text":"The Red Maasai sheep is reared for meat and is renowned for its faster growth, resistance against internal parasites, and good tolerance to trypanosomes, drought and heat stress. Photo: S. Kilungu (CCAFS) Brokers/intermediaries: Brokers serve as conduits for animals, adding little value to the products, yet seeking to make some profit from transactions on animals. They intercept animals for sale at different points and engage in fixing the prices of animals between buyers and sellers. Brokers take large fees for their services leaving the small-scale producers with little profit. Reduced returns to the farmers are compounded in cases where there were several different layers of brokers. Long transaction channels occur when animals are bought directly at the farm gate in the pretext of saving the farmers time required to go and sell their animals in the markets."}]},{"head":"Factors influencing animal prices","index":5,"paragraphs":[{"index":1,"size":90,"text":"The prices of animals in the markets were determined at the point of sale. Prices offered to individual producers depended on the prices of animals on the previous days and the number of animals available for sale at the marketing point. The prices for purchasing both sheep and goats are significantly higher in Kericho County than in Kisumu County (p<0.001). It is also notable that within Kericho County, sheep are bought at a higher price than goats, while in Kisumu County, goats are bought at a higher price than sheep."}]},{"head":"Opportunities for farmers selling sheep and goats","index":6,"paragraphs":[{"index":1,"size":35,"text":"◼ Establishing community-based sheep and goat improvement through the climate smart village approach for the smallholder farmers is increasing the knowledge and awareness of farmers on the opportunities for increasing their incomes through livestock production."},{"index":2,"size":53,"text":"◼ Working together in groups, the smallholder farmers can take a more active role in collectively marketing their animals. As a group, they can source for market information, collectively determine minimum product prices prior to sale of animals, and negotiate for higher prices leveraging on a larger number of animals available for sale."},{"index":3,"size":33,"text":"◼ Mobile phone tools used to collect information on productivity from the smallholder farmers could also be adapted and used for the collation and dissemination of market information within the climate smart villages."},{"index":4,"size":25,"text":"◼ Farmers with information on product prices both in local and urban markets can plan to produce and market animals aligned to the market demands."},{"index":5,"size":18,"text":"Detailed information on the actors in the rural markets of Nyando is available in Ojango et al. (2018)."},{"index":6,"size":27,"text":"The crosses of Red Maasai sheep have very strong compensatory growth after long dry seasons and mature earlier compared to the local breeds. Photo: S. Kilungu (CCAFS)"}]}],"figures":[{"text":"Figure 1 : Figure 1: Schematic representation of the different actors and interactions among them in sheep and goat markets of Nyando. "},{"text":"  "},{"text":"  "}],"sieverID":"8c21f407-8a74-402e-b56f-898848c87c06","abstract":"The large number of actors in the market space for sheep and goats in Nyando leads to a small proportion of the profits reaching the smallholder farmers.◼ Market prices for sheep and goats are highly variable, and are easily manipulated by other market actors depending on the needs of the sellers.◼ In order to maximize returns, smallholder livestock farmers need to understand the markets, including the different categories of market actors, then produce and sell animals that meets market requirements to targeted traders."}

data/part_3/0a6ee152ac4fc34f233bda78b71ce62d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a6ee152ac4fc34f233bda78b71ce62d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a176aec5-7c94-4811-9adb-7acd3b33aacf/retrieve"},"pageCount":3,"title":"","keywords":[],"chapters":[{"head":"Farmer registration and development -the SACAU experience in Lesotho and eSwatini","index":1,"paragraphs":[]},{"head":"Fhumulani Mashau","index":2,"paragraphs":[{"index":1,"size":94,"text":"Dispersed smallholder farmers in Sub-Sahara Africa are at risk of social and economic exclusion. Digital innovation and an enabling policy environment can help smallholders to transition out of poverty. The Southern African Confederation of Agricultural Unions (SACAU) considers farmers' organisations to be the key to drive this change. F armers' organisations can act as representative bodies to leverage services and mobilise resources to support farmers. However, verifiable membership data is necessary to enhance their credibility and legitimacy, to mobilise negotiating power and to work on evidence-based advocacy to give a voice to small-scale farmers."}]},{"head":"Farmer data -a powerful resource","index":3,"paragraphs":[{"index":1,"size":65,"text":"Concerned about the paucity of farmers' organisations' membership data, SACAU supported by AgriCord and CTA, has been working on a project to register farmers for its member organisations in the kingdoms of Lesotho and eSwatini. Launched in 2016, this project has led to the development of an Electronic Membership Data Management System for the Swaziland National Agricultural Union (SNAU) and Lesotho National Farmers Union (LENAFU)."},{"index":2,"size":102,"text":"Through the creation of this data infrastructure, SACAU aims to improve service delivery by farmers' organisations, such as improved access to extension services, markets or financing, to improve farmers' incomes. Furthermore, the collected farmer data can be monetised through trade with other economic players such as seed, fertiliser, agricultural input and processing firms. Data can therefore serve as an additional revenue source for farmers' organisations and their members. By demonstrating these benefits, increasing numbers of farmers are encouraged to register. As the farmers' organisations accumulate more members and farmers' data, they strengthen their position as advocates for farmers in their respective regions."},{"index":3,"size":77,"text":"A no mean feat, this project was made possible by over 50 field facilitators who took to the field to register the farmers in their localities. Armed with smart phones, the facilitators registered over 52,000 farmers for LENAFU and 23,000 for SNAU. Data such as the age, location, gender and farming activities were compiled in the digital platform. With the project nearly complete, this data can be translated into information and narratives for a multiplicity of purposes."},{"index":4,"size":16,"text":"Both LENAFU and SNAU were set-up with the objective to promote an enabling (policy) environment through"},{"index":5,"size":15,"text":"The accumulation of membership data by farmers' organisations can improve delivery of services to farmers."}]},{"head":"About the author","index":4,"paragraphs":[{"index":1,"size":92,"text":"Fhumulani Mashau is Projects Officer at the Southern African Confederation of Agricultural Unions (SACAU) based in South Africa. She has 16 years' experience in the agriculture sector and has held positions in the public, private and development sectors. [email protected] Article advocacy and to represent the interests of their members. Their databases allow they to work with their governments on subsidy programmes for the benefit of their members. The Government of the Kingdom of eSwatini has, for example, requested SNAU to assist in the registration of farmers under a government input subsidy programme."}]},{"head":"Advocacy and collaboration","index":5,"paragraphs":[{"index":1,"size":47,"text":"Data collection is, however, not an end in itself; it does not automatically improve the work of farmers' organisations or farmers' standard of living. What is important is sensitivity to the socio-political nature of data. To give power to farmer data, farmers' organisations need to meet governance."},{"index":2,"size":14,"text":"There are two areas where farmers' organisations and governments can mutually benefit from profiling."},{"index":3,"size":106,"text":"Firstly, since few African countries possess reliable public sector institutional statistical capacity, farmers' organisations and governments should explore joint ventures for data collection. This is hardly contentious as African governments committed themselves to allocating at least 10% of their national budgets to agriculture and rural development within five years after the 2003 African Union Heads of State and Government Summit. This commitment, which many governments are yet to meet, can neither be fulfilled, nor can the interventions make the necessary impact without reliable statistical data. Farmers' data could be used either as a source of information or as a verification mechanism complementing official data collection processes."},{"index":4,"size":48,"text":"Secondly, since advocacy is ultimately a political vocation, data collection by farmers' organisations should inform advocacy campaigns for the implementation or review of existing government policy commitments and policy change. Whereas farmers' organisations and governments may not always agree, their interests are best served by forging co-operative relations."},{"index":5,"size":51,"text":"\"This project and the publicity it generated has positioned SNAU as a partner organisation of choice for various stakeholders including government for initiatives involving farmers in the country. It has also improved the standing of SNAU as a repository of farmers' data in the country\" -Mr Nqobizwe Dlamini, SNAU Project Coordinator."},{"index":6,"size":44,"text":"An enabling policy environment for rural development should also translate into physical services. In developing countries, data collection is time consuming and costly. In Lesotho and eSwatini, project facilitators had to contend with intermittent mobile network coverage, inadequate energy sources, and poor road accessibility."},{"index":7,"size":29,"text":"The construction of physical and digital infrastructures that link urban areas -which are often the locus of trade -to rural communities is key to ensure inclusion of peripheral farmers."}]},{"head":"Bridging between producers and policy-makers","index":6,"paragraphs":[{"index":1,"size":48,"text":"The accumulation of membership data by farmers' organisations can improve delivery of services to farmers to enhance their income, and provides these organisations with the evidence and legitimacy to advocate farmers' needs. As such, farmers' organisations become trust centres that bridge between farmers, policy-makers and value chain actors."},{"index":2,"size":91,"text":"To upscale data collection through farmers' organisations, an integrated approach is needed whereby public, private and development partners collaborate. The development sector should continue to strengthen the strategic capacities of farmers' organisations, including in digital and business development and support farmer registration to enhance the provision of services to farmers. Farmers' organisations should continue to mobilise farmers and aggregate needs and supply to strengthen the position of smallholder farmers. At the same time, investments are needed by the public sector in ICTs, (digital) infrastructure, institutions and public services, and agricultural policies."},{"index":3,"size":81,"text":"In Lesotho and eSwatini, the two national farmers unions are now poised to improve their policy-making and membership service processes, and to better engage in targeted advocacy programmes that should contribute to improved standards of living for their members. Yet work remains to be done. With the continuation of their registration efforts, additional information will be collected and added to the platform to enhance reliability, gain greater clarity on the sector and region and support planning and policy intervention measures. •"}]}],"figures":[],"sieverID":"45c89a16-ca0a-4e29-9737-0bdef558529a","abstract":""}

data/part_3/0ae529f9131451857072d6dc0412eb2a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0ae529f9131451857072d6dc0412eb2a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/dad8405c-483c-45f1-b83c-c2b25d5e5e9d/retrieve"},"pageCount":3,"title":"PAPAS NATIVAS DE COLORES UN NEGOCIO CON RESPONSABILIDAD SOCIAL","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":5,"text":"Palabras clave: hojuelas, chips, Ecuador"}]},{"head":"INTRODUCCIÓN","index":2,"paragraphs":[{"index":1,"size":168,"text":"En el Ecuador las papas nativas son altamente valoradas por agricultores, indígenas y científicos por sus propiedades organolépticas (características físicas) (sabor, textura, olor y sabor), propiedades nutricionales y porque muchas toleran condiciones adversas de cultivo (Monteros y Reinoso, 2010). Sin embargo, estas papas son desconocidas para la mayoría de consumidores urbanos y tienen una presencia marginal en el mercado ecuatoriano, pues representan alrededor del 5% del volumen total de la papa comercializada (Unda et al., 2005). A pesar de esto, nuevas oportunidades de mercado están apareciendo para las papas nativas. Las características de estas papas hacen que sean muy atractivas en mercados urbanos de alto valor. Además, al ser cultivadas mayoritariamente por pequeños agricultores, son ideales para mejorar sus condiciones de vida, siempre y cuando se mantengan criterios de responsabilidad social. Este estudio tiene como objetivo describir la experiencia del Consorcio de Pequeños Productores de Papa (CONPAPA) y la empresa INALPROCES para producir, procesar y comercializar dos variedades de papas nativas en Ecuador, con criterios de responsabilidad social."}]},{"head":"MATERIALES Y MÉTODOS","index":3,"paragraphs":[{"index":1,"size":134,"text":"A mediados del 2010, mediante el trabajo conjunto del Centro Internacional de la Papa (CIP) e INALPROCES nace la idea de comercializar papas nativas de colores en el Ecuador. Con la participación del Instituto Nacional Autónomo de Investigaciones Agropecuarias (INIAP) y la Fundación Minga para la Acción Rural y la Cooperación (MARCO), se identificaron dos variedades de papas nativas adecuadas para ser producidas por agricultores del CONPAPA: Yana Shungo (corazón negro en español) y Puca Shungo (corazón rojo) (Yumisaca et al., 2009). Ambas instituciones implementaron el Enfoque Participativo de Cadenas Productivos (EPCP, Bernet et al., 2006) en dos ocasiones, generando de esta manera un ambiente propicio para este negocio, a través de la producción de publicaciones (e.g., Monteros et al., 2006) y la organización de eventos para dar a conocer a las papas nativas."}]},{"head":"RESULTADOS Y DISCUSION","index":4,"paragraphs":[{"index":1,"size":90,"text":"El negocio para producir, procesar y comercializar papas nativas entre CONPAPA e INALPROCES inició en septiembre del 2010, a través de la firma de un convenio. El convenio definió la calidad y cantidad del producto, fechas de entrega y un precio estable, el cual se fijó en base a costos de producción y márgenes de ganancia razonables para ambas partes. Esto hace que tanto la empresa como los agricultores no se vean afectados por fluctuaciones de precio del mercado y que los agricultores reciban un precio justo por su producto."},{"index":2,"size":48,"text":"En marzo del 2011, INALPROCES y CONPAPA, con el apoyo de Fundación MARCO, INIAP y CIP, lanzaron en Quito dos productos: \"Papas Nativas Andinas Kiwa\" (hojuelas de papa) y \"Papas Nativas Andinas de Colores\" (papas en fresco). Este evento recibió amplia cobertura en prensa escrita, TV y radio."},{"index":3,"size":107,"text":"Yana Shungo y Puca Shungo se cultivan entre 3000 y 3300 m de altitud, son moderadamente resistentes a tizón tardío (Phytophthora infestans) y son precoces, por lo que \"escapan\" a daños causados por plagas, granizadas, sequías y heladas. Esto las hace ideales para ser cultivadas por pequeños agricultores, ya que su cultivo es amigable con el ambiente y la salud. Ambos materiales son producto de autofecundaciones de papas nativas ecuatorianas (Yumisaca et al., 2009). El uso de estas papas nativas sumado al hecho de tener un convenio entre la empresa y la organización de productores, hace que este sea un negocio con un enfoque de responsabilidad social."},{"index":4,"size":71,"text":"La comercialización de estos productos se está realizando en la cadena Supermaxi y en locales de productos gourmet de Quito. Las hojuelas vienen en presentaciones de 50 gramos a un precio de USD 0.85, mientras que las papas en fresco vienen en presentaciones de 1.5 kg a un precio de USD 2.06. Al momento se está procesando 40 quintales por mes y la perspectiva es llegar a 200 qq por mes."}]},{"head":"CONCLUSIONES","index":5,"paragraphs":[{"index":1,"size":83,"text":"Esta experiencia con el principio de 'ganar-ganar' muestra cómo el trabajo conjunto de instituciones públicas y privadas ayuda a generar nuevos negocios e innovaciones comerciales que dan valor a la biodiversidad del Ecuador, mejoran las condiciones de vida de los pequeños agricultores de papa y consolidan al CONPAPA como una asociación líder en el rubro papa en Ecuador. Encontrando soluciones sostenibles con pequeños productores de papa a través de investigación participativa en la sierra centro de Ecuador. Revista Latinoamericana de la Papa 15(1):86-89."}]},{"head":"BIBLIOGRAFIA","index":6,"paragraphs":[]}],"figures":[{"text":" Jimenez J. y Cuesta X.; 2006. Las papas nativas en el Ecuador en: La Magia de la papa nativa, Recetario Gastronómico Instituto Nacional Autónomo de Investigaciones Agropecuaria INIAP Ediciones Abya-Yala Quito -Ecuador pp 4 -5 Unda J.; Jimenez J.; Andrade L.; Monteros C. 2005. Sondeo de la oferta de papas nativas en Ecuador In Las papas nativas en el Ecuador, estudios cualitativos sobreoferta y demanda. Primera edición. Quito -Ecuador. pp. 13 -16. Yumisaca, F., Aucancela, R., Haro, F., Pérez, C. y Andrade Piedra, J.L. 2009. Monteros C.; Monteros C.; Bernet, T., Thiele, G., Zschocke, T. 2006. Participatory Market Chain Approach (PMCA) Bernet, T., Thiele, G., Zschocke, T. 2006. Participatory Market Chain Approach (PMCA) User Guide. Primera Edición. Centro Internacional de la Papa (CIP) Lima, Perú. 169 User Guide. Primera Edición. Centro Internacional de la Papa (CIP) Lima, Perú. 169 p. p. Monteros C. y Reinoso I. 2010. Biodiversidad y oportunidades de mercado para papas Monteros C. y Reinoso I. 2010. Biodiversidad y oportunidades de mercado para papas nativas ecuatorianas. Instituto Nacional Autónomo de Investigaciones nativas ecuatorianas. Instituto Nacional Autónomo de Investigaciones Agropecuarias. Fontagro 353-05 Papas nativas. Quito, Ecuador. 11p. Agropecuarias. Fontagro 353-05 Papas nativas. Quito, Ecuador. 11p.  "}],"sieverID":"b0f09952-2a5f-4436-8c57-033f7059b8c2","abstract":""}

data/part_3/0ba6534b989806b96586ed4c0b91b133.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0ba6534b989806b96586ed4c0b91b133","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/836fb38d-0f4a-4060-b7aa-2713bbc15d2c/retrieve"},"pageCount":22,"title":"diferencias significativas. Los otros tratamientos produjeron ' \"","keywords":["s.",". ' .~"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":72,"text":"3 misma localidad con suplementación de proteína vegetal durante la época seca (Norman, 1963b). Es la opinión de los autores que el cambio frecuente de animales de pasto nativo a banco, tal como se realizó en el estudio reportado. sería impracticable en condiciones comerciales de ganadería extensiva en Australia. Como alternativa sugieren un sistema que incluya una sucesión de bancos a los cuales los animales tendrían acceso libre durante la época seca."},{"index":2,"size":44,"text":"Otro experimento de pastoreo de leguminosas como complemento a pasto nativo fue realizado por Raggar et al (1971) en la estación, , experimental Shika en Nigeria, Africa, donde la época seca se prolonga Andropogon como especies co-dominantes. Se establecieron 5 tratamientos de pastoreo, así:"},{"index":3,"size":11,"text":"1. Sólo leguminosa. 2. Pastoreo de la leguminosa cada 2 días."}]},{"head":"3.","index":2,"paragraphs":[{"index":1,"size":7,"text":"Pastoreo de la leguminosa cada 4 días."}]},{"head":"4.","index":3,"paragraphs":[{"index":1,"size":8,"text":"Pastoreo de la leguminosa sólo en la noche."}]},{"head":"5.","index":4,"paragraphs":[{"index":1,"size":26,"text":"Pastoreo de pasto nativo durante el día, con encierro en la noche y suplementación de 3 niveles (340. 682, 1021 g/A) de sem~lla de algodón ."},{"index":2,"size":33,"text":"El ensayo se inició en Enero y se llevó a cabo durante 10 semanas, período correspondiente a época seca. Los resultados indicaron que los mejo~es tratamientos en términos de ganancia de'peso -] -1"},{"index":3,"size":21,"text":"fueron en pastoreo de leguminosas ~~ la noche (137 g A día.) y pastoreo de sólo ] epl!ninCSá (172 .. ,,'."}]},{"head":"\"","index":5,"paragraphs":[{"index":1,"size":2,"text":"~ \""},{"index":2,"size":1,"text":",\""},{"index":3,"size":1,"text":".'"},{"index":4,"size":3,"text":". ' ."},{"index":5,"size":2,"text":"~ .."}]},{"head":"-1","index":6,"paragraphs":[{"index":1,"size":24,"text":"pequeñas ganancias de peso (leguminosa cada 3 días: +34 g A díé-1 ) o pérdidas de peso (leguminosa cada 4 días: ~33 g A-1"},{"index":2,"size":38,"text":"-1 día ). Para lograr las ganancias de peso obtenidas con los 2 mejores tratamientos con leguminosa se encontró que se requería 820 g A-1 día-1 de suplemento de semilla de algodón, lo cual representaba un alto costo."},{"index":3,"size":151,"text":"En la interpretación de los resultados, Raggar et al (1971) indican que no parece existir mayor beneficio de dejar consumir un exceso'de leguminosa a los animales, como obviamente sucedió en el tratamiento de sólo leguminosa. Por otro lado, parece necesario dar acceso a la leguminosa con cierta regularidad, pues de 10 contrario es poco lo que se logra. Por último, recOnocen los autores que para mantener 'leguminosa durante los 5 Ó 6 meses de época seca sería necesario. sembrar en varios sitios de la sabana bancos de leguminosa, los cuales se abrirán a los ani'males en la medida en que la disponib.ilidad en cada banco fuera limitante. Esta recomendación es similar a la expuesta por Norman y Stewart (1967).  Stewart (1967). Durante los primeros tres años. (1979)(1980)(1981) el acceso de los animales a los bancos fue res'tringida en forma variable durante la época de lluvia para asegurar recuperación de la leguminosa."},{"index":4,"size":53,"text":"Los resultados del ensayo en términos de ganancia de peso indicaron una fuerte interacción año x carga, estando los efectos confundidos con los diferentes manejos impuestos en el banco. El promedio de los 4 años indicó que invariablemente los animales ganaron peso durante la época seca, siendo las ganancias mayores en la carga"},{"index":5,"size":14,"text":"baja (183 g A-día-) que .e~ la carga alta (78 g A A )."},{"index":6,"size":53,"text":"Durante las lluvias no hubo diferencias significativas debidas a carga (383 vs 365 g A-1 día-1 ) en cargas baja y alta, respectivamente • . '. Las ganancias anuales por animal fueron mayores en carga baja (118 kg) que en carga alta (101 kg), básicamente debido a las diferencias observadas en época seca."},{"index":7,"size":76,"text":"-\\ Sin lugar a dudas, de los tres trabajos revisados resulta claro que existe un beneficio en época seca con el uso de bancos de leguminosa corno complemento a pastos nativos. No es muy claro sin embargo, si es o no factible manejar los bancos con acceso libre de los animales todo el año. Algunas ideas en este sentido se ganaron en el ensayo realizado con bancos de Kudzu en los Llanos. En ..... , ."},{"index":8,"size":2,"text":", ,\""},{"index":9,"size":1,"text":"~."},{"index":10,"size":1,"text":"."},{"index":11,"size":87,"text":"Las anteriores observaciones sirvieron como base para plantear la hipótesis de que variaciones estacionales en proteína y energía digestible de la gramínea podían afectar considerablemente la utilización de leguminosas en bancos de proteína (Tergas y Lascano, 1982). En otras palabras\", a medida que la calidad de la gramínea se reduce, particularmente en época seca, el consumo de leguminosa aumenta. Bajo condiciones de sabana nativa en los Llanos, es factible manipular la calidad de la gramínea medianLe quemas estratégicas, 10 cual le quitaría presión al banco de leguminosa."}]},{"head":"I","index":7,"paragraphs":[{"index":1,"size":29,"text":"Para validar la hipótesis anterior, se realizaron una serie de ! mediciones en sabana nativa manejada con quema y complementada con un promedio 247 y 283 g A día"},{"index":2,"size":13,"text":"rorn e, s~en o estas gananc~as 4~rga baja (183 g A-1 día-1 )."},{"index":3,"size":14,"text":"en carga baja y alta, respectivai mayores a las obtenidas con Kudzu en la"}]},{"head":"-\\","index":8,"paragraphs":[{"index":1,"size":173,"text":"Las relativamente buenas ganancias de peso en época seca con bancos de~. capitata estuvieron relacionadas con un 35-40% de tiempo de pastoreo en los bancos (Figura 1) y con niveles altos de leguminosa en la dieta total (30-50%) medido con 12C -13 C (Figura 1). Contrariamente a lo esperado, al inicio de lluvias (Abril-Mayo) se encontró un incremento de tiempo en pastoreo de los bancos de leguminosa y consecuentemente de leguminosa en la ~ieta (Figure 1) aun cuando la calida~ de la dieta en sabana en términos de proteína aumentó en este perfodC' (Figura 3). El aIteconsumo de leguminosa conjuntamente con 1& mejor calidad de la sabana  durante el inicio de lluvias estuvo asociado con aumentos en la tasa de ganancia de peso (Figura 4). Después de los primeros meses de lluvi'a, los animales continuaron pastoreando el banco de leguminosa resultando esto en una reducción drástica de leguminosa en oferta (Figura 2), de leguminosa en la dieta total (Figura 1) y de la tasa de ganancia de peso de los animales (Figura 4)."},{"index":2,"size":49,"text":"Es evidente que mediante la quema de sabana nativa no fue posible lograr que los animales autoregularán la utilización de S. capitata en banco. Por otro lado, el deterioro de los bancos de S. capítata fue ! mucho mayor a lo observado en el experimento con bancos de Kudzu."},{"index":3,"size":25,"text":"Estas diferencias parecen deberse en gran parte a la mayor palatabi1i-T dad y tasa de consumo de S. capitata en relación a Kudzu (Cuadro 1)."}]},{"head":"\\","index":9,"paragraphs":[{"index":1,"size":55,"text":"Se' puede infe~ir de lo anterior, que en la, selección de 1eguml- Otros atributos que deberían reunir las leguminosas para bancos de proteína, fuera de tener adaptación a condiciones edáficas y bióticas prevalentes, son: hábito vigoroso de crecimiento, resistencia a sequía y libre de factores anti-calidad (alcaloides, taninos). Estos factores se discuten brevemente a continuación."},{"index":2,"size":34,"text":"Un aspecto importante en la utilización de leguminosas como bancos es el de la habilidad de ~stas de competir con malezas, sobre todo teniendo en cuenta que en la medida que fijen nitrógeno, las"},{"index":3,"size":1,"text":";."},{"index":4,"size":1,"text":"'l.:"},{"index":5,"size":5,"text":". : .... :', '.,:"},{"index":6,"size":4,"text":".' \" .. '.'"},{"index":7,"size":6,"text":"* : • • \" :"},{"index":8,"size":67,"text":"... el nivel de proteína en la dieta de animales en sabana durante ~poca \\ seca (Enero-Marzo) fue adecuado, debido básicamente a la quema de la [ vegetación en Diciembre del año anterior y a pastoreo selectivoJ Es posible que con la quema, el factor limitante en la sabana duraJte la \" . ~'-\" época seca y aún lluviosa sea la cantidad del forraje de buena 1>-"},{"index":9,"size":9,"text":"calidad. Se desprende entonces, que podría esperarse una mayor'"}]},{"head":"I :","index":10,"paragraphs":[{"index":1,"size":132,"text":"respuesta en producción animal, con meno,r área de banco por anilIlfll, si , la sabana quemada es suplementada con un banco de gramínea mejO;~da + leguminosa en lugar de una leguminosa pura. Esto se deduce si se tiene en ,cuenta: (I) la mayor producción de biomasa y de energía de una gramínea en relación a una leguminosa; (2) aporte de nitrógeno de la leguminosa a la gram.ínea, 10 cual incide positivament.e en su calidad; y (3) contribución directa de proteína de la leguminosa al animal. sobre todo en ~poca seca. Una ventaja adicional de la 'asociaci6n sobre la leguminosa pufa como suplemento de sabana podría ser ~l de un menor riesgo de sobrepastoreo del banco. ]0 cual reduciría la necesidad de manejo, aspecto fundamenta] en sistemas ext.ensivos. como .. ,.:  . ,'"},{"index":2,"size":1,"text":",<'"},{"index":3,"size":2,"text":". ,"}]},{"head":"10","index":11,"paragraphs":[{"index":1,"size":109,"text":"Se reconoce que de un solo trabajo experimental es peligroso sacar conclusiones generales. Sin embargo. parecería que con gramíneas mejoradas, capaces de aprovechar el nitrógeno reciclado de las leguminosas, existen mayores ventajas con la asociación íntima de leguminosas en compara.ción con el uso de éstas como banco. Por otro lado, en regiones donde predominan suelos de mediana fertilidad y sistemas intensivos de carne y/o leche el uso de bancos de leguminosas arbustivas (Leucaena leucocephala) podrían causar gran impacto en ganancia de peso o producción de leche como complemento de gramíneas mejoradas, en épocas de lluvia o seca, tal como lo demuestran los resultados experimentales que a continuación se resumen."},{"index":2,"size":34,"text":"Existe un gran número de 'experimentos con Leucaena 1eucocepha1a en la literatura. Para desta~ar está el experimento realizado en Fiji por Partridge y Ranacou (1974). Se compararon en este ensayo 3 . . ..."}]},{"head":"tratamientos:","index":12,"paragraphs":[{"index":1,"size":5,"text":"O\" e \"'~. \",Oli~ '\"'"},{"index":2,"size":10,"text":"( ~\"\"\", . ......,.... -:\"'-\"\"\"\"'-' .. \"'t:F\\Cd. ... ) l."},{"index":3,"size":8,"text":"Pastoreo en solo Dichanthium ~i~~m. ... , 2."},{"index":4,"size":10,"text":"Pastoreo de D. aristatum + 10% (área) de L. leucocephala."}]},{"head":"3.","index":13,"paragraphs":[{"index":1,"size":10,"text":"Pastoreo de D. aristatum I 20% (área) de L. leucoceEhala."}]},{"head":"T -1","index":14,"paragraphs":[{"index":1,"size":27,"text":"Con una carga de 1. 5 A ha se obtuvieron ganancias de 215, 300   ., aS1 como tam 1en e porcentaJe e grasa e a ec e."},{"index":2,"size":4,"text":"-\\ ' 1 '"}]},{"head":"I","index":15,"paragraphs":[]},{"head":"Conclusiones","index":16,"paragraphs":[{"index":1,"size":72,"text":"El uso de bancos de leguminosas como alternativa para la suplementación de ganado pastoreando gramíneas nativas en sistemas extensivos de producción ha sido estudiado experimentalmente en varios locales, incluyendo los Llanos Orientales de Colombia. Es claro que existe un efecto benéfico en términos de producción.~nimal cuando los animales tienen acceso a bancos de leguminosa en época seca, sobre todo cuando la sabana nativa se tnaneja sin quema. Para que el uso de"},{"index":2,"size":1,"text":".'"},{"index":3,"size":164,"text":"12 bancos en sistemas extensivos tenga aplicación práctica, parece necesario que el sistema pueda ser manejado con acceso libre de animales, por 10 menos durante la época seca. Esto pareciera factible con algunas leguminosas con características de alta producción y relativamente baja palatabi1idad y/o tasa de consumo. Con leguminosas muy pa1atables se corre el riesgo de que sean sobrepastoreadas, aún manejando el pasto nativo con quema para mantener su calidad. Por otro lado, en base a algunos resultados experimentales se plantea la posibilidad de que el Uso de bancos. de gramíneas mejoradas + ! leguminosas sea un mejor complemento para sabana nativa manejada con ! quema que el de banco's de leguminosas puras. Esto si se tiene en cuenta, que la dietalseleccionada en sabana no parece ser deficiente \\ en proteína y que la I~sociación puede producir mayor cantidad de biomasa y que la legJ~ino~a asociada contribuye tanto a la calidad d~ la gramínea en -~fert; como directamente al animal, es;ecialmente en época seca."},{"index":4,"size":3,"text":".~.: . ."}]},{"head":"11:","index":17,"paragraphs":[{"index":1,"size":10,"text":"Una ventája adicional de la asociación sobre la , .'"},{"index":2,"size":17,"text":"\", leguminosa pura sería' que se requeriría menos manejo para evitar . j ¡ sobrepastoreo del banco."}]},{"head":"I -\\","index":18,"paragraphs":[{"index":1,"size":105,"text":"El uso de banco~ de leguminosa como complemento de gramíneas mejoradas ha sido menos estudiado. En base a resultados experimentales obtenidos en los Llanos Orientales de Colombia, parecería que asociación de leguminosas con gramíneas es mejor estrategia que la del uso de bancos, ya que se aprovecha más eficientemente el nitrógeno reciclado de la leguminosa. lo cual es importante para mantener la gramínea productiva a través del tiempo. Sin embargo. trabajos experimentales demuestran que el uso de bancos de l~guminosas. sobre todo arbustivas. como complemento de gramíneas mejoradas tiene gran potencial en sistemas intensivos de producción de carne y/o leche en el trópico. , ."},{"index":2,"size":3,"text":". , ',."},{"index":3,"size":4,"text":".Al, ,.,.... \" '\""},{"index":4,"size":4,"text":". . . \""},{"index":5,"size":55,"text":"\"'------Q\"\"\" \" Figura l. Frecuencia de tiempo pastoreando banco y % leguminosas en la dieta total en sabana + bancos dta S. capitata ll1::mejado con dos c8rg;)g y acceso libre todo el año (Carimagua).  Forraje disponible en sabana y bancos de S. capitata manejados con 2 cargas y acceso libre todo el año (Carímagua). Nov."},{"index":6,"size":29,"text":"Figura 3. Contenido de proteína cruda en la dieta de animales pastoreando sabana + bancos de S. capitata manejado con 2 cargas y acceso libre todo el aao. (Carimagua)."},{"index":7,"size":2,"text":"\"... ......."},{"index":8,"size":15,"text":"'\\ \"'-~~.;T\"\"\"'==:ii~-. . , . . , . , . . , .. '\" --\"._0,'       "}]}],"figures":[{"text":"1 de Octubre a }~rzo. Como banco de proteína se utilizó Stylosanthes gracilis (guianensis). el.cual complementaba una saban~ donde do~inan \\ gramíneas del género Isorbelinia e Hyparrhenia y gramíneas del "},{"text":"i Un tercer experimento de pastoreo de leguminosas en banco como-~ complemento' a pastos nativos fue realizado por el Programa. de Pastos Tropicales del CIAT en Carimagua, Llanos Orientales de Colombia, y cuyos resultados fueron publicados por Tergas ~ al (1983). En esta zona la época seca es de 4 meses (Diciembre a ~~rzo). período en el cual los animales en sapana nativa pueden perder de un 30-60% de su peso (Paladines, 1975). Como una posible estrategia para minimizar estas pérdidas de peso se montó un ~nsayo de bancos de leguminosas ~tilizando Kudzu (?ueraria ohaseoIojries) para complementar la sabana (Trachypogon vestitus y Pnspalum pcctinatum) manejada con quema, tal como es la tradición en los Llanos. El ensayo incluyó 2 cargas -25 y 0.50 A/ha con 2000 m de banco por animal, lo 2 cual'contrasta con los 8000 m de banco/animal en el ensayo de Raggar ~ al. (1971) y de 1600 a 3600 m 2 /animal en el trabajo de Norman y "},{"text":"1 1: ~anco de S. capitata de libre acceso a los animales todo el año. El \\ -¿{¡,rea de banco por animal (2000 m 2 ) y las cargas empleadas (O. 25 Y -.50 A ha ) fueron las mismas que las utilizada~ en el experimento on bancos de Kudzu. "},{"text":" 7 "},{"text":"1 : nosas para ser utiLizadas como bancos en sistemas extensivos o semi~ 1: intensivos con'gra~[neas nativas sería necesario considerar 1egumino-. ~c .. ,l., .,. sas con relativa b~i\"a palatabi1idad para evitar un sobrepastoreo del ,-\" banco. Dentro de los trabajos que se vienen realizando en el Programa de Pastos TroPicale~ se ha encontrado una gran variabilidad en pal~ta-I ' i bi1idad de 1egUminO~as de diferente género y especie (CIAT, 1981, 1982) e incluso entre ecotipos de una misma especie (CIAT, 1983). "},{"text":" Figura 5. ~onsistentemente, las ganancias de peso han sido mayores en el tratamiento de franjas que en los bancos de Kudzu o gramínea sola.Es interesante observar además, que a finales del 50. año la producción animal en el tratamiento de banco y gramínea pura tendió a '¡ disminuir, ,ruced'iendo 10 contrario en el tratamiento de franjas, prácticament,e convertido en una asociación íntima. Un análisis más detallado de los datos (Tergas ~ al, en prensa) permite indicar que en los primeros 4 años el efecto significativo de la leguminosa en franjas o bancos en relación a la gramínea pura fue durante la época seca, no existiendo diferencias entre tratamientos en la época de lluvias. Sin embargo, durante el 50. año (ClAT, 1983) las ganancias de peso en el tratamjanto de franjas fueron significativamente mayores (P .Ó5) que en los bancos o gramíñea pura tanto en época seca como lluviosa. Estas diferencias son atribu!bles a un mayor consumo de proteína en las franjas que en la gramínea pura (Figura 6). "},{"text":" realizado en Mexico por Sauceda ~ al. (1980) se estudió .el efecto de suplementación de L. leucocephala a vacas lecheras pastoreando Cvnodon p1eyostachius .. Los tratamjentos impuestos durante la época de lluvias (136 días) fu~ron: l. Pastoreo de solo C. pleyostachius. "},{"text":"\\ 1 : En San Javier, Bolivia,Paterson et al. (1981) estudiaron el l:e~:ecto de pasto~,eo complementario de leguminosas t;?obre _ la producción d~ leche en época seca. Con vacas de doble propósito (un ordeño al.~~ .. f•/l d!í~') se encontró que con pastoreo de Macrotyloma .axil1are cv. archer y , .-Glycine wightii cv. Tinaroo se elevó la producción de leche de 11 "},{"text":" . :-~ •• ~ :--~-.\"7\":-:''':''~~ --_ .. "},{"text":" Fig. 2. "},{"text":"Fig. 4 . Fig.4. Ganancia de peso de novillos pastoreando sabana + bancos de S. capitata manejndos con dos corgas y acceso libre todo el a~o (Carimagua). "},{"text":" figura 5. "},{"text":" FIGURA.6 Consumo de proteína total en pasturas de B. decum.bens (B.d.) Y B. decumbens + leguminosos (a.d. + L ) (Carimogua). "},{"text":"1 . :}:::T,'.~}. '••:••;•>H:}~.~.,: , ' . ~.'\\~l.-: ; ; : . : ••l: , .... ; _ _ _ .... ; .~ \\ .... , ~i,:..;~._ Digestibil~dad y consumo de nutrientes en bancos de P. phaseoloides y ~. capitata maduros bajo pastoreo (Carimagua)l Digestibilidad Banco de M.S. "},{"text":"1 . . 'E. Y C. Lascano. 1982. Contribuc1ón de las l~guminosas a la productividad animal como bancos ,de proteína en sabanas tropicales' de ~érica. Simposium sobre leguminosas en ,1--... \"-'I ....... .r • ....;. ..... ~-:. . : ._ álimentación animal. ,.ASOVAC XXXII Convención Anual. Caracas, Kleinheisterkamp y,-J. Velasquez. ',1984 . • Productividad animal de Brachiaria decumhens sola y con pastoreo complementario en Pueraria phaseo10ides en los Llanos Orientales de Colombia. Producción Animal Tropical (en prensa). Tergas, L. E., O. Paladines. l. K1einheisterkamp y J. Velasquez •. 1983.' Animal production from,native 'pastures with comp1ementary grazing o~ Pueraria phaseoloides ~n the• Eastern Plains -of Colombia. Tropical Animal Production. 8: 187-195. "}],"sieverID":"4c8462be-1453-4141-bda1-8b72b4c650d4","abstract":"Uno de los factores limitantes en las grar::.íneas trop:i.c.s.les, soi:n:e .'~ todo en époces de sequía. es su bajo contenido de proteína, 10 éual influye negati,,,Tamente en el conSt1.rno de raateria seca y, por ende, é-:\\ i.a producción 8.nimal (Hinsc'n y ~aJ.ford. 1967; Siebert y K~n!ledYJ 1932; l,ascano !:..~ al, 1982). Existe un gran número de traot\\jos en la literatura en los cuales se demuestra que mediante la sup.l;:;m~entac~ón de nit~6geno no proteico se puedeI\\ disminuir las pird1das de peso en an::í.males, asociadas con forrajes deficientes en pr.oteína Oloh'o::d et al, 197'1; 'faylor .~. al, 1982) u obtCllCt• gananciG.s de peso con suplemente.ción de proteína vegetal (Norman, 1963b. T:ayior ~ !l, 1982). l1esarortunaclamente, la F-uplementad.ó:::. de nitróleno no ¡;n\"oteico o protetnas de origen ~rgetal o aoigal en 6pocas ~ec&s. no siemprE es posible por razones de ialt~ de :i.nrracstn1C:tura eH .:l1.gulIas fireéls ¿el tr6pico. o por no rc~ultar econ5~icR (Pal~dines y L~a]. 1979).Una alternativa a la suplcmentaci6n con fu~n[cs de proter~a durante la ~poca seca, es el uso de ]egumiuos2~ pura~ corno suple~ento •• u -~."}

data/part_3/0ba759ab65b5b761e72a735d4c946d20.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0ba759ab65b5b761e72a735d4c946d20","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e2277d01-b98f-4a10-9ff0-4d40b3306362/retrieve"},"pageCount":1,"title":"Characterizing feeds and feed availability in Sud-Kivu province, DR Congo","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":30,"text":"The study was conducted in 4 sites representing the agro-ecological conditions of Sud-Kivu: Muhongoza (Kalehe territoire), Cirunga (Kabare territoire), Tubimbi and Kamanyola (both in Walungu territoire), and applying 2 approaches:"},{"index":2,"size":11,"text":"1. Feed Assessment Tool (FEAST) applied (by Duncan et al. 2012):"},{"index":3,"size":35,"text":"• Participatory Rural Appraisal (PRA) with 21 to 34 farmers per site, including all wealth categories, age and gender of farmers • Individual interviews to collect specific quantitative information from 9 households in each site."},{"index":4,"size":34,"text":"2. Forage identification: 2 key informants per site to show the forage species usually fed to their animals. Morphological description were conducted on those plants and their biotope before the identification of herbarium specimens."}]},{"head":"Materials and Methods","index":2,"paragraphs":[{"index":1,"size":59,"text":"Animal husbandry in Sud-Kivu province of the Democratic Republic of the Congo (DRC) is gradually moving towards stall feeding, due to demographic pressure and scarcity of collectable forages. Only 37% of farmers cultivate forages on small spaces, without further extension due to lack of seeds and vegetative propagating materials; cultivated forages contribute only 6% to the diet of animals."}]},{"head":"Introduction","index":3,"paragraphs":[{"index":1,"size":19,"text":"93 different forage species identified belonging to 19 botanical families (Table 1); dominant families were Poaceae, Asteraceae and Fabaceae."},{"index":2,"size":21,"text":"High linkage of feed availability to rainfall pattern with a great shortage from May to September (Dry Season) observed (Fig. 1)."}]},{"head":"Results","index":4,"paragraphs":[{"index":1,"size":24,"text":"Identify socio-ecological niches for cultivated, improved forages with high biomass yield and tolerance to drought stress Places to establish the improved forages once adopted:"},{"index":2,"size":31,"text":"• Roadsides near homestead • Banana plantations because of microclimate • Edges of fields in contour bands for additional erosion control • Sloping and degraded lands without competition for crop cultivation"}]},{"head":"Opportunities to overcome issues","index":5,"paragraphs":[{"index":1,"size":26,"text":"Thanks to respondents to FGDs and interviews; this study received financial support by AusAID under the Africa Food Security Initiative and through the CSIRO-BecA/ILRI Hub partnership."}]},{"head":"Acknowledgement","index":6,"paragraphs":[{"index":1,"size":6,"text":"PRA in Tubimbi -Walungu territoire 02°48'44. "}]}],"figures":[{"text":"Fig. 1 . Fig. 1. Feed resource availability throughout the year as assessed by the FEAST method (Duncan et al., 2012) in four locations (Muhongoza, Cirunga, Tubimbi, Kamanyola) of three territoires (Kalehe, Kabare and Walungu) "},{"text":" York L, Lukuyu B, Samaddar A and Stür W (2012) . ILRI, Addis Ababa, Ethiopia. Katunga DM, Ngabo T, Bacigale SB, Muhimuzi FL and Maass BL (2011) Tropentag Conference, Development on the margin, October 5-7, 2011, Bonn, Germany. Abstract Maass BL, Katunga-Musale D, Chiuri WL, Gassner A and Peters M (2012) Tropical Animal Health and Production 44, 1221-1232. Dominant feeding systems: Grazing (mostly by tethering) and collecting green forages from fields and roadsides. "},{"text":" 2''S, 28°35'28.8''E, 1073 m asl. PRA in Cirunga -Kabare territoire 02°29'46.4''S, 28°47'26.0''E, 2001 m asl. PRA in Mohongoza -Kalehe territoire 02°04'10.4'' S, 28°53'54.6''E, 1585 m asl. PRA in Kamanyola -Walungu territoire 02°44'13.7''S, 29°00'04.2''E, 973 m asl. Presented at the 22 nd International Grassland Conference 'Revitalising grasslands to sustain our communities' "}],"sieverID":"ac8c021b-8a38-492b-bf00-7fdb8152b5b5","abstract":"Representation of forage species Kalehe (N) Kabare (N) Walungu (N) General Mean (%)"}

data/part_3/0bd097b7bd7f949c975edb0cb29f0fef.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0bd097b7bd7f949c975edb0cb29f0fef","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b340b561-35f1-4a41-a40e-bd53082cd9e7/retrieve"},"pageCount":1,"title":"Study #251 Contributing Projects: • P344 -Evidence of impacts, impact pathways, synergies and cost-effectiveness of nutrition-sensitive agricultural programs","keywords":[],"chapters":[],"figures":[],"sieverID":"73834429-3f9a-455b-b930-e1f17081c0bb","abstract":""}

data/part_3/0be6344e8e23a96a45dc1acbdf0cd550.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0be6344e8e23a96a45dc1acbdf0cd550","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H006176.pdf"},"pageCount":49,"title":"","keywords":[],"chapters":[{"head":"Figures Tables","index":1,"paragraphs":[{"index":1,"size":18,"text":"Lengths of canals irrigated, filled or drained for implementing rotations, the East Maneungteung System, West Java Table 2a."},{"index":2,"size":14,"text":"Operational requirements for implementing rotations, the East Maneungteung System, West Java, dry season, 1988"},{"index":3,"size":2,"text":"Table 2b."},{"index":4,"size":16,"text":"Operational requirements for implementing rotations, the East Maneungteung System, West Java, dry season 1989 Table 3."},{"index":5,"size":14,"text":"Tertiary blocks scheduled for irrigation rotation, the East Maneungteung Syster,n, West Java Table 4."},{"index":6,"size":15,"text":"Alternative rotation plans for the East Maneungteung System, West Java, dry season, 1989 Table 5."},{"index":7,"size":15,"text":"Management improvements between 1988 and 1989 rotations, the East Maneungteung System, West Java Table 6."},{"index":8,"size":23,"text":"Rotation plan and actual practices observed at sample locations, day-and-night inspections, the East Maneungteung System, West Java, 1988 and 1989 dry seasons vii"}]},{"head":"Foreword","index":2,"paragraphs":[{"index":1,"size":136,"text":"THIS STUDY ANALYZES the formation, implementation and results of a modified pilot experiment for rotational irrigation which was conducted in the 7,611-hectare Maneungteung System near Cirebon, West Java in Indonesia (Figure 1). This site was selected by IIMI in consultation with the West Java Provincial Irrigation Service and the Directorate of Irrigation I. The primary rationale for selecting this location was threefold: a) its well-diversified cropping patterns, b) its relatively well-maintained irrigation control and measurement structures, and c) its annual use of irrigation rotations in the dry season, which are required by the water scarcity related to the fact that the system's weir is the last one on the Cisanggarung River before it empties into the sea on the north coast of Java. This research was carried out during the dry seasons of 1988 and 1989."},{"index":2,"size":44,"text":"The objectives of the study were: a) to analyze current rotation practices, b) to develop and field-test an improved rotation system, and c) to identify and test improved rotation methods which might have broader relevance in Indonesia, especially in rice-based systems undergoing crop diversification."},{"index":3,"size":43,"text":"IIMI's mandate is to assist governments in developing nations to improve and sustain irrigation performance through management innovations. Economic and financial imperatives are currently challenging irrigation bureaucracies throughout the developing countries to transform themselves into organizations which manage resources to meet measurable objectives."},{"index":4,"size":133,"text":"While it was recognized that eventual research and pilot experiments might lead to recommendations related to basic institutional needs or financing of operation and maintenance (O&M), it was agreed by IIMI and associates in the Government of Indonesia that the early research sponsored by IIMI in Indonesia should first explore the potential for improving irrigation management performance through modified procedures or innovations which could be adopted utilizing current O&M funding levels or only minor temporary additions to them. IIMI began its field operations in Indonesia in 1986. Such research would have diagnostic and experimental components and would be primarily field-based. This study represents the realization of these principles, demonstrating that real and immediate potential does exist for significantly improving irrigation performance through management innovations, even in agencies with relatively modest funding for O&M. "}]},{"head":"KILOMETERS","index":3,"paragraphs":[]},{"head":"Introduction","index":4,"paragraphs":[]},{"head":"OVERVIEW","index":5,"paragraphs":[{"index":1,"size":114,"text":"THIS PAPER REPORTS on a collaborative activity between the International Irrigation Management Institute (IIMI), the Directorate of Irrigation in the Public Works Department of the Government of Indonesia, and the West Java Provincial Irrigation Service (PRIS). The activity was a pilot experiment with modified rotational irrigation in the dry season. This was part of a broader program of action research aimed at documenting management constraints to the effective and efficient irrigation O&M in Indonesia and at testing new, low cost procedures that are feasible to implement widely under limited budgets. Several staff of the Provincial Irrigation Service and the Directorate of Irrigation I were assigned to work on the project together with IIMI staff."},{"index":2,"size":76,"text":"This paper describes an experiment of applying participatory management techniques to irrigation under conditions of pronounced resource scarcity: rotational water distribution during the dry season. The field experiment was carried out in the East Maneungteung Division of the 7,611-ha Maneungteung System, which is located on the north coast of West Java. At the time of the pilot experiment, the policy environment was in favor of crop diversification and expanded area under cultivation in the dry season."},{"index":3,"size":115,"text":"Attempts were made to increase farmer involvement and base the rotation plan both on clearly defined equity objectives and on actual technical and management constraints in the system. It is hoped that this modest experiment will help facilitate an increasing management orientation in the Provincial Irrigation Services in Indonesia and will stimulate more effective experiments and innovations with the management of irrigation rotation in other settings as well. There is a pressing need to experiment with the application of management techniques to irrigation in the effort to realize whatever irrigation policy priorities governments have set for themselves, be they area expansion, agricultural intensification, crop diversification, equity, profitability at system versus farm levels and so on."}]},{"head":"THE RATIONALE FOR ROTATIONAL IRRIGATION","index":6,"paragraphs":[{"index":1,"size":94,"text":"There are three primary reasons why rotational irrigation is practiced: a) shortage of water to meet irrigation requirements, b) conveyance difficulties when discharges are significantly below design capacity of canals, and c) the need to avoid overirrigation of non-rice crops that are susceptible to yield reduction under conditions of excess water. This paper focuses on the first two reasons because they involve modifications to normal operating practices of rice-based irrigation systems. For agronomic reasons, rotations are usually conducted at farm or field levels and are, therefore, normally outside the operational jurisdiction of irrigation agencies."},{"index":2,"size":57,"text":"Within the canal system, rotational irrigation is essential when total water supplies are inadequate to operate the system at or close to normal design discharge. Under normal conditions, discharges are sufficiently high so that the hydraulic relationships incorporated into the design and layout of structures and canals allow gatekeepers to maintain adequate discharges into all canals simultaneously."},{"index":3,"size":111,"text":"However, when actual discharges fall below to about 60-70 percent of design discharge gatekeepers find it increasingly difficult to operate control structures to maintain adequate head or stream size into all canals simultaneously. For example, irrigation supervisors in the Maneungteung System use a rule of thumb that the minimum stream size acceptable into a tertiary block is 15 lIiters per second (I/s). If proportional division to tertiary blocks of low discharges would result in a stream size less than this minimal allocation for a tertiary offtake, the usual strategy is to rotate so that larger stream sizes hydraulically consistent with design parameters can be delivered, albeit for limited periods of time."}]},{"head":"ROTATIONAL LEVELS","index":7,"paragraphs":[{"index":1,"size":44,"text":"Rotations can be managed at a number of different levels in the system. The three most common levels are: rotations within tertiary blocks, rotations between tertiary blocks along secondary canals and rotations between secondary canals (or groups of tertiary blocks) along the main canal."},{"index":2,"size":87,"text":"Rotations within tertiary blocks are common throughout Indonesia. In some systems, this is the normal operational pattern even when water is abundant. Farmers may decide it is more convenient for a few of them to receive all the discharge into the tertiary block for a limited period of time, and then pass the turn on to the next group of farmers. In this case, discharge into the tertiary block may be continuous and it is normally farmer and village leaders who initiate and manage rotations among fields."},{"index":3,"size":84,"text":"Among the reasons for farmers to use tertiary or field-level rotations are: the time when water will be delivered to each farmer can be adjusted to the timing needs of the crop; timing can be planned and known in advance (in the same general manner as in the warabandi system of India and Pakistan); it minimizes the risks of overirrigation of non-rice crops; it results in stream sizes that are large enough to manage conveniently; and it allows rapid irrigation of the entire holding."},{"index":4,"size":43,"text":"From the perspective of system managers, this type of rotational irrigation requires that the gatekeeper (penjaga pintu air) keep as constant a discharge as possible into the tertiary canal. Management of discharge through proper regulation of control structures remains the overriding operational rule."},{"index":5,"size":62,"text":"Rotations between tertiary blocks require the active participation of irrigation inspectors and gatekeepers, but they should not affect main and secondary canal operations. The normal condition under which this type of rotation is required occurs when the main-level system is still being operated under continuous flow but actual water supply is in the order of 60 to 90 percent of the demand."},{"index":6,"size":62,"text":"Under this rotational pattern, farmer and village leaders are important actors. Groups of tertiary blocks often develop plans that permit trading of water. At any given moment. some blocks will receive full discharge while others take the remainder. The length of time of allocation for each block varies depending on relative command or crop areas and the degree of overall water deficit."},{"index":7,"size":67,"text":"In practice, this type of rotation is typically brief and transitional on a system-wide basis because it relies on having reasonably stable discharges in the main and secondary canal system. If discharges fluctuate, too much inequity will result. However, in Maneungteung this form of rotation is not uncommon in tail-end areas where water supplies are often inadequate, even though the system is being operated under continuous flow."},{"index":8,"size":49,"text":"Once discharges drop below 60 percent of the requirement, this form becomes difficult to implement because the normal practice of rotating between adjacent pairs of tertiary blocks is no longer effective. More complex combinations of blocks are difficult to manage and the effects of conveyance losses become more complicated."},{"index":9,"size":54,"text":"Rotations within the main and secondary canal system are the full responsibility of system managers (usually the subsection chief, kepala ranting dinas, or sometimes for larger systems, the section chief, kepala cabang dinas). Such main system rotations override the system of continuous flow and demand-based allocations, handled routinely by the irrigation inspector (juru pengairan)."},{"index":10,"size":62,"text":"The entire system is divided into rotational units comprising different secondary canals and groups of tertiary blocks. Tertiary blocks in each rotational unit may be scheduled to receive water simultaneously or subrotations between tertiary blocks within a rotational unit may occur between turns of the rotation units. If so, the two levels are usually planned and implemented wholly independently of each other."},{"index":11,"size":80,"text":"The arrangement of 'rotational units largely determines the extent to which crop demand or area equity takes priority. If meeting crop demand is the dominant priority, then each unit should have approximately the same total water requirement. If equity is the main concern, then each unit will have roughly the same irrigable area. Of course, either criterion may be modified to account for the differential effects of conveyance losses according to distances of blocks from the top of the system."},{"index":12,"size":47,"text":"Current operating rules in Maneungteung call for rotations at main and secondary levels once total supplies fall below 60 percent of the total system requirements. The ratio of supply to demand at system level is normally referred to as faktor-k in Indonesia (referred to hereafter as factor-k)."}]},{"head":"OBJECTIVES OF ROTATIONAL IRRIGATION","index":8,"paragraphs":[{"index":1,"size":106,"text":"When available discharges are sufficient to enable water to be delivered continuously throughout the canal system it is normally possible to largely satisfy both production and equity objectives simultaneously. As discharges decrease, irrigation managers have to decide whether the shortfall is shared equally throughout the system, thereby favoring equity over maximum productivity, or to give priority to certain areas at the expense of others. Often, the outcome is by default, for want of organized agreement about clear objectives and plans. Actions tend to result in an inequitable distribution of water, with head-end areas having favorable access to water and tail-end farmers suffering most of the deficit."},{"index":2,"size":142,"text":"The objectives of rotational irrigation are different from those of irrigation management when water is in sufficient supply to meet all or most of the crop water requirements. During rotation, the basis for water allocation which pertains under continuous flow is no longer valid and a new set of rules applies. The alternatives most often considered by system manager are: i. Allocation based in proportionality of crop demand, where water is allocated in proportion to actual field-level demand, so that rotation unit sizes and locations are arranged to have similar water demands per standard unit of time, and will receive a fixed percentage of total available water; or ii. Allocation based on equity of proportional area, where water is allocated in proportion to the total irrigable area (regardless of crop type), so that each farmer has equal access to scarce water supplies."},{"index":3,"size":37,"text":"If the first alternative is adopted it is unlikely that the system will meet equity objectives because water is allocated in response to the proportion of area that has already been planted. Farmers who have been able"},{"index":4,"size":86,"text":"to plant crops before water shortages occur receive a larqer-share of water during rotation because they have a larger share of demand. This trend is particularly clear where head-end farmers are able to plant and establish rice crops. Despite the inequity caused by this management default, this situation may be more efficient in terms of production per unit volume of water because the irrigated area is concentrated and conveyance losses will be lower than if the whole system is irrigated at a lower cropping intensity. However,."},{"index":5,"size":16,"text":"this was not a policy or objective in West Java at the time of this activity."},{"index":6,"size":145,"text":"Adopting equity as the primary objective may require greater management inputs from the irrigation agency: head-end offtakes have to be closely monitored to ensure they do not receive more than their fair share, and there will be more gates and structures to be included in the overall gate monitoring program. However, the net result ought to be that more farmers get water for at least some of their land and this has particular merit in places where farmers have limited off-farm income sources during the dry season and where water users are expected to pay some or all of the system O&M costs. Over time, in a well-managed system that has equity as the major objective, these two alternatives will coincide: water will be allocated on the basis of the total irrigable area and farmers will adjust dry-season cropping plans to meet this overall condition."}]},{"head":"MANAGEABILITY","index":9,"paragraphs":[{"index":1,"size":100,"text":"The pilot experiment implemented in the Maneungteung System in 1989 was an attempt to make the rotation more manageable, or in other words to be better able to achieve more clearly specified objectives. This paper uses a standard definition of management, which is, \"the process of setting and achieving objectives through the acquisition and utilization of resources.\" We consider good management performance to be the \"efficient and effective acquisition and utilization of resources to achieve organizational objectives.\" These principles imply that rotation irrigation must have at least seven features in order to be manageable (Figure £~). These are as follows:"}]},{"head":"Clear Objectives","index":10,"paragraphs":[{"index":1,"size":64,"text":"They should be specific and uniformly understood by staff; there should not be dual or conflicting official versus unofficial objectives; and objectives should be altered as the situation requires. Rotational equity and efficiency objectives should be clearly specified and operationalized. Equity may be based on time. volume of water, crop water requirements, irrigated area, established allocation rights, and so on (Levine and Coward 1989)."},{"index":2,"size":2,"text":"Figure 2."},{"index":3,"size":7,"text":"Seven essential elements of a manageable enterprise. "}]},{"head":"A Manageable Enterprise","index":11,"paragraphs":[]},{"head":"Implementable Procedures","index":12,"paragraphs":[{"index":1,"size":28,"text":"They should be practical and realistic to implement given resource and skill constraints. Rotational procedures should be based on the constraints of available operable gates and limited staff."}]},{"head":"Adequate Resources","index":13,"paragraphs":[{"index":1,"size":73,"text":"Staff, skills, technology, funds, materials, water, land and other inputs should be sufficient to accomplish the objectives at an acceptable level of efficiency. If this is not possible then the objectives or procedures should be simplified. Staff and gates could be added to permit rotation based on crop demand or else rotation could be simplified to a system which is less-resource demanding, such as rotation based on equity per unit time or area."}]},{"head":"Control","index":14,"paragraphs":[{"index":1,"size":85,"text":"Managers should be able to ensure that the acquisition and use of resources lead to the achievement of objectives. It should be possible to attribute management activities and results to individual managers and staff and staff should not be held accountable for outcomes which go beyond their realm of control. If the rotation requires more supervision over gates by agency staff than is feasible, then the agency can either modify the rotation so that supervision is simplified or involve farmers in supervision or do both."}]},{"head":"Incentives","index":15,"paragraphs":[{"index":1,"size":36,"text":"There should be positive and negative inducements for managers and staff to achieve the objectives of the organization.• This might imply the need for temporary increases in staff payor travel allowances during management intensity rotation periods."}]},{"head":"Measurable Performance","index":16,"paragraphs":[{"index":1,"size":55,"text":"It should be possible to document and know what the outcomes of management are and whether or not the objectives were achieved. In some cases, it may be considered sufficient to simply rely on the occurrence of farmer complaints for this feedback. In other cases, systematic monitoring of gate settings and discharges may be required."}]},{"head":"Adaptability","index":17,"paragraphs":[{"index":1,"size":79,"text":"Organizations must be able to change any of the above six elements as changing conditions require it --either in order to continue to achieve objectives under new conditions, to achieve them more effectively or efficiently, or to achieve new objectives pertaining to new organizational purposes. In the long term, this implies the need for annual reassessment of rotation objectives and procedures. Within seasons, this implies the capacity to adjust to different prespecified contingency plans as changing conditions require it."},{"index":2,"size":100,"text":"For prominent sources on the above management ideas, see for example, March and Simon 1958;Drucker 1979;Richards 1986 andAnthony 1989. The need to apply principles of management to irrigation in order to achieve the increasing levels of performance is the theme of a growing literature (see Nobe and Sampath 1986;Chambers 1988;and Raby and Merrey 1989, as examples). And it was the key rationale for the establishment of the International Irrigation Management Institute in 1984. The need to involve farmers in identifying objectives, mobilizing resources and improving management control, even at distributary levels of large systems, is now widely recognized (Uphoff 1986)."}]},{"head":"Traditional Rotation in the Pilot Area","index":18,"paragraphs":[]},{"head":"CONDITIONS IN THE MANEUNGTEUNG SYSTEM","index":19,"paragraphs":[{"index":1,"size":50,"text":"THE EAST MANEUNGTEUNG Division constitutes 4,871 irrigable hectares of the 7,611ha Maneungteung System (divided into two divisions, or subsystems). It is the last irrigation system diverting water from the Cikeusik Weir on the Cisanggarung River, located in the northeast corner of West Java. It is located in the Cirebon Regency."},{"index":2,"size":96,"text":"The average annual rainfall is in the order of 1,800 mm, concentrated largely in the wet season between November and May. This rainfall, combined with high available discharge at the Cikeusik Weir, means that there is no problem, with all farmers obtaining a wet season rice crop; and in many areas farmers grow a second rice crop in the transition period between the wet and dry seasons. After July, however, rainfall is unreliable and river discharges drop quickly so that there is insufficient available water to permit full cultivation of the system, and rotation is essential."},{"index":3,"size":69,"text":"By West Java standards the system has a high level of crop diversification, with shallot (red onion), chili, green bean, mung bean, corn and groundnut being grown in addition to rice. Many farmers who cannot grow a second rice crop will switch to non-rice (palawija) crops in the transition period, and there are substantial areas where a third crop can be cultivated during the peak of the dry season."},{"index":4,"size":142,"text":"The upper end of the East Maneungteung Division (hereafter referred to as \"system\") is slightly undulating with no drainage problems, and is traversed by a number of small streams that are slightly incised below average ground level. The well-drained conditions and relatively easy access to water allow many farmers to obtain three crops a year. There is also intensive sugarcane cultivation in the upper and western parts of the system, where as much as 50 percent of the land may be under sugarcane at any given time. Because sugarcane production involves deep trenching of fields and leaves a lot of undercomposed organic matter in the fields following harvest, it is not normally possible to grow rice satisfactorily immediately after sugarcane. There is, therefore, a substantial area of palawija cropping in the wet season even though there is sufficient water for rice cultivation."},{"index":5,"size":60,"text":"The lower end of the system, close to the Java Sea, is flat and poorly drained. There are periods of flooding in virtually every wet season, and this lowers rice yields and makes sugarcane cultivation very difficult. In the dry season, however, access to canal water is restricted, and many farmers rely on shallow groundwater to supplement canal irrigation supplies."},{"index":6,"size":96,"text":"Historically, cropping intensities in the lower parts of the systems rarely exceeded 160 percent, but in recent years there has been a large increase in the area intensively cultivated to shallot and chili. The crops are grown on raised beds with the trenches used to store water between irrigation deliveries. The crops are then hand-irrigated once or twice a day using a combination of canal supplies stored in the trenches and groundwater from shallow tubewells. Some coastal areas have been converted to fish farms where there is plenty of brackish water but limited canal water supplies."},{"index":7,"size":84,"text":"Irrigation infrastructure is in accordance with design criteria for \"technical\" irrigation systems in Indonesia, which means that water can be measured at every offtake, the head of most secondary canals, and at the intake at the Cikeusik Weir. The most common control structure consists of a romijn gate at the head of every tertiary canal, and either sliding gates or stop logs in the main or secondary canal immediately downstream of each offtake. Typically, a single structure will serve two or three tertiary offtakes."},{"index":8,"size":77,"text":"The romijn gate is essentially a vertically adjustable broad-crested weir: this permits simultaneous control of water and measurement of discharge. Cipoletti weirs or Parshall flumes are used in larger canals or where there is insufficient head to install a romijn gate at tertiary level. This density of control and measurement infrastructure is intended to provide capacity to deliver water in precise amounts to meet crop water requirements; it also permits a wide range of different rotation options."}]},{"head":"THE BASIS FOR ROTATIONAL IRRIGATION IN THE MANEUNGTEUNG SYSTEM","index":20,"paragraphs":[{"index":1,"size":106,"text":"Rotation is essential because of the great differences between wet-season and dry-season conditions. Design guidelines call for tertiary canals to be able to deliver sufficient water for rice, estimated at 1.2 I/s/ha. Allowing for conveyance losses in secondary and main canals, the intake at the Cikeusik Weir and the first 8 kilometers (km) of the main canal are designed for 1.5 I/s/ha or 11.0 m 3/s. Even with this capacity, it is not possible to deliver water for land preparation for rice to all parts of the system simultaneously, so that cropping schedules are designed for a six-week stagger from head to tail of the systems."},{"index":2,"size":60,"text":"In the dry season, available discharge in the Cisanggarung River is normally about 2,000 lis, and may fall below 1,000 lis in particularly dry periods. This means that actual discharge is typically only 20 percent of the design capacity of canals, and this creates severe conveyance problems. The only effective solution is to rotate between different parts of the system."},{"index":3,"size":63,"text":"The basis for rotation in Maneungteung has traditionally been a seven-day cycle. The system is therefore divided into seven rotational units, each of which is scheduled to receive water for one day a week. In theory, different rotational arrangements exist for different levels of water shortage: one pattern when factor-k is between 0.6 and 0.4 and another when factor-k is less than 0.4."},{"index":4,"size":85,"text":"In practice, only the more drastic rotational schedule is normally implemented because of the rapid decline in available discharge in the Cisanggarung River at the end of the wet season. Rotations normally have to be implemented late in June or early July, and are maintained until the end of the dry season at the end of October. On the first of November the entire system is closed for two weeks for annual maintenance prior to wet-season irrigation deliveries which are scheduled to start in mid-November."},{"index":5,"size":32,"text":"Generally speaking, this type of rotational irrigation has been practiced from the time the system was rehabilitated in the 1970s as part of the wider program of upgrading irrigation systems in Java."}]},{"head":"IRRIGATION ROTATION PRIOR TO 1989","index":21,"paragraphs":[{"index":1,"size":118,"text":"In the early part of 1988, plans were made to make a special study of rotational Irrigation in Maneungteung. During the latter part of the 1987 dry season it was observed that there were problems at field level with rotational irrigation. Discussions with farmers showed dissatisfaction with the status quo, insofar as crops in many blocks suffered water shortages for extended periods in every dry season. Extensive lower areas of U1e system (and even parts of upper areas) were chronically unable to have third, or even a second crop while other areas were consistently able to plant three crops. A study of planning and implementing rotational irrigation commenced which resulted in an action-research program to modify existing practices."}]},{"head":"Planning Rotation","index":22,"paragraphs":[{"index":1,"size":74,"text":"The process of planning rotations requires the concurrence of people in several different agencies and villages. An initial plan is drawn up by the irrigation agency staff. This may be at subsection (pengamat) level of the PRIS if the subsection covers a complete irrigation system or at section level if the rotational units cover more than one subsection. In Maneungteung rotational plans are drawn up at section level because the system has three subsections."},{"index":2,"size":102,"text":"Once the initial plan is drafted, it is presented to the meeting of the Irrigation Committee for the subdistrict (kecamatan) held in Marc,h. This meeting includes representatives of the Provincial Irrigation Service (PRIS), agriculture service and the local government (including village leaders). The rotational plan is discussed and approved at this time. At the meeting in 1988, the proposal drafted by the PRIS was accepted without modification by the Irrigation Committee in much the same perfunctory way as was observed in similar planning activities in Sri Lanka (Murray-Rust and Moore 1983), where agency plans are ostensibly developed \"In consultation\" with farmer representatives."},{"index":3,"size":98,"text":"After the plan has been approved, it is intended that all village leaders and related officials will receive a copy of the plan, and will act upon it once it is decided that rotations must be implemented. This decision, which is the responsibility of the section or subsection engineer, is taken on the basis of factor-k. Each two week period, the value of factor-k is determined by aggregating tertiary block water requirement estimates, adding in an allowance for conveyance losses in main and secondary canals, and estimating probable water availability in the river during the forthcoming two weeks."},{"index":4,"size":77,"text":"When the system manager decides that rotations are required because factor-k has reached the critical level, the plan can be implemented unilaterally by writing to the village leaders and officials of related departments (agriculture, police, local government) of the date when rotational irrigation will commence. The time lag between sending this written communication and commencing rotations has to be about 10 days because of slow communications and the need for village leaders to inform the farmers ."},{"index":5,"size":53,"text":"Given this type of process, it is difficult to make short-term changes in the plan that accommodates different water conditions. In 1988, each rotational unit was assigned water on a specific day of the week, and there was no provision for identifying different levels of rotation for successive implementation as water supplies deteriorated."},{"index":6,"size":269,"text":"The rotation plan covered 70 tertiary blocks. Four tertiaries at the very head of the main canal had rotation by demand (the irrigation inspector was permitted to open and close the gates at will in response to his observation of whether water was sufficient or not), 2 tertiaries along the Losari Secondary were scheduled for water 2 days a week and 67 tertiaries were scheduled to receive water once a week (Figure 3). 111 the 1988 dry season in the East Maneungteung System, rotational irrigation at both tertiary and secondary levels was implemented only after overall water supplied had become far lower than could be accommodated by continuous irrigation (Figure 4a). At the beginning of June, discharge in the Cisanggarung River at the weir was about 8,000 I/s, which was approximately twice the level of demand in the entire system, which was about 4,000 lis (Figure 4b). By late June, available discharge had fallen to about 3,200 I/s and shortly after quickly passed below the system demand of about 3,000 I/s in early July. It was only at this time that the decision to implement rotations was taken, and the appropriate letters issued. However, the discharge in the Cisanggarung River at the weir continued to drop rapidly and the system IINel factor-k fell to about 0.6 by July 11 when rotations were eventually implemented. This meant that there was an extended perio~ when the system was operated at very low discharge under continuous flow, when it was incapable of delivering discharge relationships between and along canals as designed. Tail-end areas were severely water-deficit, and considerable social tension was observed."},{"index":7,"size":73,"text":"Field observations show that even before factor-k had reached 0.6, water was not reaching the tail end, due to poor distribution of water and the relatively large command area and length of canals to the tail end. Further, although rotations had been implemented in almost all previous dry seasons for several years, there was an additional delay between the time taken to establish the rotation plan and its actual implementation in the field."},{"index":8,"size":16,"text":"The traditional rotation had several inequities. The inequity can be described in a number of ways:"},{"index":9,"size":21,"text":"The number of days per week that different tertiary blocks received water during the rotational period varied from 1 to 7."},{"index":10,"size":25,"text":"The total irrigable area scheduled for irrigation each day of the week ranged from 403 ha on Fridays to 1,331 ha on Mondays (Figure 5a)."},{"index":11,"size":21,"text":"The total area planted in each rotation unit ranged from 369 ha on Fridays to 1,107 ha on Mondays (Figure 5a)."},{"index":12,"size":46,"text":"The estimated demand for water each day of the week varied greatly--although the time allocated per rotation unit was the same; this ranged from a low of 253 I/s for the Friday rotation unit to a high of 805 I/s for the Monday unit (Figure 5b)."},{"index":13,"size":119,"text":"These observations underline the difficulty of determining how to allocate scarce water. A key policy decision that has to be made is whether access to scarce water should be based on irrigable area or crop water requirements at the time the rotation is implemented. The rotations observed in 1988 allocate water primarily on the basis of actual crop water requirements at the time of rotational irrigation, Clearly, this favors head-end farmers who can get an early start to the first or second dry-season crop and who are more willing than the lower-end farmers to plant their entire fields, than are lower-end farmers. This discourages tail-end farmers from planting because they feel they will not get enough water during rotations.  "}]},{"head":"ASSESSING THE MANAGEABILITY OF THE 1988 ROTATION","index":23,"paragraphs":[{"index":1,"size":60,"text":"For implementation of a rotation to be practical and still provide basic access to water, it must be based upon local system design and institutional constraints rather than upon simple administrative boundaries or agricultural quotas. From repeated day-and-night inspections and interviews with the PRIS staff and farmers during the 1988 rotation in the Maneungteung System, the following observations were made:"},{"index":2,"size":37,"text":"The rotation did not have specific objectives or criteria to justify its conventional configuration of tertiary blocks (in fact, the PRIS subsection staff did not know the basis for its origin, which preceded their time in office)."},{"index":3,"size":28,"text":"Boundaries of rotation units were not always at locations where there was a proper control structure, makin~ it difficult to prevent flows into areas not scheduled for irrigation."},{"index":4,"size":49,"text":"The length of a canal section to be filled with water on a single day ranged from 12.458 km on Wednesdays to 23.074 km on Sundays (Table 1), meaning that tertiary blocks at the tail end of long sections were highly unlikely to receive their planned share of water."},{"index":5,"size":45,"text":"One case was observed where the upper end of a canal was scheduled for water on one day, drained completely the next day, and then water sent to the tail section on the third day, wasting scarce water in filling and draining canal sections unnecessarily."},{"index":6,"size":20,"text":"There were a large number of gates, often in disparate locations, which needed to be monitored and operated (Table 2a)."},{"index":7,"size":23,"text":"Rotation unit sizes and relative water demand were very unequal (Figures 5a and 5b) and were not in contiguous units (making control difficult)."},{"index":8,"size":14,"text":"There was virtually no monitoring by the PRIS of where the water actually went."},{"index":9,"size":10,"text":"Gates were often manipulated and canals blocked by self-interested farmers."}]},{"head":"*","index":24,"paragraphs":[{"index":1,"size":49,"text":"Staff received no bonuses and had little incentive for the intensive day-and-night tasks required to implement the rotation properly (monthly salaries of irrigation inspectors were the equivalent of about US$40.00 to US$50.00 per month, plus rice. Salaries for gatekeepers were about US$15.00, some of whom received rice as well)."},{"index":2,"size":11,"text":"* There was no adequate policing and farmers were not involved."},{"index":3,"size":181,"text":"There were no sanctions against water theft. which was very frequent (head-end tertiaries had a higher proportion of observations of unplanned water deliveries). The problem was more notable along Pabedilan and Jatiseeng secondary canals, but was present in other secondaries as well. This is a complex situation with numerous factors leading to the observed outcome. It was reported that, in some cases, much of the unscheduled activity was due to illegal operation of gates by farmers, and in others due to tacit consent of the gatekeepers. It is difficult for the PRIS to supervise head-and middle-section gates, especially since there are a large number of days when water is scheduled to pass by these gates but not to be diverted into the tertiary blocks. Given the low pay scales, which are the same in the wet and dry seasons, there is inadequate incentive for staff to carefully implement the rotation as planned. Many of the problems noted above, however, can be explained not as failures of control alone but the result of the plan itself being inequitable and difficult to manage."},{"index":4,"size":127,"text":"Throughout the period of the rotation all main and secondary canals and offtakes were inspected day and night on varying sample days of the week by the Study Team, to observe to what extent the rotation was being implemented as planned. Analysis of the 1988 rotational unit configuration (Table 2a) shows that of the 104 gates in the system, 52 gates had to be opened and the other 52 gates had to be closed per week. There was a weekly total of 175 gate monitorings per week, or an average of 25 gates per 24 hours which had to be monitored. There were 60 gates which had to be kept closed weekly to allow water to pass downstream. Implementation was cumbersome; control was more than a challenge."},{"index":5,"size":38,"text":"Table 3 (upper part) shows the number of tertiary blocks and inspectors (juru) used per day of the 1988 rotation. This ranged from two to four inspectors' jurisdictions per day, with rotation units often cutting across such jurisdictions."},{"index":6,"size":177,"text":"Field observations found that the plan was actually implemented 70 percent of the time observed (:20% when water was scheduled and delivered, and 50% when water was not scheduled and not delivered). There were only 3 percent of cases where water was not delivered when it was planned for delivery, and 15 percent when deliveries were made but which were not scheduled. Many of the latter cases were deliveries made the day following the schedule and reflected problems with filling up long sections of canals and irrigating all tertiary blocks within a single day. System managers largely respond to water conditions at the head of the system rather than basing their decisions on tail-end conditions. In the case of East Maneungteung, it seems likely that unless there is substantial change in operational improvements, normal operational rules should be changed so that rotations start before factor-k has reached 0.6 to meet water deficits at the tail of the system because discharges will be less than 50 percent of design, and hydraulic conditions would have already started to deteriorate."},{"index":7,"size":14,"text":"The Pilot Experim~~t ~~. ,\\I\"~ (: 'l . \" , ' . \".: .~:'"}]},{"head":"STEPS IN THE PROCESS","index":25,"paragraphs":[{"index":1,"size":142,"text":"THE PILOT STUDY Team consisted of IIMI staff and staff assigned to the project from the Directorate of Irrigation I and from the West Java Provincial Irrigation Service (PRIS). Project review meetings between Study Team members and the irrigation agency were held at the national, provincial, section and system levels, with the frequency of meetings increasing closer to the field. It was understood that the Study Team should identify and test new procedures which did not require significant additional O&M costs or physical changes or improvements in the system. Also, the government emphasized the need to first seek improvements which could be made within the current basic administrative procedures for irrigation O&M. More basic changes should only be considered after observing the limitations of improvements which could be made within the restrictions imposed by the physical system, staff and routine funds available."},{"index":2,"size":91,"text":"The new procedures introduced in the pilot experiment were based on management constraints found in the diagnostic stage and considerations about what improvements could be made solely through changes in the management of current resources available. In meetings between the PRIS and the Study Team, it was agreed that alterations could be made in the configuration of rotation blocks, in the timing of rotations, in the assignments to staff for supervising gate adjustments and in the role of the water users in helping determine the new rotation and supervising its implementation."},{"index":3,"size":146,"text":"It was also agreed that the Study Team could present to PRIS a set of alternative rotation plans and describe the implications for equity, efficiency and manageability of each alternative. The PRIS, at the system (or subsection) level, would nominate one of the plans and present it for approval or revision to a meeting of all Village Agricultural Officers (VAOs, or Kaur Ekbang) in the system. These are the key village level contacts for the PRIS in this area. This was decided in order to generate more commitment to the rotation plan among the farmer community. Whereas earlier the Head of the PRIS subsection would send out a letter informing village heads of the plan, it was now agreed to discuss with VAOs openly the particulars of a plan nominated by the PRIS.and obtain their advice and consent, and perhaps even their assistance in implementing it."},{"index":4,"size":39,"text":"After these principles were agreed to it was the PRIS's role to implement the new rotation, together with farmer participation in planning and supervising the rotation. It was the Study Team's role to document what happened and the results."},{"index":5,"size":97,"text":"With the objective of developing a more equitable and manageable form of dry-season irrigation than had been used in the past, pilot testing of alternative rotational practices was carried out in the East Maneungteung System in the 1989 dry season. The steps involved in the evolution of the new rotation and pilot implementation are listed below. 1. The Study Team monitored and evaluated the previous rotation system and facilitated conveyance of views between farmers, VOAs and the PRIS staff about problems in the old rotation system. This was done through field observations and measurements, interviews and meetings."},{"index":6,"size":19,"text":"2. The Study Team identified causes for the problems observed through data analysis, semi-structured interviews and direct field observation."},{"index":7,"size":70,"text":"3. In discussions with various PRIS staff and farmers involved in the rotation, the Study Team helped the PRIS clarify the various potential criteria and objectives for the rotation (such as equity per actual cropped area, equity per irrigable area, practicality of implementation, and amenability of the plan to being controlled and enforced). The PRIS staff had not thought of the rotation before in terms of specific objectives or criteria."},{"index":8,"size":20,"text":"4. The Study Team then identified a few feasible alternative rotation plans which optimized different combinations of the specified criteria."},{"index":9,"size":34,"text":"5. Several discussions about the pilot experiment were held between the Study Team and the PRIS officials at different levels: officials of agriculture service, the local government officials and VOAs at the subsection level."},{"index":10,"size":37,"text":"6. A meeting of the PRIS subsection chief and irrigation inspectors was held at the outset of the 1989 dry season to discuss alternative rotation options posed by the Study Team and to reach agreement on one."},{"index":11,"size":43,"text":"7. Shortly after the above meeting to nominate the new rotation plan, the meeting was held with all the involved PRIS subsection staff, officials of agriculture service and the local government and VOAs to discuss alternative rotational plans and select one of them."},{"index":12,"size":105,"text":"In this meeting, the farmer representatives agreed, in principle, to the plan nominated by the PRIS (commenting that it would be more equitable than in the past) and made some minor suggestions about modifying it slightly. They then signed an agreement to implement it and discussed a method for involving farmer groups in policing nighttime rotation. 8. The Study Team held a planning and training meeting among the PRIS subsection staff about implementing the new rotation. It was suggested and agreed to change the rotation shifts at twelve noon instead of at midnight, as before, in order to improve awareness and enforcement of the rotations."},{"index":13,"size":59,"text":"9. The Head of the PRIS subsection, in accordance with criteria about level of water shortage agreed with VOAs and decided when to start the rotation. It was started only in late August, due to rainy conditions which extended unusually long into August. Past main system rotations normally started in June or July, when factor K dropped below 0.4."},{"index":14,"size":59,"text":"10. Village-level arrangements were then made to schedule rotating village night-guard groups to police the rotation schedule at night. At first, groups were assigned arbitrarily to different nights, but later the schedule was modified so that the groups which did the guarding on a given night were from the area which should be getting the water on that night."},{"index":15,"size":18,"text":"11. The rotation was implemented as planned until the harvest of the second dry-season crop late in October."},{"index":16,"size":45,"text":"12. The Study Team monitored implementation of the rotation through systematic day-and-night inspections along distributary canals and through interviews with farmers and agency staff. It then analyzed the data and produced and discussed reports in subsequent meetings with the PRIS and the Department of Irrigation."}]},{"head":"ASSESSING ALTERNATIVES","index":26,"paragraphs":[{"index":1,"size":79,"text":"Five alternative plans were developed that tried to optimize the objectives of either equalizing irrigable area of rotation units, equalizing daily demand for water, having a more simple and implementable set of gate adjustments, or having a,more controllable rotation (Table 4). Fri. To develop a schedule so that the demand for water was more or less constant for six days of the week; \" To simplify the timetable so that canals were not drained and refilled more than necessary;"},{"index":2,"size":14,"text":"To use existing control structures as effectively as possible to delimit rotation boundaries; and"},{"index":3,"size":37,"text":"To involve farmers and field staff as joint partners in the planning and implementation of the rotations so that everybody was satisfied that the best was made of limited water resources and that social tensions were reduced."},{"index":4,"size":70,"text":"Each alternative was discussed among the PRIS staff and again with officials from the agriculture service, the district government and village governments. A public consensus was reached to select alternative three, on the strength of its equity and practicality for implementation. Figure 6 displays on a schematic map the new configuration of rotation units for the 1989 plan which was adopted and pilot tested. This alternative had the following characteristics:"},{"index":5,"size":15,"text":"All tertiary blocks should receive water for one day a week, with no exceptions permitted;"},{"index":6,"size":41,"text":". . Greater equity in area scheduled for irrigation each day: the daily total irrigable area varied from 56 ha on Tuesdays to 842 ha on Mondays, a ratio of only 1.49 compared to 3.30 in the 1988 pia (Figure 7);"},{"index":7,"size":17,"text":"A reduction in the number of times when gates have to be either operated or monitored (i.e."},{"index":8,"size":34,"text":"\"management inputs\") from 279 in 1988 to 241 in 1981 (a 13.6% decrease) and a decrease in the number of total required gate operations (i.e., gates adjusted, closed and opened) from 219 in 198E"},{"index":9,"size":16,"text":"to 166 in 1989 (a 24% decrease, see Tables 2a, 2b and 5 and Figure 8);"},{"index":10,"size":82,"text":"Anincrease in the estimated number of hours per week from 16.0 in 1988 to 17.7 in 1989, a 10.7 percent increase, when gates merely have to be monitored to ensure they remain closed (Table 5).  The plan was divided into two parts. The first version was intended to be implemented when factor-k was between 0.6 and 0.4. However, it was never implemented because factor-k dropped so rapidly after the rains stopped that a more substantial rotational pattern had to be implemented immediately."},{"index":11,"size":40,"text":"One potentially adverse factor however, at least in the transition to the new rotational plan, was that the selected plan involved an increase in inequity in the actual area planted, as scheduled for irrigation on each day of the week."},{"index":12,"size":57,"text":"Interestingly enouqh, this apparently negative consequence was a deliberate policy decision that was designed to overcome long-term inequity between head and tail areas of the system that has developed over several years. Farmers in the tail end have become accustomed to poor water conditions in the second dry season, and thus do not plant all their land."},{"index":13,"size":223,"text":"It was decided by the Provincial Irrigation Service (PRIS), after discussions with the IIMI staff, that in crder to encourage more equitable access to water in the long term, tail-end areas would be treated equally in terms of allocation of irrigable area (Iuas baku) rather than using past records of actual area planted. If tail end farmers were pleased with results in 1989 and their confidence in getting more water increased, then cropping intensity in tail areas could be expected to dramatically increase in 1990.  This situation led to a deliberate inequality in the water supplied in 1989, between actual areas planted in each rotation unit. At the start of the 1989 dry season, head-end areas had been able to plant almost all their lend while tail-end areas had either not received enough water or were cautious to avoid the risk of attempting high cropping intensities. Head-end areas, scheduled to receive water between Monday and Thursday had cropping intensities in August 1989 that averaged 97.7 percent (100% on Mondays and Tuesdays), while tail-end areas with water scheduled for delivery on Saturday and Sunday had cropping ir'tensities of only 50.8 percent and 27.0 percent, respectively. By giving tail-end areas an equal share of water while they had lower-cropped areas compensated for their distance and previous poor experiences with water deliveries in the dry season."}]},{"head":"ASSESSING THE MANAGEABILITY OF THE PILOT ROTATION","index":27,"paragraphs":[{"index":1,"size":29,"text":"Vie now return to the seven aspects of manageability referred to under Manageability in Chapter 1. We will apply them to our assessment of the rotational management pilot experiment."},{"index":2,"size":4,"text":"HewClear Are the Objectives?"},{"index":3,"size":122,"text":"Prior to the pilot experiment, the Head of the PRIS subsection was unaware of the criteria used to establish the earlier rotation. It was clear to him and the other PRIS staff and farmer representatives that the old approach had many flaws. including its inequity. impracticality and difficulty of control. In the discussions about results of monitoring the 1988 rotation and alternative plans, the criteria for selecting a' new rotation wer~ identified and clarified, namely that a new rotation should be based on: equity for rotation .unlt areas (not cropped area or real demand); the rotation should be practical to implement; and the rotational unit sizes should be inversely proportional to distance from the headworks. (Figure 7) How Implementable Are -the Procedures?"},{"index":4,"size":117,"text":"The new rotation, which was identified by the Study Team and selected by the PRIS, was substantially easier to implement~n terms of a more efficient and small configuration of gates to be monitored and adjusted. Also boundaries between the rotation units were placed where there were adjustable gates (Figure 6 and Table 4) and, because of the discussions and preparations which were made in advance, it was possible to implement the 1989 rotation much more quickly than in 1988, after discharge levels dropped off. Figures 4a   and 4b show that the rotation was not started in 1988 until two weeks after system-level supply dropped below demand. while in 1989 this was narrowed to less than one week."},{"index":5,"size":5,"text":"How Adequate Are the Resources?"},{"index":6,"size":71,"text":"Given the smaller amount of gate adjustments and monitoring needed under the new rotation, together with the mobilizing of farmers to help in policing the rotation at night. the labor resources were judged to be adequate to the tasks involved. Inspectors generally lived near their areas of work and had, at least, bicycles for transport, although nighttime use of bicycles to tour the system was considered somewhat dangerous, if done alone."}]},{"head":"How Controllable Is the Process?","index":28,"paragraphs":[{"index":1,"size":162,"text":"Realigning rotation unit boundaries according to locations where there were adjustable gates, switching deliveries between rotational units at midday instead of at midnight and involving farmer rotation unit representatives in nighttime policing substantially helped to make the rotation more controllable by the PRIS managers. Farmer night-watch groups were observed to be functioning on most night inspections. However, partly due to the inadequate incentives for staff, nighttime field work by the PRIS staff was probably not as intensive as was apparently needed Uudging from the illegal irrigation issues which still continued in 1989, although at lower levels than before). Some farmer guard teams complained of a) not being able to contact PRIS staff at their homes at night in order to correct unofficial diversions, or b) having the diversions return to their illegal positions after they had been corrected earlier in the night. There were some accounts of complicity between farmers and the low-level PRIS staff in some of the unplanned water deliveries."},{"index":2,"size":59,"text":"Table 6 shows that, in 1988. 30 percent of the observed arrangements during the rotation period was not in accordance with the official plan. In 1989, only 13 percent was not in accordance with the plan. Although unofficial issues were still frequently observed. they were not as frequent as in 1988, suggesting that an improvement in control was achieved."},{"index":3,"size":94,"text":"Figure 9 displays data for each inspection through the rotation period of discharge, the relation of supply to demand for the East Maneungteung System and the number of observed unscheduled or illegal irrigation issues per inspection. The Delivery Performance Ratio (DPR) is the ratio of actual discharge delivered (supply) to planned delivery (i.e., irrigation demand). In 1989. there was a tendency for more unofficial issues to be made when the water discharge increased (apparently because the opportunity for doing it and the effective impact of these actions are magnified when more water is available)."},{"index":4,"size":52,"text":"The correlation R 2 between the number of unofficial deliveries and discharge during the 1989 rotation was 0.30. In 1988, the level of unofficial deliveries was relatively haphazard and not correlated with variations in water supply (R 2 = 0.02). In 1989, unofficial deliveries were concentrated in a few high discharge periods."},{"index":5,"size":48,"text":"Sometimes, given rotation units are not able to or willing to absorb all of the water entering the unit when occasional high discharges unexpectedly and briefly enter the system during the rotation period. In these cases, unscheduled allocations to other units must be made to disperse the water."},{"index":6,"size":82,"text":"Figure 10 shows that unscheduled water deliveries under the old rotation were more spatially dispersed among rotation units, than was the case under the new rotation, where most of the unplanned activity occurred in the Monday, Tuesday and Friday units. The Monday and Tuesday units are in the upper end of the system and have been accustomed to receiving more adequate water supplies. The new rotation based on greater equity of unit sizes decreased the proportion of water scheduled for these areas."},{"index":7,"size":72,"text":"Hence, the frequency of unplanned deliveries to these areas was partly a response to their higher expectation and a reaction to the new plan. Also the Friday unit is an area of considerable production of high value shallots, much of which is rented to large-scale operators, who tend to have resources to manipulate water allocation. Some of this area is irrigated from a stream supplied via a drain in the Monday unit."}]},{"head":"How Accountable Are the Staff?","index":29,"paragraphs":[{"index":1,"size":155,"text":"The existence of a formal meeting and signed agreement about the rotation between the PRIS and the village agriculture officials was an important factor in strengthening a general sense of accountability to the plan. The meeting enabled the PRIS subsection to discuss the rotation directly with village representatives, which helped override more vested interest. The nighttime rotation guard groups (usually consisting of four or five farmers who went around together) usually sought out the irrigation inspector when an illegal issue or closure was observed. This helped make the PRIS staff somewhat more accountable to the water users, although there were reports that, often, the groups could not locate inspectors or the disturbances often reoccurred later in the night, even after being corrected by the PRIS staff. Flags were placed at the head of secondaries to designate the location of the rotation turn on a given day, thereby helping clarify implementation and making violations more discernable."},{"index":2,"size":92,"text":"The PRIS accepted a suggestion that jurisdictional boundaries of inspectors should be realigned on the basis of the new rotational arrangement and locations of qates with measurement devices. This would no doubt help the inspectors to be more accountable for flow going into and out of their areas. However, apparently more field supervision of water deliveries and activities of inspectors is needed by superiors.  Water supply and frequency of unofficial irrigation issues dJdng rotation period, the East Maneungteung System, West Java.   June -September, 1988   No. of unofficial issues Irrigation waters supply(l/s) (Thousands)"},{"index":3,"size":3,"text":"r----------------------------.----..., 4 -."},{"index":4,"size":10,"text":"~ 'I ':\\/'~\"\"\"\"\"\"'\" ---.~ .. ~.... -.L...I:.:..:==-=-:.:::.lI:..:.L --' L --'-_---'"}]},{"head":"Mon.","index":30,"paragraphs":[{"index":1,"size":1,"text":"Tues."},{"index":2,"size":1,"text":"Wed."}]},{"head":"Thurs.","index":31,"paragraphs":[{"index":1,"size":1,"text":"Fri."}]},{"head":"Sat.","index":32,"paragraphs":[{"index":1,"size":1,"text":"Sun."}]},{"head":"inspections","index":33,"paragraphs":[{"index":1,"size":6,"text":"August -October 2,---------------------------------, -.L...I:.:..:==-=-:.:::.lI:..:.L --'-L----L_ _"}]},{"head":"Mon","index":34,"paragraphs":[{"index":1,"size":1,"text":"Tues."},{"index":2,"size":1,"text":"Wed."}]},{"head":"Thurs.","index":35,"paragraphs":[{"index":1,"size":1,"text":"Fri."}]},{"head":"Sat.","index":36,"paragraphs":[{"index":1,"size":1,"text":"Sun."}]},{"head":"inspections","index":37,"paragraphs":[{"index":1,"size":34,"text":"Of course, the major weakness in accountability of the old and new rotation systems is the continuing lack 0 sanctions against violating the plan. either for farmers, the village officials or the PRIS staff."}]},{"head":"How Supportive Are the Incentives for Staff?","index":38,"paragraphs":[{"index":1,"size":75,"text":"The average irrigation inspector receives a monthly salary of approximately US$30.00 to US$40.00 plus a nce allocation. A small travel allowance for field work is also provided, although there is no difference in the amount between dry and rainy seasons. Unofficial incentives or temptations to reallocate water according to special interests, can easily exceed the level of salaries. Furthermore, the PRIS staff, often and understandably, have sideline income-earning activities which often compete for official time."}]},{"head":"How Measurable Are the Results?","index":39,"paragraphs":[{"index":1,"size":115,"text":"Actual deliveries to rotation units on any given day could be monitored due to the realignment of unit boundaries according to locations of adjustable gates, nearly all of which had discharge measurement devices. Figure 11 shows the relationship between water adequacy at the system level and at the rotation unit level, and at the same points in time. Water adequacy is indicated by the Delivery Performance Ratio (OPR), the ratio between actual and planned deliveries. In 1989, there was a much closer correlation between the OPR at the system level and the OPR at the level of the rotation unit level (R 2 = 0.44), than was the case in 1988 (R 2 = 0.27)."},{"index":2,"size":101,"text":"In 1989, whenever the OPR was less than 1.0, the scheduled rotation unit received virtually all the water. When the OPR was more than 1.0, the scheduled area tended to receive slightly more than its share, but not substantially so. Surplus water tended to be directed to other blocks not scheduled for irrigation. This contrasts sharply with the situation in 1988. There was a much closer link to water management at the main and subsystem levels in 1989. The DPR was introduced to the PRIS staff at this level and was discussed during the rotation period as a performance monitoring tool."}]},{"head":"Progress, Problems and Adaptability","index":40,"paragraphs":[{"index":1,"size":78,"text":"The 1989 experimental rotation system is a far more manageable one than the prior rotations used in the area in terms of specificity of objectives (especially equity of unit areas), implementability, reduced management requirements and measurability of results. It is somewhat improved in the adequacy of human resources (regarding farmer participation in approving and policing the plan) and control. However, it is not significantly different from the earlier rotation in manageability in terms of staff accountability and incentives."},{"index":2,"size":23,"text":"Despite the improvements made in the pilot rotation, a number of problems remained and some corrections were still needed, such as the following:"},{"index":3,"size":89,"text":"From the experience with the 1989 rotation it became clear that tail-end areas should receive water on Mondays, Tuesdays and Wednesdays in order to provide maximum control by irrigation staff over gates at the head end on full working days; Ngure 11. DPR at system and rotation unit, the East Maneungteung System. West Java. June -September, 1988 OPR (Rotation Unit) Head-end areas Should• be .irrigated on Fridays, Saturdays and Sundays in order to rmrurruze supervision requirements of irrigation staff, focusing monitoring on a few structures along the main canal;"},{"index":4,"size":64,"text":"Rotations should be implemented as soon as discharge for the Maneungteung East Canal reaches about 3,000 I/s rather than using factor-k or waiting for river discharges to drop; * Minor adjustments should be made to daily rotations so that the local problems encountered in 1989 can be smoothed out, such as unexpected problems in irrigating certain tertiary blocks simultaneously because of deteriorated canal conditions;"},{"index":5,"size":26,"text":"Village and local government officials should be kept informed of the problems associated with implementation so that those who break the agreed rules can be sanctioned;"},{"index":6,"size":22,"text":"Switching between rotations should be done at midday rather than at midnight to simplify and clarify the plan and facilitate greater control;"},{"index":7,"size":23,"text":"On a given night, night-guard teams should be mobilized from the area having the rotation turn (to enhance their incentive to guard diligently);"},{"index":8,"size":10,"text":"A system of sanctions against violations needs to be developed;"},{"index":9,"size":62,"text":"The PRIS should receive some form of bonus for extra work or favorable results from implementing the dry-season rotation (although this would require more basic institutional changes); and * Higher-level policy analysis and discussion need to be pursued regarding institutional reforms which are needed to provide the PRIS with greater institutional incentives to improve not only dry-season rotations but irrigation performance generally."}]},{"head":"Conclusion FINDINGS","index":41,"paragraphs":[{"index":1,"size":100,"text":",THIS STUDY SHOWS that significant improvements can be made in the manageability and performance of ...etry-season irrigation rotation at the local level using current resources. These include improvements in ,aspects such as the configuration of rotation units, scheduling, staff assignments and involvement of farmers ,in planning decisions, and their enforcement. However, such adjustments do not address, and by .Jhemselves cannot overcome, management control problems connected with weak staff-incentives and . leccountability and the \"rent-seeklnq\" patterns of water allowance which are driven by underlying economic . J8nd land-tenure inequalities, which, in turn, are especially manifest during periods of scarcity (Repetto 1986)."},{"index":2,"size":29,"text":"Further, needed improvements in staff incentives and accountability, sanctions and the adaptability of the PRIS to changing agricultural preferences of farmers will require more basic institutional and policy changes."},{"index":3,"size":36,"text":"It is becoming widely recognized that irrigation line agencies around the world, which are generally funded by national or provincial revenues, normally lack the institutional imperative to achieve and monitor performance objectives (Small et al. 1989)."},{"index":4,"size":167,"text":"Improvements in water distribution according to the rotation plan and the decreased tampering under the pilot rotation can be explained partly as a result of the effect of concerted attention on staff activities in the pilot study, more support from farmers due to a generally more acceptable rotation plan, more explicit public commitments to the plan by the PRIS and village representatives, made in advance of implementation, and the greater ease of implementing and supervising the new plan. When water is in short supply, rotational irrigation represents one of the larger management challenges for irrigation staff. Water becomes more valuable to farmers, competition increases, and management tasks are more complex and more intensive. However, there is no commensurate increase in management resources. The main observations from the study indicate that there is potential for achieving moderate but immediate improvements in equity through the joint strategy of a) altering rotations to make them more manageable under local resource constraints and b) involving farmers in planning and enforcing implementation."}]},{"head":"Awareness of Objectives","index":42,"paragraphs":[{"index":1,"size":163,"text":"Rotational plans in Maneungteung did not provide equitable access to water. Up to 1988, the cropping pattern at the time rotations were introduced determined the overall plan. This means that over a period of several years upper-end farmers had established a precedent for scarce water, while tail-end areas had a high proportion of fallow. Further, the area scheduled for irrigation each day was also inequitable, so that the value of factor-k each day shows significant variation: some farmers getting water every day, others once a week. If the dry season starts early, crops may suffer water stress, while a continuation of the rains may mean that nearly all farmers obtain a full crop in the first dry season. Excessive dry-season planning of high-water demand crops such as rice or shallot can place extreme pressure on the PRIS to implement rotations; if the farmers had known about the typically conservative crop plan and had followed it, it would have been unnecessary to implement rotations."}]},{"head":"Existing Management Complexity","index":43,"paragraphs":[{"index":1,"size":145,"text":"Conventional rotational plans observed were too complex for existing management capabilities. They required too many gate operations and too much supervision of gates. The Maneungteung pilot study showed that it is possible to reduce the work load significantly while improving equity, and to do this at minimal cost. The pilot experiment shows that it is a reasonably straightforward task for irrigation managers to reassess their current rotational plans, determine how to reduce overall gate operations and thus make more time available for supervision and monitoring. In Maneungteung, it proved easy to modify rotational plans to take full advantage of suitable locations where water could be properly controlled or flows stopped. It is easy to slip into the habit of designing rotations based on the administrative division of a system rather than developing one that makes the best use of the control infrastructure and available staff."}]},{"head":"New Rotational Plans","index":44,"paragraphs":[{"index":1,"size":57,"text":"Developing new rotational plans is a gradual process involving negotiation and testing. The experience of Maneungteung in 1989 shows that it is possible to modify rotational plans to achieve greater equity, and to implement these plans without major difficulties. However, patience and committed leadership are required in all stages of the processing: planning, implementation, supervision and evaluation."}]},{"head":"RECOMMENDA\"r10NS","index":45,"paragraphs":[]},{"head":"Objectives of Rotational Plans","index":46,"paragraphs":[{"index":1,"size":49,"text":"Rotational plans should specify clearly what the objectives are. When water is scarce it is important to clearly define the equity principle to be adopted, and to develop a rotational plan that meets that objective as closely as possible given the limitations of physical infrastructure and the canal layout."},{"index":2,"size":49,"text":"The fairest way to achieve equity is to use the total irrigable area as the basis for water allocation, thereby giving tail-end farmers an equal right to water. If this proves difficult because of conveyance problems, rotations between seasons to different parts of a complex system should be considered."}]},{"head":"Preknowledge of Rotational Plans","index":47,"paragraphs":[{"index":1,"size":44,"text":"Rotational objectives and procedures must be known in advance. If rotational plans are to achieve their objectives then farmers must know of these plans before they plant their dry season crops. Decreasing the level of uncertainty can only help farmers to be more productive."},{"index":2,"size":119,"text":"Rotational plans based on clear objectives do not reduce the overall risk, but can provide assurances of priority to water if it is less than adequate for all areas. Traditional rotation plans were based mainly on area planted and hence gave priority to those who planted more. These tended to be located in areas with better access. By redefining and clarifying the equity objective (i.e., based on irrigable, not planted, area) the risk is spread out among more farmers because each person is entitled to a share of the available water. If water becomes scarce, the effect is felt equally, and it becomes the choice of individuals to decide whether to irrigate all or part of the cropped area."}]},{"head":"Simplicity of Rotational Plans","index":48,"paragraphs":[{"index":1,"size":63,"text":"Rotational plans should be as simple as possible to be understood and implemented. Where possible, the plan should call for gates to be either open or shut so that control over water is simpler and easier to monitor. Developing plans so that several adjacent tertiary blocks can be irrigated rather than tertiaries on two or three secondaries greatly reduces management and supervision tasks."}]},{"head":"Implementability of Rotational Plans","index":49,"paragraphs":[{"index":1,"size":134,"text":"Rotational plans must be implementable with existing physical infrastructures. If main or secondary canals had to be blocked at the downstream limit of a daily rotational area, this should be at a gate that is functional and where proper control can be maintained. The plan should aim at minimizing the lengths of canals that have to be filled and emptied to achieve a full rotational cycle; travel time allowed should also be minimized when determining the area to be irrigated each day. It is not easy to develop a rotational schedule that fits a system design based primarily on continuous flow. However, until such time as management implications of rotations are included in the design process, it is incumbent upon system managers to adopt as efficient a system as possible within the design constraints."}]},{"head":"Speed of Implementation of Rotations","index":50,"paragraphs":[{"index":1,"size":103,"text":"Rotations should be implementable quickly and on the basis of appropriate criteria. Delay in implementing rotations means that some farmers will suffer more than others. These are always tail-end farmers, because breakdown in hydraulic conditions will not be felt near the head of canals. The use of factor-k to determine when to implement rotation should be modified to include assessment of the percentage of design discharge flowing in canals, while field monitoring should be used to determine when tail-end reaches of canals are beginning to experience conveyance problems and it is time to introduce rotations between tertiary blocks and then between secondary canals."},{"index":2,"size":146,"text":"The use of factor-k to determine when to implement rotations is hydraulically unsound. In a typical dry season, a certain percentage of farmers never plant so that demand is automatically less than design discharge. Factor-k values only assess the ratio between actual demand and supply, and do not take into account the hydraulic viability of running the system at low discharges. The major purpose of rotations is to maintain flows closer to design levels than would be possible if continuous flows are adopted. The result is that water distribution wider continuous flow conditions may become very difficult even when factor-k is still high because demand is much lower than in the wet season. Implementation, therefore, should be based on an assessment of both the level of actual demand in the system and the adequacy of current discharges relative to hydraulic flow parameters in the system design."}]},{"head":"Controllability of Rotational Irrigation","index":51,"paragraphs":[{"index":1,"size":57,"text":"Rotational irrigation must be controllable. There is little utility in developing a rotational plan if it is not enforced. In areas where rotations have to be introduced every year it is essential that farmers have enough confidence in the system management that they will risk planting a dry-season crop, or risk planting a more valuable dry-season crop."},{"index":2,"size":76,"text":"This confidence can ~only be developed over a period of several seasons, and this requires a consistent set of plans and implementation by irrigation staff. It is essential that the agreed plan is implemented in accordance with that agreement, and that violators are brought to task. Nothing will erode the confidence of tail-end farmers more quickly than seeing upper-end farmers taking water out of turn, or successfully offering inducements to irrigation staff to break the schedule."},{"index":3,"size":59,"text":"Because rotational irrigation affects the whole community, it is important that the whole community is involved. This involvement goes beyond planning, and includes active farmer and village leadership involvement in supervision, monitoring and sanctioning activities. It is impossible for irrigation staff to undertake these tasks because there is neither the time nor the manpower available to supervise rotations unilaterally."}]},{"head":"Conditions for Accountability","index":52,"paragraphs":[{"index":1,"size":8,"text":"Supportive organizational arrangements should exist to ensure accountability."},{"index":2,"size":102,"text":"To facilitate the implementation of rotational plans, the boundaries of rotational areas, where possible, should coincide with the jurisdictions of irrigation inspectors in an effort to reduce the amount of coordination required. It is not desirable, however, that only one irrigation inspector be fully responsible for a single day of the cycle because the supervision load is too high. Plans should include a system of mutual assistance between irrigation inspectors so thatthose who do not have duties on a given day, because there is no water in their area, can assist in the monitoring and supervision in other parts of the system."},{"index":3,"size":94,"text":"It is important that once this innovation has been started it is pursued and further refined over several seasons to ensure that the plans are as easy to manage as possible, that all parties are reasonably satisfied with the arrangements, and that difficulties encountered can be accommodated by making adjustments in the successive seasons. Making changes to rotational irrigation should not be seen as a one-time, project-type of activity, but the development of a long-term process that deals with the particularly difficult task of managing irrigation when there is insufficient water for all concerned."},{"index":4,"size":138,"text":"This pilot experiment was an exercise where an international irrigation management organization collaborated with an administrative line agency to develop, implement, and evaluate an improved irrigation management procedure which is based on standard management principles of specifying clear objectives and implementable procedures to achieve easurable results. Line agencies often function less to achieve results than to implement administrative routines as prescribed from above. Frequently, agency staff pay little attention to whether or not the procedures were actually implemented or the results achieved. A pilot project such as this concentrates special attention on management activities. This alone can stimulate improved performance and no doubt was partly responsible for the improved performance measured in the second year of the study. This shows that the identification and application of locally appropriate management procedures can have a direct effect on improved performance."},{"index":5,"size":91,"text":"However, the experiment also supports the view that the institutional accountability and incentive to manage, and not the identification of management procedures, constitute the hard part of the challenge in improving and sustaining irrigation management performance. Various new management activities were carried out on the momentum of a pilot research and development project. The Study Team members and agency staff discussed equity and management objectives and identified ways to link new implementation procedures to the n~wly clarified objectives. Farmers were included in designating main system rotation units and in policing implementation."},{"index":6,"size":62,"text":"And yet the experiment was not able to fully address the more fundamental problems of control and incentives. In order for this \"management approach\" to be sustained by the implementing agency, its own institutions must be reoriented towards a \"need to manage.\" There must be an institutional imperative to clarify objectives and achieve results. This more difficult challenge remains to be addressed."}]}],"figures":[{"text":" Figure1. Figure2. Figure3. Figure4a. "},{"text":" Figure 4b. "},{"text":"Figure Figure sa. "},{"text":" Figure 5b. "},{"text":" Figure 6.Figure 7. "},{"text":" Figure 8. "},{"text":" Figure 9. "},{"text":" Figure 10. "},{"text":" Figure 11. "},{"text":"Figure 1 . Figure 1. Location of research sitl;j in CirebonSection, West Java, indonesia. "},{"text":"Figure 3 , Figure 3, Rotation plan for the East Maneungteung Irrigation System, dry season, 1988. "},{"text":"Figure 4a . Figure 4a. Discharge in the Cisanggarung River at the Cikeusik Weir during the rotation period, dry season, 1988. "},{"text":" on aate locations Inequitable block size/distance relationship, many aates to be controlled Note: U =Upper part of the system, M:::: Medium part of the system and L = Lower part of the system Each rotation alternative considered for the East Maneungteung System for the 1989 dry season had the following objectives: "},{"text":" Figure 6. Rotation plan for the East Maneungteung Irrigation System, dry season, 1989. "},{"text":"Figure Figure 7.Improvement of equity in block areas between 1988 and 1989 rotations, the East Maneungteung System, West Java "},{"text":"Figure Figure 8. "},{"text":" Figure 9. "},{"text":"5 Figure 10 . Figure 10. Average number of observed deviations from the rotational plan per inspection, the East Maneungteung System, West Java. "},{"text":"Figure 11 . Figure 11. DPR at system and rotation unit, the East Maneungteung System. West Java. "},{"text":" Daily rotation block areas, the East Maneungteung System, West Java,dry season, 1988.     Figure 5a. Area (ha)       Figure 5a. Area (ha) 1,400       1,400 1,200       1,200 1,000       1,000 800       800 600       600 400       400 200       200 O~~~Ja:~~~:zt,...~)Ql:1tz~~Y1<2:l'l.~:)Qoan...::~::la~U200!Clb>' O~~~Ja:~~~:zt,...~)Ql:1tz~~Y1<2:l'l.~:)Qoan...::~::la~U200!Clb>' Mon. Tues. Wed. Thurs. Fri. Sat. Sun. Mon.Tues.Wed.Thurs.Fri.Sat.Sun. Area (ha)       Area (ha) 1,400       1,400 1,200       1,200 1,000       1,000 800       800 600       600 June :::Il~mmmJm~~ July August September October Mon. Tues. Wed. Thurs. Fri. Sun. June :::Il~mmmJm~~ July August September October Mon. Tues. Wed. Thurs. Fri. Sun.  "},{"text":"Table 1 . Lengths of canals irrigated, filled or drained for implementing rotations, the East Maneungteung System, West Java. Irrigable Total canal Total canal Total canal IrrigableTotal canalTotal canalTotal canal area  length used length filled length drained arealength usedlength filledlength drained   1988   1988 Monday 1,331 13,539 6,387 14,143 Monday1,33113,5396,38714,143 Tuesday 902 21,947 3,304 3,195 Tuesday90221,9473,3043,195 Wednesday 995 12,458 4,856 7,193 Wednesday99512,4584,8567,193 Thursday 433 12,925 3,837 3,370 Thursday43312,9253,8373,370 Friday 403 16,380 3,455 0 Friday40316,3803,4550 Saturday 1,017 19,962 5,361 0 Saturday1,01719,9625,3610 Sunday 870 21,295 3,854 2,521 Sunday87021,2953,8542,521   1989   1989 Monday 842 9,375 3,213 14,189 Monday8429,3753,21314,189 Tuesday 564 10,306 4,144 3,213 Tuesday56410,3064,1443,213 Wednesday 752 15,5640 5,234 1,084 Wednesday75215,56405,2341,084 Thursday 734 14,795 3,304 2,965 Thursday73414,7953,3042,965 Friday 576 15,282 8,130 •7,643 Friday57615,2828,130•7,643 Saturday 655 19,789 6,256 1,749 Saturday65519,7896,2561,749 Sunday 748 20,351 4,057 2,495 Sunday74820,3514,0572,495 -     -  "},{"text":"Table 2a . Operational requirements for implementing rotations, the East Maneungteung System, West Java, dryseason, 1988.      Mon. Tues. Wed. Thurs. Fri. Sat. Sun. Total  Mon.Tues.Wed.Thurs.Fri.Sat.Sun.Total Gate adiusted 15 26 15 11 8 16 24 115  Gate adiusted1526151181624115 Gate closed 3 9 6 11 10 5 8 52  Gate closed39611105852 Gateo ened 15 1 11 9 4 8 4 52 219 Gateo ened15111948452219 Gate kept closed 5 6 0 1 11 19 18 60 279 Gate kept closed560111191860279 Total ate a eation 18 10 17 20 14 13 12 104  Total ate a eation18101720141312104 Total gate operation per Inspector 3 5 4 5 2 3 4   Total gate operation per Inspector3545234 Total gates for 24-hour monitoring 20 32 15 12 19 35 42 175  Total gates for 24-hour monitoring20321512193542175 Gales for 24-hour monitoring/inspector 5 3 3 4 3 5 6   Gales for 24-hour monitoring/inspector5334356    15       15  "},{"text":"Table 2b . Operational requirements for implementing rotations in the East ManeungteungSystem, West  Java, dry season, 1989.      Mon. Tues. Wed. Thurs. Fri. Sat. Sun. Total  Mon.Tues.Wed.Thurs.Fri.Sat.Sun.Total Gate adjusted 15 3 3 16 9 11 11 68  Gate adjusted1533169111168 Gate closed 1 11 8 7 5 11 6 49  Gate closed11187511649 Gate opened 9 8 11 1 11 7 2 49 166 Gate opened98111117249166 Gate kept closed 0 0 9 15 12 15 24 75 241 Gate kept closed0091512152475241 Total cats operation 10 19 19 8 16 18 8 98  Total cats operation10191981618898 Total gate operation per inspector 3 4 4 3 4 3 2   Total gate operation per inspector3443432 Total cates for 24-hour monitorino 15 3 12 31 21 26 35 143  Total cates for 24-hour monitorino1531231212635143 Gates for 24-hot:lr rnonitorinq /inspector 2 2 4 6 6 5 6   Gates for 24-hot:lr rnonitorinq /inspector2246656  "},{"text":"Table 3 . Tertiary blocks scheduled for irrigation rotation, the East Maneungteung System, West Java. 1988 1988  "},{"text":"Table 4 . Alternative rotation plans for the East Maneungteung System, West Java, dryseason, 1989.     Alternative I Mon. Tues. Wed. Thurs. Fri. Sat. Sun. Alternative IMon.Tues.Wed.Thurs.Fri.Sat.Sun. Total area (ha) 776 630 658 631 686 641 849 Total area (ha)776630658631686641849 Crop area (ha) 776 630 649 600 546 325 297 Crop area (ha)776630649600546325297 Total canallenath (rn) 5188 10306 13323 14795 15282 19399 20351 Total canallenath (rn)5188103061332314795152821939920351 Location (U/M/U* U U/M M M MIL L L Location (U/M/U*UU/MMMMILLL Advantaae Relativelv eoual block sizes      AdvantaaeRelativelv eoual block sizes Disadvantaae Less practical to control and adlust cates     DisadvantaaeLess practical to control and adlust cates Alternative II Mon. Tues. Wed. Thurs. Fri. Sat. Sun. Alternative IIMon.Tues.Wed.Thurs.Fri.Sat.Sun. Total area (ha) 776 630 555 734 686 641 325 Total area (ha)776630555734686641325 Crop area (ha) 776 630 546 703 546 325 297 Crop area (ha)776630546703546325297 Total canallenoth (rn) 5188 10306 15540 14795 15282 19789 20351 Total canallenoth (rn)5188103061554014795152821978920351 Location (U/M/L)* U U/M M M L 'L L Location (U/M/L)*UU/MMML'LL Advantaae Gates more controllable, fairlv eaual block sizes    AdvantaaeGates more controllable, fairlv eaual block sizes Disadvantaae Complicated shifting between uncontiguous blocks    DisadvantaaeComplicated shifting between uncontiguous blocks Alternative III   (Selected for pilot ex erlment)   Alternative III(Selected for pilot ex erlment)  Mon. Tues. Wed. Thurs. Fri. . Sat. Sun. Mon.Tues.Wed.Thurs.Fri.. Sat.Sun. Total area (ha) 842 564 752 734 576 ••655 748 Total area (ha)842564752734576••655748 Crop area (ha) 842 564 752 734 436 333 20~ Crop area (ha)84256475273443633320~ Total canallenoth (rn) 9375 10306 15540 14795 15282. 19789 20351 Total canallenoth (rn)937510306155401479515282.1978920351 Location (U/M/U* U U/M U/MlL M L L L Location (U/M/U*UU/MU/MlLMLLL Advantage Good inverse relationship between crop area/block and distance; block boundaries drawn AdvantageGood inverse relationship between crop area/block and distance; block boundaries drawn  where cates exist      where cates exist Disadvantaae Greater number of oates to monitor and ooerate than some other options  DisadvantaaeGreater number of oates to monitor and ooerate than some other options        Continued... Continued...  "},{"text":" 7.Improvement of equity in block areas between 1988 and 1989 rotations, the East Maneungteung System, West Java TableS. Management improvements between 1988 and 1989 rotations, the East Maneungteung System, TableS.Management improvements between 1988 and 1989 rotations, the East Maneungteung System,  West Java.      West Java.  irnqable area (ha):   4871 irnqable area (ha):4871  Numberof cates:    114 Numberof cates:114  Numberof tertiary blocks:   70 Numberof tertiary blocks:70 ,. Management Requirements     ,. Management Requirements     1988 1989 %Chan e 19881989%Chan e     279  241 -13.6 279241-13.6     219  166 -24.2 219166-24.2     32.4 27.4 -15.4 32.427.4-15.4     16.4 9.7 -40.9 16.49.7-40.9     16.0 17.7 10.7 16.017.710.7     10  6 -40.0 106-40.0  1,400 Irrigable area (ha) 10 o o 6 1,400Irrigable area (ha)10 oo 6    1,200    1,200 1,200 2. Equity of Rotations      1,200 2. Equity of Rotations 1,000 800 [ Waterplanned> day/week Weekly inequityIndex  6 3.3  0 1.49  --54.8 1,000 800 [ Waterplanned> day/week Weekly inequityIndex6 3.30 1.49--54.8  600      600  400      400  200      200  0      0   Mon. Tues. Wed. Thurs. Fri. Sat. Sun. Mon.Tues.Wed.Thurs.Fri.Sat.Sun.     I~ 1988 ~ 1989 I  I~ 1988 ~ 1989 I  Ratio of highest to lowest area/day    Ratio of highest to lowest area/day  1988: 3.30      1988: 3.30  1989: 1.49      1989: 1.49  "},{"text":"8 . Changes in management inputs between 1988 and 1989 rotations, the East Maneungteung System, West Java. Mgt. Index Open Closed Total Monitoring Mgt. IndexOpenClosedTotal Monitoring  I~1988 ~19891  I~1988 ~19891 Management Index: Total gate operations   Management Index: Total gate operations Open: Monitoring discharge    Open: Monitoring discharge Closed: Keeping gate shut    Closed: Keeping gate shut  "},{"text":"Table 6 . Rotation plan and actual practices observed at sample locations, day-and-night inspections, the East Maneungteung System, West Java, 1988 and 1989 dry seasons. Tertiary  Planned   Unplanned practices  TertiaryPlannedUnplanned practices blocks         blocks  Delivered Not delivered Delivered Not delivered DeliveredNot deliveredDeliveredNot delivered  1988 1989 1988 1989 1988 1989 1988 1989 19881989198819891988198919881989 MTRV 2 7 12 30 2 5   MTRV27123025 MTRVI 2 9 12 24 2 6  3 MTRVI291224263 MTRVII 2 9 3 23 11 9  1 MTRVII293231191 PBI 1 9 6 32 11 1   PBI19632111 PBII 2 9 9 17 7 16   PBII29917716 PBIII 2 10 8 27 8 5   PBIII21082785 PBIV 2 10 12 29 5 2  1 PBIV2101229521 PBV 3 7 11 33 3 2 1  PBV371133321 PBVI 4 7 11 35 3    PBVI4711353 PBVII 4 7 11 35 3  1  PBVII47113531 PBVIII 3 7 11 35 2  1 1 PBVIII371135211 PBIX 2 7 14 34     PBIX271434 JTS I 3 7 1 15 10 20   JTS I371151020 JTS II 3 7 1 28 10 6  1 JTS II371281061 JTS III 4 7 1 12 10 23   JTS III471121023 JTSIV 4 7 3 30 6 4 1 1 JTSIV473306411 JTSV 3 7 4 28 5 6 1 1 JTSV374285611 JTSVI 4 7 4 28 5 5 1 2 JTSVI474285512 LS I 3 9 4 17 4 16   LS I39417416 LS II 3 9 4 30 4 3   LS II3943043 LS III 4 4 7 35 1 3   LS III4473513 LSIV 3 4 7 33 1 4 1 1 LSIV347331411 LSV 3 4 6 37 2  1 1 LSV34637211 LSVI 3 4 6 37 2 1 1  LSVI34637211 LSVII 3 4 7 37 1 1 1  LSVII34737111 LSVIII 3 1 7 38 2 2  1 LSVIII31738221 LSIX 3 1 8 40   1 1 LSIX3184011 LSX 3 1 11 39  1 1 1 LSX311139111 LSXI 3 1 11 40   1 1 LSXI31114011 LSXII 3 4 11 35   1 3 LSXII34113513 Total 87 186 223 913 120 141 14 20 Total871862239131201411420 AveraQe/lns. 2.64 4.429 6.76 21.74 3.64 3.357 0.42 0.476 AveraQe/lns.2.644.4296.7621.743.643.3570.420.476 PercentaQe 20 15 50 72 27 11 3 2 PercentaQe20155072271132 Total observations in the dry season 1988: 444/ No. of inspections: 33.     Total observations in the dry season 1988: 444/ No. of inspections: 33. Total observations in the dry season 1989: 1260/ No. of inspections: 42.     Total observations in the dry season 1989: 1260/ No. of inspections: 42.  "}],"sieverID":"66528e24-6fba-4b1a-aa7f-cefc3e647a80","abstract":"Water supply and frequency of unofficial irrigation issues during rotation period, the East Maneungteung System, West Java Average number of observed deviations from the rotational plan per inspection, the East Maneungteung System. West Java DPR at system and rotation unit, the East Maneungteung System, West Java v THIS STUDY WAS part of a two-year Phase II research and development program, funded by the Asian Development Bank and the Ford Foundation. It consisted of two components--efficient irrigation management and small-scale system turnover of water users. A grant from the Rockefeller Foundation enabled IIMI to conduct additional activities under the component for efficient irrigation management, with particular emphasis on crop diversification and dry-season irrigation (including rotational irrigation). Additional general support in the form of IIMI office space and facilities was provided by the Government of Indonesia. Some core financing from IIMI was also utilized.Throughout the implementation of this project full support and encouragement were provided by Ir. Soebandi Wirosoemarto, Director General of Water Resources and Ir. Koesdaryono, Special Assistant to the Minister of Public Works. Within the Directorate of Irrigation I, the following individuals provided regular support and assistance: Ir. Seonarno, Director of Irrigation I, Ir. Hamudji Waluyo and Ir. Winarno Tjiptorahadjo, both of whom served as Head of the Sub-Directorate for Operation and Maintenance during the project, and Ir. Soekarso Djunaedi, Head of Tertiary Development, and all of them made trips to 11M I field sites and offered numerous insights despite their very busy schedules.Within the West Java Provincial Irrigation Service (PRIS), special thanks are due to Ir. Maman Gantina, Head of Water Resources and Ir. Apun Affandi, Head of O&M, in the head office in Bandung. Ir. Hadzan Sumalidjaja and Ir. Sardjono were each Head of Irrigation for the Cirebon Region (Wilayah) during part of the study. Each of them provided institutional and intellectual support for the project. It was lr. Sardjono, while Head of Irrigation for the Cirebon Section in 1987, who first suggested to IIMI that the Maneungteung System would be a good research site.He also helped select choice staff to be temporarily seconded to the project as collectors of field data. These included: Cecep, Nurhayanto, Taryono, Soetrisno and Affandi. These staff diligently worked many odd hours interviewing farmers and agency staff, recording discharge levels and conducting midnight inspections of the irrigation system. Ir. Kadar and Ir. Rusyan of the Cirebon Section of the PRIS provided much advice and support, as did their subsection Heads in the Maneungteung System."}

data/part_3/0c21392795d1f368784ccc6679d17cd8.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0c21392795d1f368784ccc6679d17cd8","source":"gardian_index","url":"https://digitalarchive.worldfishcenter.org/bitstream/handle/20.500.12348/3860/7fa6fb5d5d0e5289386a82c45c776514.pdf"},"pageCount":1,"title":"Productivity and the promise of integrated rice-fish systems: How gender will shape success or failure in an era of rural transformation in Myanmar","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":62,"text":"In order for rice-fish systems to increase production leading to increases in nutrition and income, leading to increases in household wellbeing; both women and men will need to be equitably engaged in and benefiting from the systems, including having access to extension and control over income. Yet current gender dynamics and barriers challenge the assumption that this will happen on its own."}]},{"head":"\"... We don't want our children to be farmers… cannot get rich as a farmer.\" Male smallholder rice farmer, Myaungmya focus group discussion","index":2,"paragraphs":[{"index":1,"size":20,"text":"Rice-fish systems offer increased production, profits, improved livelihoods and nutrition; but these outcomes will rely on gender barriers being addressed. "}]}],"figures":[{"text":"Background• Unprofitable and unproductive farming; monoculture rice the lowest productivity in Southeast Asia • Complex land tenure and land use policy • Rural poverty 38.8% : Urban 14.5% • Outmigration (seeking better jobs) • 1 in 3 children suffer a form of malnutrition • Absence of gender in the rice-fish discourse Research Questions • What are women and men smallholders aspirations, needs and preferences in relation to rice-fish production; to what extent do emerging technologies meet these? • What are the barriers to gender-equitable outcomes from improved/integrated rice-fish production system? • How can integrated rice-fish production systems contribute to gender equity and women's empowerment? • Any unintended consequences or trade-offs and why? "},{"text":"Fisheries WorldFish, IRRI, Departments of Agriculture and Fisheries collaborative research on rice-fish systems. • Ayeyarwaddy Delta (2016 -2020) • Demonstration farm phase; integrates mixed methods longitudinal social studies through to scale out. • Results presented: first round findings of FDG's and KII's in communities surrounding the demonstration plots. \"Household headship (HH)\" Males seen as HH, in turn enabling • Better access to and control over land • Decision to adopt aquaculture • Often target of training and extension Women traditionally dominant postharvest activities in fish (market and value addition) and have strong control over the use of income from fish. "}],"sieverID":"6155a05c-6686-4205-bb7b-c57de89dcd7f","abstract":""}

data/part_3/0c2a879746cd5965d6daf3a20d799340.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0c2a879746cd5965d6daf3a20d799340","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/666426ae-6c47-425b-8bf6-7bd1eb40dd44/retrieve"},"pageCount":108,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":14,"text":"iii To be Africa's leading research partner in finding solutions to hunger and poverty."}]},{"head":"Our Vision","index":2,"paragraphs":[{"index":1,"size":23,"text":"Photo by A farmer in Uganda making his way home after a hard day's work in the field. Photo by JT Oliver, IITA."},{"index":2,"size":1,"text":"1"}]},{"head":"Possibilities, potentials, and positive changes","index":3,"paragraphs":[{"index":1,"size":33,"text":"At the final interview of the selection process for the position of Director General of IITA, one of the members of the interview panel asked me, \"So, what is your vision for IITA?\""},{"index":2,"size":119,"text":"The question -short, pointed, and straight as an arrow -is probably the most important that can be asked of any candidate vying to be the head of the largest agricultural researchfor-development organization in sub-Saharan Africa. My response, outlined in my presentation \"Realizing the Possibilities\" during that interview and summarized below, presents strategies for operationalizing my vision for the institute in the next 10 years. Deeply committed to IITA's vision of \"being Africa's leading research partner in finding solutions to hunger and poverty,\" I intend, as Director General, to organize and strengthen our research and research partnerships, building on our achievements and enhancing our scientific and administrative capacity to help resource-poor farmers boost production, improve food security, and increase incomes."},{"index":3,"size":80,"text":"By 2020, we will be operating through decentralized and well-integrated research programs working on major challenges in Africa's food and agricultural sector specifically on crops and natural resources linked to human wellbeing. We will also be carrying out our mission through programs aligned to and part of the larger CGIAR Consortium Research Programs (CRP), and fostering innovative partnerships and catalyzing relationships between and among international agricultural research centers (IARCs), national, regional and pan-African entities, the private sector, and farmer organizations."},{"index":4,"size":73,"text":"We will also build on scientific advances and better understanding of the socioeconomic environment to enable farmers to triple yields, enhance crops' nutritional value, and promote greater commercialization of the food crops that we work on. We will achieve this by optimizing the use of natural and related resources while preserving the environment for future generations. To do this, we will have to double the human and financial resources currently available to us."},{"index":5,"size":43,"text":"Well-defined strategic interventions -some related to the four strategic System Level Outcomes of the new CGIAR of reducing rural poverty, increasing food security, correcting undernutrition, and promoting more sustainable management of natural resources -will serve as our guiding light toward achieving our goals."},{"index":6,"size":110,"text":"In the short-term, I will quickly work on the following priorities: revamp the natural resource management research area and establish the biotech platform for West Africa; decentralize the R4D program area along the Impact Zones, with the CRP on the Humid Tropics as the operating and integrating arm; bring in strong and resourcewinning Impact Zone research directors and the next generation of process-based and development and impact-oriented scientists; finalize the alliance with icipe and CIAT-TSBF to establish a CGIARbased African center; strengthen relationships with other IARCs and CGIAR centers; and engage the private sector, where possible, for farm input supply and within the value chains of cocoa, cassava, and soybean."},{"index":7,"size":50,"text":"I will engage the Board's unique talents, skills, and abilities to continually assess our strategies, devise smart solutions to adapt to new challenges and opportunities, and ensure that we maintain exemplary performance on all the strategic interventions. And all these, I will carry out with transparency as a leadership imperative."},{"index":8,"size":46,"text":"As Director General, I pledge to exert all efforts to position IITA as the primary driver of \"bringing new agriculture for a wealthier Africa,\" and it will be my great honor and pleasure if you will join me in this challenging but worthwhile and wonderful journey."}]},{"head":"Nteranya Sanginga Director General","index":4,"paragraphs":[]},{"head":"Research Highlights","index":5,"paragraphs":[]},{"head":"Agriculture and Health","index":6,"paragraphs":[{"index":1,"size":43,"text":"Micronutrient deficiency, particularly of vitamin A, zinc, and iron, is a major public health problem affecting mostly women and children. Foodborne diseases, mycotoxins, plant toxins, and poor management practices in intensified agriculture are responsible for associated diseases and can impose barriers to trade."},{"index":2,"size":67,"text":"We address these major challenges by finding ways to provide a higher diversity and density of micronutrients in human diets, reduce food toxins, increase the knowledge on nutrition patterns and distribution of food and nutrients within social systems particularly with respect to human nutrition across social strata and gender, and overcome labor force bottlenecks in farms and households affected by HIV/ AIDS or malaria through appropriate technologies."}]},{"head":"Yellow-fleshed, vitamin A-fortified cassava root developed by IITA. Biofortification of staple food crops is the most viable option to address the problem of malnutrition among millions of Africans. Photo by JT Oliver, IITA","index":7,"paragraphs":[]},{"head":"Tackling killer aflatoxins in African crops","index":8,"paragraphs":[{"index":1,"size":61,"text":"Contamination by aflatoxins of food crops is a global issue that is undermining public health and development efforts. In humans, aflatoxins increases disease susceptibility by suppressing the immune system, stunts children's growth, and causes cancer and death from acute poisoning through liver cirrhosis/necrosis. Aflatoxins also severely impact livestock through contaminated feed, causing death, slower growth, reduced feed conversion, and lower yields."},{"index":2,"size":65,"text":"Aflatoxins are also non-tariff barriers to global trade since food crops that are contaminated above the limits set by importing countries are banned or rejected. Around 25 percent of the world's food crops are affected, with more than 5 billion people in developing countries, particularly in Asia and Africa situated between 40 o N and 40 o S, most at risk of chronic aflatoxin exposure."},{"index":3,"size":66,"text":"Aflatoxins are produced by the fungi Aspergillus flavus when these infect both staple and export crops. However, not all strains of the fungus are bad and produce the toxins. There are also benign ones -non-toxic or 'atoxigenic'that, when used in a biocontrol technology and introduced at a particular stage of the crop, could outcompete and reduce the population of the toxic ones, thereby drastically reducing contamination."},{"index":4,"size":83,"text":"We have been working on the biocontrol of aflatoxins for several years, successfully developing and deploying the biocontrol product aflasafe TM with the support of the Agriculture Research Service of the US Department of Agriculture (USDA-ARS). In the last two years, we consolidated efforts on biocontrol of aflatoxins with partners in Nigeria, Burkina Faso, Senegal, and Kenya. We also initiated a new biocontrol program in Zambia and secured funding for expansion of biocontrol activities in Mali, Ghana, and Tanzania for 2012 and beyond."},{"index":5,"size":30,"text":"This year, we launched two projects in Nigeria, Kenya and Zambia that sought to provide farmers with a natural, safe, and cost-effective solution to aflatoxin contamination in maize and peanut."},{"index":6,"size":37,"text":"In Kenya, we identified four competitive atoxigenic strains isolated from Kenyan maize to constitute a biocontrol product called aflasafe-KE1 TM . We are currently gathering efficacy data in areas where the technology will be deployed in Kenya."},{"index":7,"size":44,"text":"In Zambia, the project will also develop a countryspecific biocontrol product, but initial focus is on mapping the incidence of aflatoxin in maize and groundnut. In Nigeria, where the biocontrol technology is most advanced, we are exploring opportunities for commercialization of aflasafe TM ."},{"index":8,"size":36,"text":"In Senegal, we coordinated the evaluation of a biocontrol product -aflasafe-SN1 -in 2010 and 2011, which involved 80 groundnut farmers. Fields treated with aflasafe-SN1 showed 90% reduction in aflatoxins compared to those that were left untreated."},{"index":9,"size":40,"text":"In Burkina Faso, we screened more than 3,500 A. flavus isolates, and selected eight native atoxigenic strains that were evaluated in 30 maize and groundnut farms. From these eight, we will identify the four most effective strains to constitute aflasafe-BF1."},{"index":10,"size":49,"text":"The projects will emphasize the development of a viable business plan for the production, adoption, and distribution of the biocontrol products to ensure sustainability of efforts. Raising public awareness about aflatoxins and biocontrol and building the human capacity and support facilities of national partners will equally be given priority."},{"index":11,"size":99,"text":"The aflatoxin control project in Kenya and Nigeria is funded by the Bill & Melinda Gates Foundation, USDA, and the African Agricultural Technology Foundation (AATF). We are working with the Ministries of Agriculture in Kenya and Nigeria, USDA-ARS, AATF, Kenya Agricultural Research Institute, Doreo Partners, the National  Field testing of aflasafe™ in Nigeria over the past four years has produced extremely positive results: aflatoxin contamination of maize and groundnut was consistently reduced by 80-90%, in some cases even as high as 99%. In 2011, we deployed nearly 14 tons of aflasafe TM in some 450 maize and groundnut farms."},{"index":12,"size":71,"text":"Ranajit Bandyopadhyay, IITA Plant Pathologist, is optimistic that Kenya and Senegal will have their own versions of aflasafe TM within two years, Burkina Our work on aflatoxin control and on establishing the partnership resulted in another grant titled \"Expansion of biological control to manage aflatoxin in maize and groundnut using regionally-adapted beneficial fungi in Eastern and West Africa\" from the Meridian Institute which manages a multi-donor fund on behalf of PACA."},{"index":13,"size":25,"text":"The grant will be used to develop countryspecific aflasafe TM for Ghana, Mali, and Tanzania, and regional biocontrol products for West, East, and Southern Africa."},{"index":14,"size":50,"text":"The project will also design and construct a lowcost manufacturing facility in Nigeria to optimize and adapt the manufacturing process to a developing country context, as well as develop and test viable commercialization models of aflasafeTM in Nigeria. We will collaborate with USDA-ARS, Doreo Partners, and AATF in this effort. "}]},{"head":"Seeing yellow: tackling malnutrition with vitamin A cassava","index":9,"paragraphs":[{"index":1,"size":38,"text":"In November, the Nigerian government officially released three new vitamin A-enriched 'yellow' cassava varieties that we developed with our partners that could deliver substantial quantities of the important nutrient in the diets of more than 70 million people."},{"index":2,"size":55,"text":"The yellow color (cassava is generally white) of the newly released varieties is imparted by their high breeding efforts improve cassava's nutritional quality. The research was supported by funding from HarvestPlus and in partnership with Nigeria's National Root Crops Research Institute (NRCRI) and the International Center for Tropical Agriculture (known by its Spanish acronym CIAT)."},{"index":3,"size":35,"text":"The vitamin A cassava varieties, officially named by the National Variety Release Committee of Nigeria as UMUCASS 36, UMUCASS 37, and UMUCASS 38, are recognized as IITA genotypes' IITA-TMS I011368, IITA-TMS I011412, and IITA-TMS I011371."},{"index":4,"size":75,"text":"Vitamin A deficiency (VAD) is widely prevalent in sub-Saharan Africa. In Nigeria, VAD afflicts about 20 percent of pregnant women and 30 percent of children five years old and below. VAD can lower immunity and impair vision, and lead to blindness and even death. Yellow cassava provides a costeffective medium to deliver vitamin A to VADvulnerable individuals and communities in Nigeria where the average person consumes about 600 grams of cassava in various forms daily."},{"index":5,"size":58,"text":"Vitamin A is an anti-oxidant. Medical research has shown that regular vitamin A intake slows the progression of cataracts, promotes and maintains healthy vision, prevents muscular degeneration, boosts the immune system, regenerates healthy skin cells, and protects against an array of illnesses such as cancer, heart disease, asthma, depression, infertility, Parkinson's disease, psoriasis, arthritis, and high blood pressure."},{"index":6,"size":24,"text":"The new varieties are envisioned to mostly benefit children and women, which could provide up to 25 percent of their daily vitamin A requirement."},{"index":7,"size":158,"text":"Aside from being nutritious, the yellow varieties have also been proven to give high yields and offer good resistance to major diseases and pests. Farmers who evaluated them also said that the varieties are well suited for producing gari and other food products -they even swear that the yellow cassava tastes better than their white counterparts, too! Farmers across the country, and even in other cassava producing countries in West Africa, are already clamoring for planting materials of these new varieties. HarvestPlus is working with IITA and local partners to multiply stem cuttings to satisfy the demand. By 2013, researchers say that there will be enough certified stems of the vitamin A cassava varieties to cover 25,000 households initially. breakthrough, we are already working on developing improved versions of these varieties that can provide up to 50 percent of the required daily vitamin A allowance. These further improved yellow cassava varieties should be ready in a few years."},{"index":8,"size":29,"text":"Other collaborators in the development of the new vitamin A cassava include the Brazilian Agricultural Research Corporation (Embrapa) and various government and agricultural research and extension agencies in Nigeria."}]},{"head":"Working a MIRACLE in Southern Africa","index":10,"paragraphs":[{"index":1,"size":105,"text":"In sub-Saharan Africa, approximately 22.4 million people are living with HIV/AIDS. In rural areas where over 80 percent of the population depend on agriculture livelihoods, the disease presents a major challenge because it leads to reduced farm As an approach, the project uses transfer of agricultural and postharvest innovations as a means of mitigating the impact of HIV/AIDS on affected smallholder farmers. Specifically, it promotes the production, value addition, and utilization at both small-and medium-scale commercial levels of nutrient-dense crop varieties that are also highyielding, and resistant to drought, pests, and diseases. These crops include soybean, cowpea, quality protein maize, cassava, and sweetpotato, among others."},{"index":2,"size":60,"text":"The project also encourages the production, marketing, and consumption of indigenous, yet nutritious, vegetables such as amaranths, pumpkin leaves, sweet potato leaves, cassava leaves, and other local and nutrient-packed vegetables. MIRACLE also pushes for the production of small livestock, focusing on feed formulation using dual or multipurpose legumes and cereals, improved animal housing, and better disease control particularly of chickens."},{"index":3,"size":33,"text":"Beneficiary households are being trained to sustainably produce their own nutritious foods and to use these to generate additional incomes, and develop and promote value added products and processes from various nutrient-dense crops."}]},{"head":"Soybean demonstration plot in Nkhata Bay MIRACLE site in Malawi.","index":11,"paragraphs":[{"index":1,"size":5,"text":"Photo by T Gondwe, IITA."},{"index":2,"size":33,"text":"To ensure sustainability of its interventions, MIRACLE will advocate for appropriate national policies to link agriculture with nutrition and improve the general health status of PLWHA and their families in the project countries."},{"index":3,"size":23,"text":"Aside from improving the socioeconomic and health conditions of HIV/AIDS-affected farming households, MIRACLE will also help ease the stigma associated with the disease."},{"index":4,"size":81,"text":"More than half a century after the first case of HIV was diagnosed in the Congo in 1959, PLWHA still suffer discrimination especially in developing countries where education on the disease is almost non-existent. The UNAIDS in 2009 listed the HIV prevalence rate among adult population (15-49 years old) -the most labor-productive age group -in MIRACLE's target countries as 26.1 percent in Swaziland (the highest in southern Africa), 15.2 percent in Zambia, 12.5 percent in Mozambique, and 11.9 percent in Malawi. "}]},{"head":"Agrobiodiversity","index":12,"paragraphs":[{"index":1,"size":72,"text":"Knowledge on the living and taxonomic collections of other (non-crop) organisms help researchers find sustainable ways to manage pests and diseases and improve soil fertility of ecosystems to enhance human welfare. We are involved in the conservation and sustainable use of biodiversity of fungi, plant associated microorganisms, insects, mites and parasitic nematodes for biological pest control and in the development of environment-friendly technologies to protect the natural habitat and conserve on-farm biodiversity."},{"index":2,"size":30,"text":"The goal of our Agrobiodiversity Program is sustainable improvement in agricultural growth, particularly in sub-Saharan Africa, through increased use of efficiently conserved collections of important plant and non-plant biological resources."},{"index":3,"size":15,"text":"One of our genebank staff sorting cowpea seeds for storage. Photo by JT Oliver, IITA."}]},{"head":"Safeguarding Africa's precious crop biodiversity","index":13,"paragraphs":[{"index":1,"size":39,"text":"As vanguard of Africa's crop biodiversity, we work to help stem the loss of the continent's plant genetic resources and optimize their potential by developing new and more effective ways to conserve and use them in crop improvement research."}]},{"head":"Acquisition and distribution of crop genetic resources","index":14,"paragraphs":[{"index":1,"size":52,"text":"Our Genetic Resources Center (GRC) holds more than 28,000 accessions of key food crops in sub-Saharan Africa and continuously work to expand our germplasm collection. We have also supported crop improvement and conservation activities of partners and other agricultural research organizations in various countries by providing them with the needed crop germplasm."},{"index":2,"size":40,"text":"This year, the GRC acquired 289 accessions of various pea, soybean, sword bean, and yam); South Africa (bambara groundnut); India (bambara groundnut, cowpea, and soybean); Japan (cassava and yam); Fiji (cowpea); Senegal (cowpea); Zambia (cowpea); and the UK (wild Vigna)."}]},{"head":"Safety duplication of seed crop collections in the Svalbard Global Seed Vault","index":15,"paragraphs":[{"index":1,"size":53,"text":"We hold the distinct honor of being the first international agricultural research center to send seeds to the Svalbard Global Seed Vault -also called the \"Doomsday Vault\" -located on the Norwegian island of Spitsbergen. Our initial consignment sent in January 2008 comprised of 7,000 unique seed samples of crops from 36 African nations."},{"index":2,"size":28,"text":"Between then and 2010, we have sent more than 12,000 accessions of African food crops to the seed vault, representing over 55 percent of our conserved seed germplasm."},{"index":3,"size":37,"text":"In 2011, we sent an additional 2,017 germplasm accessions for safety duplication to the Svalbard Vault. This shipment comprises of 27 accessions of African yam bean, 317 of bambara groundnut, 1,577 of cowpea, and 96 of maize. "}]},{"head":"Cryopreservation of yam and cassava","index":16,"paragraphs":[{"index":1,"size":78,"text":"During the year, researchers conducted experiments at the Institut de recherche pour le développement (IRD) in France and at IITA-Ibadan in Nigeria to compare two cryopreservation approaches developed for yam: encapsulation/dehydration by IRD and droplet/ vitrification by IITA. Results showed that the droplet/ vitrification approach was more suitable for yam cryopreservation. As the approach has also shown high efficiency for cassava, the approach will be used for the long-term preservation of the international collections of the two crops."}]},{"head":"Long-term conservation of yam and cassava collections","index":17,"paragraphs":[{"index":1,"size":103,"text":"Currently, the GRC maintains all accessions of yam and cassava in field bank conditions with a partial backup in vitro. Eventually, we plan to introduce and maintain these yam and cassava accessions under in vitro slow growth conditions. Materials that qualify for cryopreservation -or conservation through deepfreeze -will be placed in cryobanks. Once an accession proves stable in in vitro slow growth and is successfully duplicated in the cryobank, its field duplicate will be removed. For accessions that are stable in vitro but recalcitrant to cryopreservation, in vitro samples will be maintained at two different locations and the field duplicate will be eliminated."},{"index":2,"size":43,"text":"We envision that with this approach, we will progressively reduce yam and cassava field banking activities in IITA-Ibadan; however, residual field activity will remain for in vitro recalcitrant accessions and field regeneration of the in vitro-stored samples (with true-to-type checking every five years)."},{"index":3,"size":35,"text":"It is proposed the in vitro slow growth and field activity in Ibadan be maintained, while the in vitro duplication and cryoprocessing/cryobanking activity be moved to our East Africa Hub in Dar es Salaam, Tanzania."},{"index":4,"size":48,"text":"The transfer of the safety duplication activity to Tanzania will improve our standard on risk management of collections. It will also provide critical mass to the plant tissue culture activity planned for the Hub for eventual mass propagation and diffusion of clean germplasm in East and Southern Africa."}]},{"head":"Keeping track of what we have is an important function for the long-term conservation of our collection.","index":18,"paragraphs":[{"index":1,"size":5,"text":"Photo by JT Oliver, IITA."},{"index":2,"size":33,"text":"In the case of cassava, we will maintain botanical seeds of the core accessions in the long-term seed bank of the GRC with safety back-ups in genebanks in Saskatoon, Canada and Svalbard, Norway."}]},{"head":"IITA Microbial Bioresource Collection","index":19,"paragraphs":[{"index":1,"size":56,"text":"This year, researchers at our Germplasm Health Unit characterized and established a unique reference culture collection made up of bacteria, fungi, and viruses intercepted in germplasm, and of reference isolates of pathogens of sub-Saharan food and horticultural crops. The collection will serve as an important resource for research, verification of diversity, and development of diagnostic tools."},{"index":2,"size":32,"text":"The collection, which was initiated in early this year, contains 68 fungal strains, 6 bacterial strains, and 8 virus species originated or intercepted in Nigeria that have been morphologically and biologically characterized."},{"index":3,"size":41,"text":"This will be augmented by regularly adding new isolates and strains, including pathogens and beneficial agents. We are currently genetically characterizing (through DNA Barcoding) these isolates -based on rDNA, histone, beta-tublin, elongation factor or CO1 genes -to help eliminate redundant ones."},{"index":4,"size":19,"text":"DNA isolated from these cultures is put in the DNA bank to also serve as reference standards in diagnostics."}]},{"head":"CIALCA Conference 2011: putting humid tropics research in the global limelight","index":20,"paragraphs":[{"index":1,"size":43,"text":"In October, over 200 farm researchers, development experts, and other stakeholders gathered in the Rwandan capital of Kigali for a landmark conference that took stock of agricultural development efforts in Central Africa's breadbasket and chart a path towards food security for the region."},{"index":2,"size":68,"text":"The international conference is the first-ever that examined the challenges and opportunities for intensifying farm production of the humid tropics regions in sub-Saharan Africa. It was organized by the Consortium for Improving Agriculture-based Livelihoods in Central Africa (CIALCA), which we co-implement with Bioversity International and the Tropical Soil Biology and Fertility Institute of the International Center for Tropical Agriculture (TSBF-CIAT). people per square kilometer in Rwanda and Burundi."},{"index":3,"size":59,"text":"Although these are high-potential areas for farm production due to good rainfall and temperatures that allow cropping most of the year, persistent civil conflicts, lack of infrastructure, political instability and poverty have left small farmers struggling to eke out a living. Food security is a major problem, with some areas reporting 30 to 40 percent of families going hungry."},{"index":4,"size":28,"text":"Since 2006, CIALCA has been working with public and private sector partners to make improvements to farm production, market access, and child nutrition in the Great Lakes region."},{"index":5,"size":41,"text":"Experts at the conference warned that countries in the Great Lakes region could face increased conflict and greater instability in coming decades unless there is widespread use of better farm approaches and innovations that could grow more food with less land."},{"index":6,"size":28,"text":"\"Previous conflicts have been indirectly driven by the ability of the land to support food needs of Central Africa's high population densities,\" said IITA Director General Nteranya Sanginga."},{"index":7,"size":54,"text":"\"In the future, the big question will be whether the land and the soils that underpin farm yields can support booming populations under new constraints like rapid climate change and other environmental factors,\" Sanginga told the conference, adding that food prices could continue to rise in the absence of sustainable intensification of food production."},{"index":8,"size":32,"text":"\"If we do not do anything now, we will be going back to the situation of war -a war not because of ethnicity but war for food, war for space,\" added Sanginga."},{"index":9,"size":57,"text":"Indeed, the effects of climate change in the already resource-strained countries in the region are a major concern. For example, some of our recent studies have shown that the ability of farmers to grow coffee and banana -two of the region's largest cash cropsare severely affected by rising temperatures, making them more susceptible to pests and diseases."}]},{"head":"Members of a women's group","index":21,"paragraphs":[{"index":1,"size":13,"text":"in Rwanda working on a communal maize-soybean farm. Photo by JT Oliver, IITA."},{"index":2,"size":46,"text":"Hans Herren, president of the Millennium Institute and World Food Prize Laureate, said in a key note address that many farmers could not embrace new sustainable approaches to farm production as they could not access them. Besides, Herren added, some approaches were harmful to the environment."},{"index":3,"size":67,"text":"Participants shared examples of sustainable farm approaches that could increase yields and alleviate land pressure in the region. Burundi. The adoption of higher-yielding climbing beans is said to play a big role in improving soils. \"Hopefully, it is these kinds of innovations that can help to steer the region towards a brighter future,\" said Jos Kalders of Belgium's Directorate General for Development Cooperation (DGDC) which funds CIALCA."},{"index":4,"size":47,"text":"And while significant progress has been made in the region, scientists also drew attention to the severe yield gap of sub-Saharan Africa's agricultural productivity. Staple crops such as maize, millet, beans, sweet potatoes, and cassava are being produced at 60 percent to 90 percent below their potential."},{"index":5,"size":57,"text":"Participants at the conference reached consensus that agricultural research and development efforts should focus on sustainable intensification, which combines the most effective and sustainable approaches to improving farm yields. \"Aside from just producing food, it is also imperative that we help farmers connect to markets. Farmers will produce more if they are assured of markets,\" Kalibata emphasized."},{"index":6,"size":42,"text":"\"I also ask you not to keep your science on the shelves. Bring them to the fields and respond to the needs of farmers in real time. You have the power to improve the lives of African farmers, use it!\" she concluded."}]},{"head":"Banana and Plantain Systems","index":22,"paragraphs":[{"index":1,"size":66,"text":"Grown by smallholder farmers, bananas and plantains are major staple food and leading cash crop in the tropics and sub-tropics. Bananas are similar in management to root and tuber crops, with clonal propagation and perishable, bulky harvested products. In the East African highlands, they are the top source of dietary calories, stabilize hillside soils against erosion, and are a main source of cash income for farmers."},{"index":2,"size":41,"text":"We undertake research to increase the knowledge on ecosystems, social systems, and commodity chains related to banana and plantain production, improve the sustainability and profitability of banana and plantain systems, and improve the quality of bananaand plantain-based food products in Africa. "}]},{"head":"Maize to the rescue of African banana against an unseen enemy","index":23,"paragraphs":[{"index":1,"size":36,"text":"Our banana and plantain researchers have found an unlikely ally in maize in the fight against nematodesmicroscopic worms that damage the roots of plants, slowing their growth, making them prone to toppling, and producing smaller fruits."},{"index":2,"size":50,"text":"In sub-Saharan Africa, smallholder growers lose 40 percent or more of their yields due to the tiny worms. Losses are so severe because bananas are grown on the same land which lets the worms build up a high density unlike the crop rotations methods practiced in Europe and the US."},{"index":3,"size":63,"text":"In experiments, our researchers infused maize cystatin gene and a synthetic nematode-repelling protein into the plantain, cv. Gonja manjaya. The cystatin introduced from maize kernel prevents nematodes from digesting proteins, literally \"starving\" them to death and greatly reducing their population. The nematode-repelling protein, on the other hand, makes the plantain's roots secrete a synthetic peptide that disables the nematodes' ability to find it."},{"index":4,"size":54,"text":"Results of our tests showed that the maize cystatin and peptide, alone or combined, can provide plantain with resistance to simultaneous infections by multiple nematode species, as what actually happens in the field. In the study, our scientists infused plantain with either one or both of the genes for single or dual nematode defense."},{"index":5,"size":69,"text":"Feeding on the roots, nematodes restrict the flow of nutrients into the plants and stunt their growth. Farmers easily lose 40 percent or more of their crop because of nematode infestation, especially in areas frequented by storms and high winds. This is because nematodes damage and weaken the roots -the plant's anchor -causing the whole plant to completely topple over. Plants heavily laden with harvest-ready bunches are especially affected."},{"index":6,"size":36,"text":"Our scientists worked with counterparts from the University of Leeds on the transgenic research in Uganda. The results of the study have been published in the latest edition of the journal Molecular Plant Pathology (http://onlinelibrary.wiley.com/ doi/10.1111/j.1364-3703.2012.00792.x/abstract)."},{"index":7,"size":57,"text":"The research team assessed 245 independent transgenic lines (plantlets) for resistance to nematodes. From these, they identified the strongest 11 (those that showed more than 67 percent nematode resistance). These lines will be further evaluated in confined field trials in Uganda in collaboration with the National Agricultural Research Organization (NARO) after approval by the National Biosafety Authority."},{"index":8,"size":45,"text":"Leena Tripathi, IITA Biotechnologist and one of the lead scientists, said that the research is a breakthrough in managing nematodes, which many farmers are usually not aware of because they do their damage underground and are too small to be seen by the naked eye."},{"index":9,"size":55,"text":"The team assures that maize cystatin is safe to use. It naturally occurs in the crop's kernel and has been in the diets of humans for as long as maize has been consumed. The safety of cystatin-based transgenic work has also been well-established in rice for years. A similar protein is present in human saliva."},{"index":10,"size":51,"text":"Safety studies of the synthetic peptide also showed that it is destroyed by the high temperatures required for cooking plantain and by the digestive fluids in the intestine. In addition, the protein is not listed as being a potential allergen in Allergenonline and Allmatch, reference tools used by WHO and FAO."},{"index":11,"size":42,"text":"While the safety of the genetic interventions has been proven in the laboratory and in many studies, we will still carry out further safety analyses during the field trials to ensure that they pose absolutely no danger to humans or the environment."},{"index":12,"size":19,"text":"Nematoderesistant banana and plantain will help farmers to realize the crop's full economic potential. Photo by JT Oliver, IITA."}]},{"head":"On the horizon: fully wilt disease-resistant banana","index":24,"paragraphs":[{"index":1,"size":29,"text":"Good news for banana and plantain farmers across Africa: we have successfully developed and tested banana and plantain that are totally resistant to the deadly Banana Xanthomonas Wilt (BXW)."},{"index":2,"size":41,"text":"BXW causes crop production losses of more than US$500 million every year and puts at risk the food security and livelihoods of millions of mostly resource-poor smallholder farmers and their families. All banana varieties in Africa are vulnerable to the disease."},{"index":3,"size":48,"text":"Leena Tripathi, lead scientist of our banana transformation research, says that 12 transgenic lines infused with wilt-resistance genes from green pepper had been shown to be 100 percent resistant to BXW under confined field trials in Uganda. it also takes about 15 years to produce an improved variety."},{"index":4,"size":32,"text":"Given the rapid spread and devastation of BXW across the continent, genetic transformation through the use of modern biotechnology tools offers an effective, fast, safe, and viable way to develop resistant varieties."},{"index":5,"size":57,"text":"However, she noted that more work needs to be done before open field trials could be conducted as Uganda does not currently have related laws that would allow such testing, but she is optimistic that the country would soon overcome this hurdle and, if all goes well, the world may see its first transgenic banana by 2017."},{"index":6,"size":23,"text":"The wilt-resistance genes -plant ferredoxinlike amphipathic protein (pflp) and hypersensitive response-assisting protein (hrap) -were obtained under an agreement from Academia Sinica in Taiwan."},{"index":7,"size":25,"text":"Aside from full resistance to BXW, the transformed lines also showed flowering and yield (bunch weight and fruit size) characteristics comparable to local non-transgenic varieties."},{"index":8,"size":20,"text":"Partners in this research include the National Agricultural Research Organization (NARO) of Uganda and the African Agricultural Technology Foundation (AATF)."},{"index":9,"size":34,"text":"We are also working with the University of Leeds' Africa College in developing transgenic plantain that is resistant to nematodes (see preceding article \"Maize to the rescue of African banana against an invisible enemy\")."},{"index":10,"size":24,"text":"The plants have shown promising results in screenhouse trials and the best lines will soon be planted in confined field trials also in Uganda."},{"index":11,"size":23,"text":"Tripathi added that the institute will also look at stacking the anti-wilt genes with anti-nematode genes in the same plant for multiple resistance. "}]},{"head":"Cereals and Legumes Systems","index":25,"paragraphs":[{"index":1,"size":24,"text":"Cereals and legumes such as maize, soybean, and cowpea are important food, feed, and cash crops mainly grown by smallscale farmers in sub-Saharan Africa."},{"index":2,"size":40,"text":"However, the productivity of these cereal and legume crops is currently low due to pests and diseases, poor soil fertility, poor access to improved seeds and postharvest technologies, inadequate research and extension capacity, underdeveloped markets, and policy and institutional constraints."},{"index":3,"size":32,"text":"Through our Cereal and Legume Systems Program, we aim to generate research products and services that increase the productivity and commercialization of cereal and legume systems while preserving the natural resource base."},{"index":4,"size":11,"text":"Women making their way to the market with their cowpea produce."},{"index":5,"size":5,"text":"Photo by S Muranaka, IITA."}]},{"head":"Pushing back against the violet vampire","index":26,"paragraphs":[{"index":1,"size":50,"text":"Together with our partners in Nigeria and Kenya, we have begun a major push against parasitic weed that have spread across much of sub-Saharan Africa, wreaking havoc of up to US$ 1.2 billion in damage every year to the maize and cowpea crops of tens of millions of smallholder farmers."},{"index":2,"size":52,"text":"Through a project, we are introducing proven technologies for fighting Striga -also called \"witchweed\" -and Alectra. Also known as the \"violet vampire\" because of the bright purple flower it produces, Striga attaches itself to the roots of crops such as maize and cowpea, sucking out nutrients, reducing yields, and destroying entire harvests."},{"index":3,"size":81,"text":"Witchweed primarily affects smallholder farmers who can't afford costly herbicides for fighting the parasitic plant. supported by a US$ 6.75 million grant from the Bill & Melinda Gates Foundation to IITA. Its goal is to help 200,000 maize farmers and 50,000 cowpea farmers in areas with high rates of Striga infestation in Kenya and Nigeria. By project's end in 2014, we estimate that over 250,000 individual farmers will see up to 50% higher maize yields and double their current cowpea yields."},{"index":4,"size":82,"text":"The four-year project will focus on improving and expanding access to methods of Striga control, while supporting research to identify the most effective means of controlling the parasitic weed under varying conditions. It will evaluate and implement four approaches: using Striga-resistant crop varieties; using a \"push-pull\" technology that involves intercropping with specific forage legumes that inhibit the germination of Striga; using herbicidecoated seeds; and deploying biocontrol of Striga. After a two-year evaluation period, the project will scale up the most effective approaches."},{"index":5,"size":97,"text":"Each of the approaches to control Striga holds promise, especially when two or more options are employed at the same time. For example, in West Africa, we have tested the combined use of Strigaresistant maize varieties in rotation with legumes that cause witchweed seeds to germinate but fail to latch on to the host. This approach increased crop productivity by an average of 88 percent. We will partner in this initiative with the International Maize and Wheat Improvement Center (CIMMYT), African Agricultural Technology Foundation (AATF), International Centre of Insect Physiology and Ecology (icipe), and BASF Crop Protection."},{"index":6,"size":45,"text":"We expect that the integrated witchweed control interventions will generate an estimated US$8.6 million worth of additional grain (maize and legumes) annually at the project locations-resulting in increased incomes, better nutrition, and reduced poverty, as well as employment opportunities from grain production to food markets."}]},{"head":"New maize and soybean varieties hold promise for African farmers","index":27,"paragraphs":[{"index":1,"size":25,"text":"Smallholder farmers in Malawi and Nigeria are celebrating the release of new soybean and maize varieties that are offering hope of better incomes and livelihoods."}]},{"head":"New soybean in Malawi","index":28,"paragraphs":[{"index":1,"size":30,"text":"The Malawi Agricultural Technology Clearing Committee (ATCC) in January 2011 officially approved the release of the improved variety dubbed TGx1740-2F. We developed the variety through our Tropical Legumes II project."},{"index":2,"size":59,"text":"In on-station and on-farm trials, TGx1740-2F outperformed local varieties grown in the country, giving a mean grain yield of 2,464 kg/ha. Pre-release production data showed that the new variety exceeded the yields of the varieties Nasoko and the widely grown promiscuous variety Magoye, which were used as checks, by 10% and 32%, respectively, during the two-year multilocation station trials."},{"index":3,"size":52,"text":"TGx1740-2F performed equally well during on-farm participatory variety selection trials in four districts of central Malawi. In the 2009/10 season, it outperformed all the new types of soybean varieties under testing, giving 2,248 kg of grains per hectare. Again, it also surpassed yields by Nasoko and Magoye by 15% and 38%, respectively."},{"index":4,"size":29,"text":"This new variety matures early, has more pods per plant up to the top of the plant, performs well under poor and erratic rainfall, and has better lodging resistance."}]},{"head":"A Malawi soybean farmer tending to her young crop.","index":29,"paragraphs":[{"index":1,"size":5,"text":"Photo by JT Oliver, IITA."},{"index":2,"size":44,"text":"The release of TGx1740-2F is considered a milestone for IITA as this is the first time that a promiscuous soybean variety -one that is able to nodulate effectively with diverse indigenous Rhizobia in the soil -developed by the institute has been released in Malawi."}]},{"head":"Quality protein and drought-tolerant maize varieties in Nigeria","index":30,"paragraphs":[{"index":1,"size":56,"text":"Maize production in Nigeria got a much needed boost as the national government approved the release of five new maize varieties. In addition to having high nutritive content and tolerance to drought, the new varieties also offer good resistance to diseases and pests such as parasitic weeds and maize streak, mature early, and give high yields."},{"index":2,"size":20,"text":"Drying maize. The newly released varieties offer new hope for farmers and processors in Nigeria. Photo by JT Oliver, IITA."},{"index":3,"size":76,"text":"In December 2011, the Nigeria Variety Release Committee officially approved the release of SAMMAZ 32, SAMMAZ 33, SAMMAZ 34, SAMMAZ 35, and SAMMAZ 37. The first four varieties are extra early-maturing varieties, while SAMMAZ 37 is an intermediate-maturing quality protein maize (QPM) variety. The varieties were developed by the Institute for Agricultural Research at Samaru in collaboration with our breeders. They are products of conventional breeding that incorporated high-lysine gene into adapted populations of selected lines."},{"index":4,"size":41,"text":"SAMMAZ 32, SAMMAZ 33, SAMMAZ 34, and SAMMAZ 35 have good levels of resistance to Striga hermonthica and maize streak virus, high tryptophan content, mature in 80 to 85 days, and have yield potentials of 3.5 to 4.5 tons per hectare."},{"index":5,"size":36,"text":"SAMMAZ 37, on the other hand, is a yellow endosperm variety that matures in 115 days, has good resistance to the maize streak virus, high tryptophan content, and a potential yield of 5.9 tons per hectare."}]},{"head":"Drought-tolerant maize critical to food production in West Africa -Study","index":31,"paragraphs":[{"index":1,"size":47,"text":"A research study has proven what most people have always known but are not saying out loud: access to improved seeds by smallholder farmers is a vital prerequisite to significantly increase maize production in West Africa in light of climate change and floundering yields of traditional varieties."},{"index":2,"size":33,"text":"The study was conducted by researchers working on the Drought Tolerant Maize for Africa Project (DTMA) implemented by the International Maize and Wheat Improvement Center (known by its Spanish acronym CIMMYT) and IITA."},{"index":3,"size":64,"text":"Tahirou Abdoulaye, IITA Impact Socioeconomist and lead researcher of the study team, notes that improved maize varieties tolerant of drought are helping farmers in addressing production risks and called for joint efforts to facilitate their wider dissemination across sub-Saharan Africa (SSA). The DTMA Project is helping farmers in cushioning the negative effect of drought by developing and disseminating maize with significantly improved drought tolerance."},{"index":4,"size":63,"text":"The study also highlighted the importance of seed companies in the dissemination of quality seeds. It found that although the number of seed companies in West Africa has more than doubled since 2007from about 10 established companies to more than 22 currently in the four DTMA participating West African countries of Nigeria, Benin, Mali, and Ghana -their combined production is still below demand."},{"index":5,"size":31,"text":"For instance, the total production of improved maize seeds in those countries stands at about less than 15,000 metric tons while more than 80,000 metric tons are required for Nigeria alone."},{"index":6,"size":37,"text":"Based on the findings of the study, Abdoulaye is urging governments in the region to tackle the challenge of poor irrigation to pave the way for yearround production of improved seeds to accelerate availability and meet demand."},{"index":7,"size":37,"text":"While he commended member countries for adopting fairly liberal seed laws, Abdoulaye advised that the Economic Community of West African States must step up efforts that would see the full implementation of the harmonized regional seed law."},{"index":8,"size":41,"text":"\"This will help countries that are lagging behind, as improved drought-tolerant maize varieties will move freely across the region,\" he says. \"It is equally important for governments in the region to help seed companies gain access to working capital,\" Abdoulaye added."},{"index":9,"size":81,"text":"Consumed by more than 650 million people in SSA, maize productivity in recent years has been severely threatened by frequent droughts and irregular rainfall. In 2011 alone, more than 12.5 million people suffered the effects of drought -the worst in 60 years -and resulting famines in the Horn of Africa. In West and Central Africa, more than 35 percent of the area under maize is affected by drought as nearly the entire crop is grown without irrigation, relying solely on precipitation."},{"index":10,"size":15,"text":"A woman farmer gathering some of her droughttolerant maize harvest. Photo by J Atehnkeng, IITA."}]},{"head":"Horticulture and Tree Systems","index":32,"paragraphs":[{"index":1,"size":51,"text":"Fruits, vegetables, and tree crops present an ideal opportunity for poor African farmers to derive additional income through crop diversification, which results in better use of available land, water and labor resources. However, the potential of these crops cannot be realized fully because African farmers face a wide range of constraints."},{"index":2,"size":54,"text":"Through our Horticulture and Tree Systems Program, we aim to to improve the productivity of fruits, vegetable, and tree crops by diversifying the existing staple cropping systems to give resourcepoor farmers an opportunity to generate more income from exports and value addition. These crops also provide food and nutritional security for producers and consumers."}]},{"head":"The legacy of the Sustainable Tree Crops Program","index":33,"paragraphs":[{"index":1,"size":29,"text":"This year, our Sustainable Tree Crops Program (STCP) came to an official close after two phases and almost 10 years of helping cocoa farmers in West and Central Africa."},{"index":2,"size":51,"text":"We established STCP in November 2002 in response to the growing challenges in the tree crops sector, particularly of cocoa, cashew, and coffee, in the region. The program was supported by the United States Agency for International Development (USAID) and the World Cocoa Foundation (WCF) and its global chocolate industry members."},{"index":3,"size":27,"text":"STCP was a public-private partnership and an innovation platform that enhanced productivity through innovations, increased marketing efficiency, diversified farmer income, and strengthened the institutional and policy environment."},{"index":4,"size":56,"text":"STCP began as a three-year pilot program covering Cameroon, Cote d'Ivoire, Ghana, Guinea, and Nigeria. Following the successful completion of the pilot phase, we launched STCP Phase 2 in 2007 at the recommendation of an external review committee and expanding its scope to include marketing, production, and institutional innovations. Liberia was brought on board replacing Guinea."},{"index":5,"size":15,"text":"Since its inception, STCP has worked to bring cocoa back into the global development spotlight."},{"index":6,"size":17,"text":"The following summarizes the highlights of the program's achievements during its second phase from 2007 to 2011."}]},{"head":"Building capacities, enriching lives","index":34,"paragraphs":[{"index":1,"size":64,"text":"By the end of its Phase 2 run, STCP has trained more than 100,000 farmers, extension workers, and facilitators in the five participating countries in integrated crop and pest management and quality (ICPM/Q), planting, replanting and diversification (PRD), and occupational health and safety (OHS). STCP carried out training through its innovative Farmer Field Schools (FFS)/ Farmer Learning Groups (FLG) and Video Viewing Clubs (VVC)."},{"index":2,"size":26,"text":"Training in selected communities were handled by facilitators identified from the same community and working with STCP participatory extension specialists (PES) and cocoa subject matter specialists."},{"index":3,"size":48,"text":"To significantly multiply its capacity building impact, STCP introduced an innovation called farmer-to-farmer diffusion, in which farmers directly trained by STCP were required to train two other farmers on topics that they learned. This arrangement was formalized in knowledge-sharing agreement signed by each direct trainee prior to training."}]},{"head":"A woman community facilitator leads discussions in the cocoa extension manual during a VVC session. Photo by Ambrose","index":35,"paragraphs":[{"index":1,"size":2,"text":"Dziwornu, IITA-STCP."},{"index":2,"size":33,"text":"STCP supported each direct and indirect trainee with training and extension materials. The highly illustrated manuals were used during and after the training to reinforce learning and adoption of skills among the farmerparticipants."},{"index":3,"size":30,"text":"To follow up on its training activities, STCP held field days for primary and secondary knowledge recipients of FFS, during which PES conducted short refresher courses on various cocoa-production topics."},{"index":4,"size":26,"text":"STCP tracked data about its training activities through a monitoring and evaluation (M&E) database. Related information can be easily retrieved from the database for impact analysis."},{"index":5,"size":27,"text":"Aside from cocoa farmers, STCP also trained staff of industry partners and government agricultural extension agencies, and provided technical support and backstopping for their own training activities."}]},{"head":"Innovating for development","index":36,"paragraphs":[{"index":1,"size":31,"text":"During its run, STCP initiated innovative approaches and platforms in West and Central Africa aimed at making cocoa extension more effective and responsive to the needs of farmers in the subregion."}]},{"head":"An FFS session in progress with a farmer doing a presentation","index":37,"paragraphs":[{"index":1,"size":5,"text":"Photo by Ambrose Dziwornu, IITA-STCP."}]},{"head":"Farmer-to-Farmer Diffusion","index":38,"paragraphs":[{"index":1,"size":46,"text":"In West and Central Africa where cocoa farmers outnumber available extension resources, STCP introduced farmer-to-farmer diffusion to bridge the extension gap. In this approach, farmers directly trained by STCP were required to train two other farmers on cocoa production in return for the training they received."}]},{"head":"Video Viewing Clubs","index":39,"paragraphs":[{"index":1,"size":85,"text":"To address the perceived male dominance of the cocoa sectors in the participating countries, STCP established VVCs geared specifically to deliver extension and training on cocoa production to women farmers. Although originally conceptualized to cater to women, and largely because of the approach's effectiveness, male farmers were eventually allowed to join VVCs, but priority has always been given to women. evaluation of the VVC also showed that farmers who participated in the approach were likely to increase their yields by as much as 40 percent."},{"index":2,"size":42,"text":"Each enrolled farmer attended an average of 20 VVC sessions to complete training, with video viewing interspersed with practical field exercises to enforce learning. For the VVCs, STCP developed 11 technical videos on cocoa ICPM/Q. These videos are accessible from the Web."},{"index":3,"size":36,"text":"In 2008, the VVC approach was conferred the CGIAR Science Awards for Outstanding Communications, citing STCP \"for training farmers in West African countries use digital video as a way to share knowledge of sustainable cocoa production.\""}]},{"head":"Plant Material Brokerage System","index":40,"paragraphs":[{"index":1,"size":39,"text":"Through this approach, STCP assisted its trained farmers in procuring hybrid cocoa pods and seedlings for establishing nurseries or for direct planting on their fields, and in obtaining tree seeds/ seedlings that were integrated into old and new farms."},{"index":2,"size":46,"text":"During its second phase, STCP distributed about 15.53 million cocoa seedlings and more than 600,000 cocoa pods. In addition to cocoa planting materials, STCP also distributed cassava stems to cocoa farmers which were grown and used as temporary shade for cocoa stands and as food crop."},{"index":3,"size":66,"text":"The program also established two Cocoa Production System Planting Material Resource Centers in Ghana. Conceived under the Cocoa Sector Support Program (CSSP) Phase II -a bilateral project of STCP-the centers served as the first of its kind one-stop source points for cocoa planting materials and other crops used in cocoa production systems. The centers also offer extension and training services for cocoa farmers through technical videos."},{"index":4,"size":108,"text":"Research at the core, research for the common good STCP's research studies and findings are treated as global public goods and therefore could be freely accessed, used, and shared with stakeholders and partners. These findings and results have been presented in numerous international conferences and seminars by IITA and STCP staff and could be accessed from the IITA (www.iita.org) and STCP (http://liferay.iita.org/web/stcp/home) Web sites. Throughout its second phase, STCP produced and disseminated 13 journal articles, 13 working papers, 25 training manuals, 2 policy briefs, 1 impact brief, and a number of newsletters, technical articles, and press releases. The program also conducted about 20 scientific studies and impact assessments."},{"index":5,"size":72,"text":"Hand-in-hand with partners for impact STCP Phase 2 simultaneously operated with existing bilateral projects of partners within its operational countries. These included, among others, the Cocoa Livelihoods Program (CLP) sponsored by the World Cocoa Foundation (WCF); CSSP funded by the European Union; and the Mars Partnership for African Cocoa Communities of Tomorrow (iMPACT) funded by Mars Chocolate, Inc. Working with these partners and complementing existing similar projects significantly boosted STCP's own impact."}]},{"head":"The international development broker","index":41,"paragraphs":[{"index":1,"size":68,"text":"In 2011, STCP, working with the Ghana Cocoa Board, facilitated the development and finalization of an agreement between the governments of Ghana and the Republic of Liberia to jointly develop, promote, and implement research activities to improve their respective agricultural sectors. The agreement was officially sealed with the signing of a Memorandum of Understanding by high-level officials of the two countries during the early part of the year."}]},{"head":"Helping smallholder farmers in Africa adapt to an evolving agricultural landscape","index":42,"paragraphs":[{"index":1,"size":35,"text":"This year, we continued with initiatives that help smallholder farmers and other stakeholders cope to an ever-changing agricultural landscape by providing science-based knowledge, assessing the environment, and documenting impact to support scaling-up of effective interventions."}]},{"head":"Managing and disseminating information on African crops","index":43,"paragraphs":[{"index":1,"size":83,"text":"In 2011, we made significant progress toward setting up the online AgriSTAT database of the African food crops that we work on. With the database's user interface now completed, specific datasets can be queried and retrieved in standard MS Excel format. We are now focusing on uploading and editing timeseries and cross-sectional data on crop production, harvested area, and yield per hectare; prices of crops and crop products; modern or improved varieties of our core research crops; rainfall data; and various development indicators."},{"index":2,"size":87,"text":"We also developed and disseminated a tworeport series on cowpeas and yams entitled \"World Cowpea Economy: Facts, Trends, and Outlook\" and \"World Yam Economy: Facts, Trends, and Outlook\", as well as another document focusing on legumes titled \"Tropical Legumes in Africa and South Asia: Trends, Outlook, and Opportunities\". The reports paint a regional and global picture of the economics of cowpea, yam, and legumes and provide up-todate information for stakeholders engaged in the production, processing, and marketing of the crops to help them make informed investment decisions."}]},{"head":"Assessing the agricultural landscape","index":44,"paragraphs":[{"index":1,"size":107,"text":"We conducted rapid value chain assessment surveys in the eight countries participating in the \"Putting Nitrogen Fixation to Work for Smallholder Farmers in Africa\" project that we are implementing. These include the Democratic Republic of the Congo (South Kivu), Ghana, Kenya, Malawi, Mozambique, Nigeria, Rwanda, and Zimbabwe. The surveys evaluated local, national, and global forces that are driving changes in grain legume systems such as common beans, cowpeas, groundnuts, and soybeans in these countries. The aim is to identify opportunities and constraints for grain legumebased economic growth, so that research areas can be prioritized and resources allocated to areas that will give the most return on investment."},{"index":2,"size":15,"text":"A project participant helping gather groundnut samples for yield analysis. Photo by J Atehnkeng, IITA."},{"index":3,"size":33,"text":"Evidence\"; production of the \"IITA Social Science Research Agenda for the Next Decade\"; and the completion of the PhD thesis by Djana Mignouna on the adoption and impact of IR-Maize in western Kenya."},{"index":4,"size":112,"text":"We also completed a survey of the adoption and socioeconomic impact of cassava integrated pest management technologies in Cameroon involving 320 respondents from the four regions of the country. Results of this survey are being compared with similar surveys conducted in Central and Northern Benin. Initial analysis of the comparative data showed remarkable gender-based differentiation of cultivation and transformation strategies by country and region. Additionally, respondents in all the countries surveyed identified the lack of a formal network for the distribution of pest-resistant varieties as a common problem. We conducted a similar study on CIALCA technologies in Rwanda, Burundi, and Eastern DRC, the results of which are still being compiled and analyzed."},{"index":5,"size":29,"text":"A farmer spraying pesticide on his vegetable crop. We conducted surveys in Benin and Cameroon to determine the socioeconomic impact of IPM on smallholder growers. Photo by Arnstein Staverloekk."}]},{"head":"Former President Obasanjo named IITA Goodwill Ambassador","index":45,"paragraphs":[{"index":1,"size":39,"text":"Former President Olusegun Obasanjo has accepted IITA's offer to be the institute's 'Goodwill Ambassador,' in an effort to strengthen the fight against hunger and poverty in Africa. Director General Nteranya Sanginga announced Obasanjo's acceptance of the role in November."},{"index":2,"size":97,"text":"As Goodwill Ambassador, Obasanjo will help the institute in advocating for policies that would advance agricultural research and bring to reality the long-awaited African Green Revolution. He will extend and amplify the institute's vision and mission and help focus the world's attention on our R4D work in sub-Saharan Africa and, to some extent, other countries in the humid tropics. Obasanjo's role as Goodwill Ambassador is envisioned to boost our thrusts to improve the plight of some 20 million resource-poor smallholder farmers and assist in reviving 25 million hectares of degraded agricultural lands in the next 10 years."},{"index":3,"size":75,"text":"Born in March 1937, Obasanjo was the first Nigerian President to hand over to a democratically elected president -first as a military head of state in 1979, and second in 2007 as a civilian president. Under his watch, the country's growth rate doubled, its foreign reserves rose from US$2 billion to US$43 billion, and the nation became debt-free. In 2005, the international community gave the Nigerian government its first passing mark for its anticorruption efforts."},{"index":4,"size":47,"text":"In the agricultural sector, Obasanjo initiated the Presidential Initiatives on some of Nigeria's major commodities including cassava, maize, rice, and cocoa. His 10 percent cassava policy that mandated flour millers to include cassava flour in wheat boosted cassava production by 10 million tons between 2002 and 2008."},{"index":5,"size":35,"text":"As a result, Nigeria became the world's number one producer of cassava, while maize became a major cash and economic crop. Maize, rice, and cocoa yields in Nigeria also recorded substantial increases during Obasanjo's tenure."}]},{"head":"Yam farmers need not be poor: US$12 million landmark initiative to boost yam productivity in West Africa","index":46,"paragraphs":[{"index":1,"size":47,"text":"In one of the most ambitious efforts ever undertaken on behalf of a smallholder crop like yam, IITA and a host of partners have embarked on a groundbreaking initiative to dramatically boost yam productivity and double the incomes of more than three million farmers in West Africa."},{"index":2,"size":136,"text":"The five-year \"Yam Improvement for Income and Food Security in West Africa\" (YIIFSWA) project, which is supported by a US$12 million grant from the Bill & Melinda Gates Foundation, is being led by IITA in collaboration with the National Root Crops Research Institute (NRCRI) of Nigeria, the Crops Research Institute (CRI) of Ghana, the UK's Natural Yams provide the most important source of dietary calories in Nigeria and Ghana. And for many people in the region, they rank above meat as the main source of protein. Despite its food and economic potentials, the fate of yams hangs in the balance as a variety of factors have depressed yields to a mere 14 percent of potential harvests. But with additional investments, there is tremendous potential to rapidly boost yam production and the income derived from the crop."},{"index":3,"size":21,"text":"YIIFSWA will initially focus on 200,000 smallholder farm families in Ghana and Nigeria-90 percent of whom cultivate less than two hectares."},{"index":4,"size":113,"text":"A key priority is to ensure that affordable pest-and disease-free seed yams are available to farmers, along with storage and handling technologies that can reduce post-harvest loss. Yam breeders will develop and widely disseminate new, higher-yielding, disease-resistant varieties. The private sector partners will provide certified seed and help link smallholder farmers, particularly those in remote areas, With a potential rate of return of 78 percent, each dollar invested in yam research generates US$52 worth of additional food for the poor, relative to US$124 for all households. Additionally, creating an abundance of a locally produced nutritious staple like yams can provide insurance against crises sparked by a sudden, sharp rise in global food prices."},{"index":5,"size":104,"text":"A key goal of the YIIFSWA project is to improve not just yield and outputs in the field but also to enhance market access for smallholder farmers. Although smallholder farmers cultivate the majority of yams in the region, our findings show that those benefiting from the domestic, regional and global market for yams are mainly medium to large-scale producers. A combination of higher yields in the fields, reduced production costs through improved seed tuber supply, and better market access for smallholder growers will not only improve incomes for farmers, but also increase the affordability and consumption of yams in both rural and urban areas."},{"index":6,"size":47,"text":"Work by the UK's Department for International Development (DFID) -a long-time partner to IITA's yam research -has shown that there is a significant potential for YIIFSWA to attract private sector investment in the production of certified yam seed that are clean, healthy, available and much more affordable."},{"index":7,"size":84,"text":"For example, in different parts of Nigeria, anywhere from 66 to 97 percent of households desire to eat yams on a weekly basis. Yet the domestic price of yams is well above the reach of many such consumers, whose low income make them only able to afford to buy slices rather than whole tubers. In addition, there are lucrative export opportunities to meet the demand of West Africans living abroad. In 2011 alone, Nigeria exported some US$27.7 million worth of yams to the USA."}]},{"head":"Yams stored and marked ready for processing.","index":47,"paragraphs":[{"index":1,"size":5,"text":"Photo by H Kikuno, IITA."}]},{"head":"IITA cassava bread influences Nigeria cassava utilization policy","index":48,"paragraphs":[{"index":1,"size":33,"text":"His Excellency President Goodluck Jonathan of Nigeria has hinted that the country may soon have a new policy on bread content, following our successful development of bread that contains 40 percent cassava flour."},{"index":2,"size":64,"text":"Jonathan emphasized that achieving 40 percent cassava flour content in bread was indeed a major breakthrough. According to the Nigerian president, using 40 percent cassava flour to replace wheat flour in bread will save the country more than US$ 2 billion per year in wheat import payments, which could otherwise go towards improving the livelihoods of millions of Nigerian cassava farmers and their families."},{"index":3,"size":76,"text":"The president directed his ministers to come up with policies to encourage the increased use of cassava flour in the production of bread in the country after presenting the IITA-developed cassava Jonathan told the Ministers of Economy, National Planning, Trade and Investment, and Agriculture, and his Chief Economic Adviser to put their heads together and submit to him policies that the Nigerian government could implement to encourage those who use cassava flour for their manufacturing processes."},{"index":4,"size":47,"text":"\"For us as a nation to move forward, we need to tame our taste for exotic products. Some of the things we bring from outside are not even as good as what we have right here in our country,\" the president emphasized as he lauded the product."},{"index":5,"size":26,"text":"Jonathan said that after he sampled the IITAdeveloped bread, he told himself that it will be the only bread that he would eat from now on."},{"index":6,"size":91,"text":"The president explained that efforts to incorporate cassava flour in bread was initiated by the administration of former President Olusegun Obasanjo, who decreed that bakers put in at least 10 percent cassava flour in the breads they make, largely because of the rising cost of wheat in the international market. Akinwumi Adesina, Nigeria's Minister of Agriculture and Rural Development said that the IITA-developed cassava bread \"will create a lot of jobs, spur markets for our farmers, stabilize prices, and give us pride in the fact that we eat what we produce\"."},{"index":7,"size":28,"text":"He added that the IITA initiative fits perfectly within the government's Agriculture Transformation Agenda aimed at developing the agricultural sector and increasing its share to the country's GDP."},{"index":8,"size":42,"text":"The minister also noted that although Nigeria was the world's top producer of cassava roots, producing 34 million tons annually, the country accounted for zero percent in terms of added value which is unfortunate given the vast potential of the root crop."}]},{"head":"Mounds of cassava flour","index":49,"paragraphs":[{"index":1,"size":32,"text":"for sale in a rural market. An expanded national policy on the use of cassava flour in bread will further spur the development of the cassava sector. Photo by O Adebayo, IITA."}]},{"head":"Integrated Pest Management (CGIAR Systemwide Program)","index":50,"paragraphs":[{"index":1,"size":132,"text":"The CGIAR Systemwide Program on Integrated Pest Management (SP-IPM) is a global partnership program that aims to: (1) tackle those areas where research promises to provide solutions to pressing problems in sustainable agricultural development but where impact has so far been limited, usually due to fragmentation of efforts or inadequate links between researchers and farmers; (2) address new challenges posed by the fast growing demand for safe and affordable food under difficult circumstances caused by climate change and variability; (3) draw together the IPM efforts of the international agricultural research centers and their partners and to focus these efforts more clearly on the needs of resource-poor farmers in the developing world; and (4) comparatively analyze different institutional experiences that will result in common lessons, methods, tools and services to guide collective action."}]},{"head":"SP-IPM: heeding the call for global plant health management","index":51,"paragraphs":[{"index":1,"size":46,"text":"This year, the SP-IPM program that we coordinate participated in high profile events that raised awareness on the importance of integrated pest management, as well as successfully lobbied for new projects that will help smallholder growers in sub-Saharan Africa battle pests and diseases that hinder production."}]},{"head":"SP-IPM at the XVII International Plant Protection Congress","index":52,"paragraphs":[{"index":1,"size":99,"text":"Every four years, the International Association for Plant Protection Sciences (IAPPS) organizes the International Plant Protection Congress (IPPC), an event in which SP-IPM showcases its achievements in collaborative crop health management research undertaken by its member centers. In 2011, the XVII IPPC was held in cooperation with the American Phytopathological Society (APS) in Honolulu, Hawaii from 6 to 10 August. The SP-IPM Coordinator actively participated in the preparations for the event as a member of the organizing committee at the request of IAPPS. economic development, and trade opportunities. The presentations are available from the SP-IPM Web site at www.spipm.cgiar.org."},{"index":2,"size":40,"text":"The highly successful and well-attended SP-IPM special session was also one of the few symposia during the congress that had a clear focus on plant protection issues in developing countries. The symposium was moderated by Richard Sikora, Chair of SP-IPM."}]},{"head":"IPM Workshop for the Feed-the-Future Initiative","index":53,"paragraphs":[{"index":1,"size":49,"text":"At the same event, SP-IPM, together with the IAPPS Secretariat and the IPM Collaborative Research Support Program on IPM (IPM-CRSP), organized a workshop on \"IPM for the Feed-the-Future Initiative\" that reviewed the plant protection activities of different international agencies as well as chart the way forward in this area."},{"index":2,"size":40,"text":"The workshop produced a nine-point agenda to enhance the impact of the Feed-the-Future (FTF) initiative, which are also are applicable in similar agricultural programs funded by international donor agencies worldwide. These recommendations can be downloaded from the SP-IPM Web site."}]},{"head":"SP-IPM staff meeting","index":54,"paragraphs":[{"index":1,"size":82,"text":"During the congress, the SP-IPM Secretariat held a program meeting to take advantage of the attendance of SP-IPM staff at the event and in lieu of a Steering Committee meeting for the year. Participants extensively reviewed the achievements of the program for the past three years starting when the Chairman and Coordinator joined the Secretariat. SP-IPM staff also discussed about the future of the group in light of the new CGIAR Consortium Research Programs (CRPs) and the close of some system-wide initiatives."},{"index":2,"size":50,"text":"The group agreed that a structure is needed for inter-disciplinary networking, maintaining the identity of the IPM research area within the CRPs, and to lobby for further investment in IPM-related research. Proposals have been forwarded on how this organization might look like to the Chair and Coordinator for their consideration."}]},{"head":"New projects: implementing the SP-IPM research framework","index":55,"paragraphs":[{"index":1,"size":50,"text":"This year has been another successful one for SP-IPM in terms of research proposals submitted to donors. SP-IPM proposals are developed by multiple member centers but submitted by only one on behalf of the others to encourage and enhance collaboration. These proposals complement on-going research of the individual member centers."},{"index":2,"size":32,"text":"In 2011, we initiated two new projects funded by the German Government through the Federal Ministry of Economic Cooperation and Development (BMZ) (see box below). Each project will run for three years."}]},{"head":"New projects on the ground in 2011","index":56,"paragraphs":[{"index":1,"size":61,"text":"Enhancing horticultural productivity, incomes and livelihoods through integrated management of aphid pests on vegetables in sub-Saharan Africa This project will develop and implement ecologicaland biological-based pest management options to reduce losses due to aphid infestations on okra, cabbage, and kale in sub-Saharan Africa, and build the capacities of NARS partners and farmers in the use of non-chemical alternatives to synthetic pesticides."},{"index":2,"size":77,"text":"Overview: The melon/cotton aphid, Aphis gossypii is the main aphid that infests okra; while the cabbage aphid, Brevicoryne brassicae, and the turnip aphid, Lipaphis pseudobrassicae, are the predominant aphids of cabbage and kale, with the former being dominant in mid-altitudes while the latter is found largely in lowaltitudes. Based on available knowledge, collectively these aphids can cause large losses in the yield and quality of their respective host crops through direct damage and transmission of viral diseases."},{"index":3,"size":36,"text":"To combat these pests, growers apply large amounts of synthetic pesticides with little consideration for crop contamination, human and environmental effects, and the other negative consequences such as the disruption of naturally occurring biological control agents."},{"index":4,"size":37,"text":"The project determines the level and dynamics of aphid infestations and the diversity and prevalence of aphid-transmitted viruses and their damage on the targeted crops as well as the diversity and impact of predators, parasites and pathogens."},{"index":5,"size":41,"text":"Appropriate user-friendly identification and monitoring tools are being developed and windows of opportunities for intervention are being identified. Detailed evaluation of promising natural enemies will be carried out and possibly new natural enemies or new strains introduced to complement existing ones."},{"index":6,"size":25,"text":"Conservation biocontrol and biopesticides and natural products as alternatives to chemical pesticides will be tested and promoted. Aphid-tolerant/resistant varieties will also be identified and promoted."},{"index":7,"size":33,"text":"Training and awareness building are being carried out to enhance appreciation of non-chemical alternatives and the adoption of recommended practices among NARS and farmers. Educational materials are being developed and used for training."},{"index":8,"size":14,"text":"Participating countries: Kenya and Cameroon Funding: BMZ (€1.2M) Implementing SP-IPM members: IITA, AVRDC, icipe"}]},{"head":"Combating fruit flies and mango seed weevil through community-based implementation of a sustainable IPM program for mango in sub-Saharan Africa","index":57,"paragraphs":[{"index":1,"size":98,"text":"Locally grown fruits such as mangoes are well recognized as an important source of income and foreign exchange in Africa. Over 80 percent of fruits and vegetable production is carried out by smallholders for both urban domestic and export markets of which the EU is the major export destination and the USA is an emerging market. Several factors, however, constrain fruit production such as tephritid fruit flies (e.g. Bactrocera invadens and Ceratitis cosyra) and mango seed weevil (MSW) (Sternochetus mangiferae) that damage fruits and cause 40 to 80 percent yield loss depending on the locality, variety, and season."},{"index":2,"size":26,"text":"Pest infestations not only reduce revenues and profits from local and export markets, but they also cause increasingly high production costs for smallholder growers and traders."},{"index":3,"size":38,"text":"The project will implement IPM programs for the management of fruit flies and MSW that are based on protein baits, male annihilation technique (MAT), fungus-based biopesticides, biological control (e.g., parasitoids and weaver ants), \"soft\" pesticides, and orchard sanitation."},{"index":4,"size":59,"text":"These methods have been proven to be effective in managing the target pests and minimizing the use of pesticides that leave unwanted residues, thereby facilitating compliance with standards required for export markets. In addition to these pre-harvest measures, hot water-based postharvest treatments for fruit flies will be developed and promoted to facilitate quarantine certification often demanded by export markets."},{"index":5,"size":38,"text":"The project builds on the completed first phase of a mango IPM project funded by BMZ, which generated relevant knowledge base and the management methods for fruit flies and MSW mentioned above that are now ready for implementation."},{"index":6,"size":143,"text":"Participating countries: Kenya and Tanzania Funding: BMZ (€1.2M) Implementing SP-IPM members: icipe, IITA Also in 2011, BMZ approved four new projects that will start in early 2012. These are: \"Local Focus: safe and effective pest and crop management strategies to strengthen the vegetable value chain in the humid tropics\", which we will lead and implement in collaboration with AVRDC and other partners; \"Beating Begomoviruses: Better livelihoods for farmers in tropical Asia with begomovirus-resistant tomato, hot pepper and mungbean, and integrated disease management\", which will complement the latter project and will be implemented by AVRDC in India, Vietnam, and Thailand; \"Implementation of integrated thrips and tospovirus management strategies in smallholder vegetable cropping systems of Eastern Africa\", which will be conducted by icipe with AVRDC; and \"Cost effective, farmer-and environment-friendly biocontrol of aflatoxin in chili peppers (Capsicum spp.)\", that we will carry out in Nigeria."},{"index":7,"size":20,"text":"Chili pepper for sale.One of SP-IPM's new projects will tackle aflatoxin in this \"hot\" vegetable. Photo by JT Oliver, IITA. "}]},{"head":"Financial Information","index":58,"paragraphs":[]},{"head":"Funding overview","index":59,"paragraphs":[{"index":1,"size":44,"text":"Funding for 2011 was US$47.427 million, of which 98.8% came from CGIAR investors and 1.2% from other sources. Expenditure was US$46.71million (net of indirect costs recovery of US$4.478 million), of which 85.2% was used for program expenses and 14.8% for management and general expenses."},{"index":2,"size":53,"text":"The governments and agencies that provided the largest share of our funding in 2010 and 2011 are shown in Figure 1, while IITA`s 2010 and 2011 expenditures by program and CGIAR system priorities are shown in Figures 2 and 3, respectively. Performance indicators, as prescribed by the CGIAR, are reflected in Figure 4.   "}]}],"figures":[{"text":"ii Photo by Arnstein Staverløkk, Bioforsk. "},{"text":" The project in Senegal is funded by AATF and works with Direction de la Protection des Végétaux, Université Gaston Berger, St. Louis, and the USDA-ARS. The Burkina Faso project is funded by the Austrian Development Agency and involves the Institut de l'Environnement et de Recherches Agricoles, Vienna University of Technology, and USDA-ARS. "},{"text":" Banana and plantain is the fourth most important staple in sub-SaharanAfrica. Photo by JT Oliver, IITA. "},{"text":" of the role of IITA Ambassador. Photo by C Ono Raphael, IITA. "},{"text":" the minister's visit to IITA-Ibadan to see the production of the cassava bread. Photo by O Adebayo, IITA. "},{"text":"Figure 1 . Figure 1. Funding: Top 10 donors, 2010 and 2011 "},{"text":"Figure 3 . Figure 3. Expenditure by CGIAR System Priority: 2010 and 2011 "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" The best 6-8 ensure that they  ensure that they are not harmful to  are not harmful to humans or animals  humans or animals in any way.  in any way. Local  Local commercial  commercial varieties are  varieties are extremely difficult  extremely difficult to improve through  to improve through conventional  conventional breeding because  breeding because they do not  they do not produce seeds and  produce seeds and are sterile, while  are sterile, while BXW-resistant Banana BXW-resistantBanana transgenic bunches transgenicbunches banana plants showing banana plantsshowing in the confined advanced and in the confinedadvanced and field trials in mid-stages of field trials inmid-stages of Uganda. Photo infection by Uganda. Photoinfection by by L Tripathi, IITA. BXW. Photo by P van Asten, lines will be further tested IITA. by L Tripathi, IITA.BXW. Photo by P van Asten, lines will be further tested IITA.  in multi- in multi-  location trials location trials  across the across the  country. country.  We are also We are also  conducting conducting  environmental environmental  and food and food  safety studies safety studies  such as such as  digestibility digestibility  analyses to analyses to  "}],"sieverID":"4b8aebe3-3eaa-4e09-8610-ae389c2e4314","abstract":"Cover photo: Women farmers of Jalino community in Borno State, Nigeria during a participatory appraisal exercise. Through our R4D initiatives and with partners, we promote the active participation of women in planning and decision making in agriculture especially in the rural areas."}

data/part_3/0c3aada56cb30b3f14633e89039f9c5b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0c3aada56cb30b3f14633e89039f9c5b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e1b705cc-ded0-4963-b86b-8e80aec4d0d3/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":53,"text":"In Burkina Faso, seven Decentralized Vine Multipliers (DVMs) and six Agriculture Extension Officers have been identified, trained, and provided starter vines in 2019 to ensure enough vines are available for supply to beneficiary households later this year. In Sierra Leone, collaboration with the National Program, the variety \"Mathuthu\" has been recommended for release."}]},{"head":"What is the problem?","index":2,"paragraphs":[{"index":1,"size":79,"text":"Inadequate consumption of nutrient-rich foods is one of the major risk factors for malnutrition in most communities. For some families in Africa, there is limited access to these foods because of inability to produce enough on own plots, unavailability of such foods in local markets and/or lack of economic ability to purchase these foods. Moreover, limited knowledge on the importance of consuming nutritious diets, sub-optimal feeding and hygiene behaviors and negative gender norms do compromise intake of nutritious diets."}]},{"head":"What do we want to achieve?","index":3,"paragraphs":[{"index":1,"size":74,"text":"In Burkina Faso, Nigeria and Sierra Leone, Helen Keller International (HKI) is working to improve diets of most families by promoting locally adapted varieties of OFSP alongside other crops, within HKI's signature Enhanced Homestead Food Production (EHFP) program, an integrated nutrition-sensitive agriculture intervention. The OFSP intervention is supported by the Hemsley Foundation in Burkina Faso, Mondelez International Foundation in Nigeria and by Irish Aid in Sierra Leone. The specific objectives of these interventions include:"},{"index":2,"size":15,"text":"• Increasing the production and consumption of OFSP and other nutritious crops at household level;"},{"index":3,"size":12,"text":"• Improving nutrition and hygiene behaviors, especially of pregnant and lactating mothers;"},{"index":4,"size":11,"text":"• Increasing women's involvement in household decision-making and access to resources;"},{"index":5,"size":15,"text":"• Increasing income, particularly of women, through the sale of surplus produce and other activities;"},{"index":6,"size":17,"text":"• Engaging students in the production and consumption of OFSP, nutritious diets and adopting a healthy lifestyle."}]},{"head":"How are we making it happen?","index":4,"paragraphs":[{"index":1,"size":46,"text":"HKI's EHFP program, which includes OFSP, is implemented around 3 core pillars, as: i) Production of diverse foods at the homestead and on group plots; ii) Social Behavior Change Communication (SBCC) on Essential Nutrition Actions (ENA) and Essential Hygiene Actions (EHA); and iii) Gender Empowerment activities."},{"index":2,"size":4,"text":"Key OFSP-related activities include:"},{"index":3,"size":32,"text":"• Establishing beneficiary women's groups or mother support groups at the community level and using these as platforms to distribute OFSP vines vines and promote infant and young child feeding (IYCF) practices."},{"index":4,"size":8,"text":"• Training of families on improved agronomic practices;"},{"index":5,"size":35,"text":"• Facilitating farmers' access to vines of improved, locally adapted OFSP varieties by supporting the establishment of DVMs at the community level and strengthening links between DVMs, beneficiary families and families and Crop Breeding Institutes;"},{"index":6,"size":34,"text":"• Integrating OFSP into village model farms, group gardens and homestead gardens. • Creating income generating opportunities for women, including trainings for processing OFSP (Fig. 2) and establishing Savings and Internal Lending Communities (SILC)."},{"index":7,"size":24,"text":"• Conducting SBCC and gender trainings and activities to improve behaviors for better nutrition and hygiene, as well as address social and gender norms."},{"index":8,"size":28,"text":"• Building capacity of frontline workers, including agriculture extension and community health workers, and in the case of school-based programs, teachers, to provide continuous support to beneficiary families."},{"index":9,"size":20,"text":"• Establishing school-based young farmer clubs to engage students in OFSP production, processing and consumption, and and holding OFSP-focused events."},{"index":10,"size":22,"text":"• Introducing \"smart\" farming techniques, including cultivating OFSP in recycled containers, tires and sandbags in urban areas with limited access to land."}]},{"head":"Where we are working?","index":5,"paragraphs":[{"index":1,"size":72,"text":"In Burkina Faso, HKI is presently implementing OFSP intervention across 60 villages in Sissili province, under the \"Yazourawonduoi\" project. Under HKI's led Nutrition Lifestyle Project in Nigeria, OFSP has been promoted across 9 schools (focusing on pupils aged 6-11 years) in urban areas of Ikeja, Ojudu and Onigbongbo Local Councils of Lagos State. In Sierra Leone, HKI's OFSP intervention is scaled-up in communities across 13 of the 14 districts in the country."}]},{"head":"What have we achieved so far?","index":6,"paragraphs":[{"index":1,"size":91,"text":"The EHFP project in Burkina Faso started in March 2019. So far, HKI has worked with government and other implementing partners to select the intervention communities, hire staff and conducted trainings to get the implementation underway. To date, seven DVMs and six agriculture extension officers have been identified and trained. About 23,700 vines have been provided to the seven DVMs to begin vine multiplication to ensure enough vines are available for supply to beneficiary households. The intervention is targeted to 8,000 families (or 56,000 individuals) who will benefit from OFSP production."},{"index":2,"size":81,"text":"The Healthy Lifestyle Project in Nigeria is a three-year project that started in January 2018. Under this project, HKI has worked to create awareness about the nutritional quality of OFSP which has led to uptake of the crop among 4,882 students and their families in urban communities of Ikeja, Lagos State. In addition, school gardens have been established across all nine schools for students to grow OFSP. Young Farmer clubs have also been established in all schools to promote OFSP adoption."},{"index":3,"size":87,"text":"In Sierra Leone, HKI has worked with the Sierra Leone Agriculture Research Institute (SLARI) to realize complete varietal evaluation of six genotypes of OFSP. Overall, the \"Mathuthu\" variety outperformed all the other five genotypes and has been recommended to the National Seed Board of for official release for cultivation across Sierra Leone. HKI is using this variety in our programs across 13 districts of the country and has also achieved the integration of OFSP into the national School Feeding Programme, to help address short-term hunger and malnutrition."}]},{"head":"What's next?","index":7,"paragraphs":[{"index":1,"size":31,"text":"HKI's proposed next steps in Burkina Faso include trainings of beneficiary women on OFSP production and postharvest handling, securing community plots for group gardening, trainings and activities on SBCC and gender."},{"index":2,"size":24,"text":"The Nigeria program will continue on-going activities. In addition, Home Garden Champions will be identified to support efforts of integrating OFSP into community gardens."},{"index":3,"size":36,"text":"In Sierra Leone, HKI will continue working with SLARI on crossing of OFSP varieties Kaphulira and Chipika with Mathuthu to increase the level of disease resistance. Activities similar to those outlined for Burkina Faso will continue. "}]}],"figures":[{"text":"The Healthy Lifestyle Project in Nigeria that started in January 2018 has worked to create awareness about the nutritional quality of Orange-fleshed Sweetpotato (OFSP), which has led to uptake of the crop among 4,882 students and their families in urban communities of Ikeja, Lagos State and school gardens established at nine schools (Fig. 1). "},{"text":"Fig 1 . Fig 1. Primary school children harvesting OFSP in Lagos Nigerian (Credit: B. Chima) "},{"text":"Fig 2 . Fig 2. Value addition training for rural farmers (Credit: H. Turay) "},{"text":" In Burkina Faso, HKI works with the government's Ministries of Health, Agriculture, Environment, Green Economy and Climate Change, Women, National Solidarity, Family, and Humanitarian Action, and Territorial Administration, Decentralization and Social Cohesion. Other partners on the project include National Institute for Agricultural Research (INERA); 2 NGOs: Medicus Mundi Italia / LVIA and Projecto Mundo, Professional Unions and Private Sector. HKI OFSP Project partners in Nigeria include the Ikeja Local Government Education Authority (LGEA) and Local Government Area Agriculture Department as well as the Lagos State Universal Basic Education Board (SUBEB), Ministry of Economic Planning & Budget (MEPB), Ministry of Agriculture and the Nutrition Department of Ministry of Health (SMoH). In addition, the Management Committees and Parent Forum Members (Parent Teacher Associations) of the schools as well as Community Development Associations.  "}],"sieverID":"b3a8ad9b-c440-4d72-94b8-378b4186a5af","abstract":""}

data/part_3/0c5d877335e4397417baaa9adc5cfb16.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0c5d877335e4397417baaa9adc5cfb16","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/4f981dd4-4c9f-4642-adff-98af0e661054/retrieve"},"pageCount":12,"title":"","keywords":[],"chapters":[{"head":"Population et économie","index":1,"paragraphs":[{"index":1,"size":101,"text":"Le Bénin compte une population estimée par l'UN en 2003 à 6,7 millions d'habitants, avec une densité de population de 59 habitants par km 2 . Trois quart sont concentrés dans la moitié Sud du pays, où la densité atteint 120 habitants par km 2 . Avec 46 % de la population ayant 15 ans ou moins, une croissance de 2,65 % p.a est enregistrée. En 2010, la population est estimée par la CIA à 8,8 millions. La croissance a entretemps atteint 2,98 % p.a., la fertilité est haute (5,49 naissances par femme) et l'espérance de vie est de 59 ans."}]},{"head":"Carte 2.1 Bénin et ses départements, avec chef-lieux désignés et routes goudronnées","index":2,"paragraphs":[]},{"head":"Benin and its departments, with main localities (where already designated) and paved roads","index":3,"paragraphs":[{"index":1,"size":130,"text":"Encore aujourd'hui la plupart des gens (70 %) pratiquent l'agriculture, la pêche, la pisciculture, la chasse, la collection de plantes médicinales, etc. En addition à une agriculture de subsistance riche et variée avec maïs, manioc, igname, niébé au sud et sorgho et millet au nord, légumes (tomates, en contre-saison dans la Vallée de l'Ouémé) comme cultures principales commercialisées à travers le pays, les filières de coton, d'ananas, de palmier à huile, et plus récemment, d'acajou, se positionnent comme cultures de rente également pour l'exportation. Pourtant, dans une bande de 100 km du Sud du pays, les fermes agricoles en moyenne n'atteignent guère 3 ha. La production de bovins est concentrée plus tôt au Nord, celle des porcins au Sud; les ovins et caprins sont élevés à travers tout le pays."},{"index":2,"size":81,"text":"En 2009, l'agriculture contribuait à 33,2 % au PIB (avec le coton comme la plus grande culture d'exportation), l'industrie 14,5 % et les services (principalement le port de Cotonou, les banques, et le tourisme) 52,3 %. Selon l'OCDE 73,7 % des Béninois avaient accès à moins de 2 $ par jour (47,3 % pour la limite de 1 $ par jour). L'Indice du Développement Humain du PNUD place donc le Bénin au 161 ème rang des 182 pays recensés en 2009."}]},{"head":"Climat","index":4,"paragraphs":[{"index":1,"size":98,"text":"Au Bénin, le climat est influencé par l'orientation de la côte par rapport à la direction de la mousson et par l'affrontement des alizés maritimes et continentaux. Les saisons dépendent essentiellement de la zone d'affrontement des alizés ou zone intertropicale de convergence (ZIC) et de ses déplacements au cours de l'année. En juillet, la ZIC se situe largement au nord du pays; les vents soufflant de l'océan amènent les pluies. En décembre, au contraire, la ZIC est au sud du Bénin, sur l'Atlantique; les vents venant du Sahara sont secs et froids. Ils constituent l'alizé continental, dénommé harmattan."},{"index":2,"size":88,"text":"Dans le Sud les moyennes mensuelles de température oscillent entre 26° et 28°C, les amplitudes sont faibles, les écarts entre les maxima et les minima variant entre 5° et 10°C. Par contre dans le Nord, les moyennes maximales mensuelles sont au-delà de 35°C et peuvent même atteindre 40°C à Kandi. Les moyennes de l'humidité relative décroissent du sud vers le nord, 80 % à Cotonou et 50 % à Kandi. Les écarts de la moyenne annuelle sont plus grands dans la partie septentrionale que dans la partie méridionale."}]},{"head":"Carte 2.2 Pluviométrie en mm par an","index":5,"paragraphs":[]},{"head":"Annual rainfall in mm","index":6,"paragraphs":[{"index":1,"size":11,"text":"Carte 2.2 Pluviométrie en mm par an. Annual rainfall in mm."}]},{"head":"Carte 2.3 Réseau hygrographique du Bénin","index":7,"paragraphs":[]},{"head":"Rivers of Benin","index":8,"paragraphs":[{"index":1,"size":93,"text":"La pluviométrie (Carte 2.2) est comprise entre 900 mm et 1 400 mm par an avec un gradient ouest-est et un gradient sud-nord. La répartition de la pluie dans l'année permet de distinguer deux grands types de climat avec transitions: au sud le climat tropical humide (subéquatorial ou guinéen) avec deux maxima de pluie (grande saison de pluie d'avril à juillet et petite saison de pluie de septembre à octobre), et le climat soudanien à partir de la latitude de Savè aux environs de 8°N avec un seul maximum de pluie en juin."},{"index":2,"size":49,"text":"La végétation qui résulte de ces conditions climatiques est discutée dans le chapitre suivant. 1 Information de base pour développer une Liste Rouge pour le Bénin Basic information for developing a Red List for Benin 2 Bénin, milieu naturel et données socio-économiques Benin, its natural environment and socio-economic data"}]},{"head":"Réseau hydrographique","index":9,"paragraphs":[{"index":1,"size":94,"text":"En addition un grand nombre de Forêts Classées a été établi. Les surfaces qui sont ainsi protégées est impressionnantes; mais la réalité est différente. Dans la plupart des cas, les agriculteurs ont envahi ces terrains, les bois de valeur souffrent d'une coupure sélectionnée, et souvent seulement un noyau reste sous couverture de forêt naturelle. De la forêt de Wari Maro et d'autres au centre du pays, qui il y a quelques années, se présentaient encore sous une couverture forestière continue, il ne reste que peu, et ceci malgré des projets qui envisagent leurs protection."},{"index":2,"size":166,"text":"Plus au sud, la Forêt Classée de la Lama (4 777 ha) avec son noyau central (1 900 ha) de forêt naturelle de type dense humide, qui est entourée des plantations de teck, est relativement bien protégée et gardée continuellement. Les forêts de Niaouli 150 ha (110 ha de forêt de plateau et 40 ha de forêt de bas-fonds) et de Pobè (150 ha de forêt dense) sont situées sur des stations de recherche où elles sont aujourd'hui relativement bien gardées. Mais la forêt communautaire d'Ewè souffre sous le fait que les deux communes avoisinantes se disputent la propriété. Cette forêt est donc menacée de disparaître complètement. Le même sort pourrait arriver à la forêt d'Ahozon près de Pahou (environ 70 ha), la seule forêt côtière restante. La forêt communautaire de Lokoli (500 ha), la plus grande forêt inondée du pays, jouit d'une protection locale pour l'exploitation touristique, mais reste hautement menacée par la coupe de bois et la production de vin de palme de raphia."},{"index":3,"size":75,"text":"En addition à ces forêts sous tutelle officielle de l'état où des communes, des milliers de forêts de petite taille (dans la plupart des cas <1 ha) sont protégées par la coutume d'un vodoun local. Particulièrement au sud du pays, ces forêts sont les seuls endroits avec un vestige de végétation forestière. Leur protection n'est souvent pas assurée. Le sort de ces 'forêts sacrées' sera discuté en détail dans les différents chapitres de ce livre."},{"index":4,"size":74,"text":"Les sables côtiers, marais, pelouses naturelles sont protégées dans les sites Ramsar 1017 (zones humides), qui bénéficient d'un statut international de protection (Complexe Est à Nokoué et Complexe Ouest à Ahémé). Mais ailleurs, ces formations, ainsi que les 'inselbergs' à présent ne jouissent pas de protection ciblée et officielle, mais font l'objet d'efforts de sauvegarde par des ONGs actives en protection de la nature et des organisations villageoises, souvent basées sur les croyances locales."}]},{"head":"Geographical situation","index":10,"paragraphs":[{"index":1,"size":82,"text":"The Republic of Benin covers 114 763 km 2 between 6°15' and 12°25' N and 0°40' and 3°45' E with a coastline along the Gulf of Guinea of 120 km and a direct distance from the Atlantic to the Niger River in the north of 675 km. In the north, the country borders the Republic of Niger, in the NW the Republic of Burkina Faso, in the east the Republic of Nigeria and in the west the Republic of Togo (Carte 2.1)."}]},{"head":"Population and economy","index":11,"paragraphs":[{"index":1,"size":99,"text":"The population of Benin was estimated by the UN in 2003 at 6.7 million with a population density of 59 inhabitants per km 2 . Three quarters are concentrated in the southern half of the country, where densities reach 120 inhabitants per km 2 . With 46 % of the population aged 15 years or less, population growth is estimated at 2.65 % p.a. In 2010, the population was estimated by the CIA to be 8.8 million with a population growth of 2.98 % p.a., a high fertility (5.49 births per woman) and a life expectancy of 59 years."},{"index":2,"size":122,"text":"Even today, the majority of people (70 %) are involved in agriculture, fishing, hunting, the collection of medicinal plants, etc. There is a rich and varied subsistence agriculture with maize, cassava, yams, cowpea in the south and sorghum and millet in the north, vegetables (tomatoes, in dry season from the Ouémé Valley), which are all commercialized across the country. In addition, cotton, pineapple, palm oil, and more recently cashew, have become also cash crops for export supported by organized production chains. Nevertheless, farms in a 100 km band along the Atlantic coast barely average 3 ha. The production of cattle is concentrated in the north, the one of pigs in the south, while sheep and goats are raised across the entire country."},{"index":3,"size":91,"text":"In 2009, agriculture contributed 33.2 % to the GNP (cotton being the most important export commodity), industry 14.5 % and services (principally the port of Cotonou, banks and tourism) 52.3 %. According to the OECD, 73.7 % of Beninois had access to less than 2 $ Protection de la Nature en Afrique de l'Ouest Nature Conservation in West Africa per day (47.3 % for the limit of 1 $ per day). The Index of Human Development of the UNDP places Benin 161 th among 182 countries that were evaluated in 2009."}]},{"head":"Climate","index":12,"paragraphs":[{"index":1,"size":70,"text":"In Benin, climate is influenced by maritime and continental trade winds and seasons are essentially affected by the annual displacement of the Intertropical Convergence Zone (ICZ). In July, when the ICZ is situated north of the country, rains are brought by the winds from the sea. In December, when the ICZ lies south of Benin over the Atlantic Ocean, dry and cold winds called 'Harmatan' blow from the Saharan desert."},{"index":2,"size":60,"text":"In the south of the country monthly mean temperatures oscillate between 26° and 28°C, with low amplitudes of 5° to 10°C. In the north, monthly mean maxima are between 35°C and 40°C (at Kandi). Mean relative humidities decrease from south to north, from 80 % in Cotonou to 50 % at Kandi, with mean amplitudes being higher in the north."},{"index":3,"size":60,"text":"Rainfall (Carte 2.2) varies from 900 to 1 400 mm per year with a west-east and south-north gradient. Rainfall distribution shows two types of climates with corresponding transitions: in the south a tropical humid climate (Subequatorial or Guinean) with two rainfall maxima in April-July and September-October, and a Sudanian climate from Savè at 8°N northwards with one maximum in June."},{"index":4,"size":14,"text":"The vegetation that grows under these climatic conditions is discussed in the next chapter"}]},{"head":"Fresh water resources","index":13,"paragraphs":[{"index":1,"size":273,"text":"See Carte 2.3: In the north, the Niger River borders the Republic of Niger over 137 km, with the Mékrou, Alibori and Sota as tributaries from the south. The NW is drained by the Penjari, which borders Burkina Faso and drains into the Volta, the biggest River of Ghana. In the west, the Mono, whose source lies in Togo, forms the border to this country, reaching the Atlantic Ocean near Grand Popo. Close by lies the estuary of the Kouffo, which passes through Lake Ahémé and adjacent lagoons. Most of the rest of the country is drained by the Ouémé and its tributaries, mainly the Zou in the centre west and the Okpara along the Nigerian border. The Ouémé drains into Lake Nokoué and the lagoon of Porto Novo, and from there through the Badagri Creeks into the ocean at Lagos, Nigeria. Since a channel was dug at Cotonou in the 1880s and deepened in the 1980s sea water penetrates directly into Lake Nokoué rendering its water brackish during the dry season. In addition, several smaller rivers with particularly interesting faunas merit mentioning: The Sô flows from the Lama depression into Lake Nokoué, having as its tributary the Hlan, which crosses the Lama forest and the inundated forest of Lokoli. The Iguidi is located near the Nigerian border in the south. The Iguidi and the Hlan are the only larger and permanent forest rivers of the country. Depending on the years, the plains of the Ouémé and the Sô are inundated over a surface of up to 100 km x 50 km, thus forming one of the biggest flood plains of West Africa."}]},{"head":"Protected areas","index":14,"paragraphs":[{"index":1,"size":176,"text":"Benin has a vast network of protected areas (Carte 2.4) the most important being the Complex WAP (W, Arli and Pendjari Parks), which comprises the Pendjari Park of Benin (2 755 km 2 ), the National W Park of Bénin (5 020 km 2 ), Niger (2 190 km 2 ) and Burkina Faso (3 000 km 2 ), and the National Park of Arli in Burkina Faso (with several types of protected zones, 3 988 km 2 ). Together with the surrounding controlled hunting zones these areas cover over 30 000 km 2 . These parks constitute the largest protected area in West Africa and are listed as 'World Heritage Sites of UNESCO', where the fauna and flora is protected since 2002 under an international agreement between the three countries. The challenge to maintain this area in its pristine state is enormous and land pressure is strong. Thus, 14.5 % of the savannah around the WAP parks has been taken under cultivation between 1984 and 2002, as compared to 0.3 % within the parks themselves."},{"index":2,"size":28,"text":"In addition, a large number of Classified Forests has been established. Most of them are, however, invaded by farmers and cattle herders and often only small central parts"}]}],"figures":[{"text":" République du Bénin s'étend sur une superficie de 114 763 km 2 entre 6°15' et 12°25' N et 0°40' et 3°45' E avec une côte de 120 km le long du Golfe de Guinée et une distance à vol d'oiseau de 675 km de l'Atlantique jusqu'au Fleuve Niger au Nord. Le Bénin est limité au nord par la République du Niger, à l'est par la République du Nigeria, à l'ouest par la République du Togo et au nord-ouest par la République du Burkina Faso (Carte 2.1). "},{"text":" Au nord, la frontière entre le Bénin et le Niger est faite du fleuve Niger sur 137 km, qui est alimenté au sud par le Mékrou, l'Alibori et le Sota (Carte 2.3). Le nord-ouest est drainé par le fleuve Penjari, qui forme la frontière vers le Burkina Faso et qui se jette dans la Volta, le plus grand fleuve du Ghana. A l'ouest, le fleuve Mono, dont la source se trouve au Togo, forme la frontière avec ce pays et se jette dans l'Atlantique près de Grand-Popo. Tout près de cette embouchure, le fleuve Kouffo, qui alimente le Lac Ahémé et passe par des lagunes, se jette dans l'océan Atlantique. Le reste du pays, est drainé par le fleuve Ouémé et ses affluents, notamment le Zou au centre-ouest et l'Okpara qui fait frontière avec le Nigeria; ils se réunissent et se jettent tous dans le Lac Nokoué et la lagune de Porto-Novo. Son ancienne embouchure à travers les lagunes de Badagri se trouve à Lagos au Nigeria. Un chenal a été créé dans les années 1880 et renouvelé dans les années 1980 à Cotonou. Ceci a pour conséquence que l'eau de la mer pénètre rendant l'eau du Lac Nokoué saumâtre en saison sèche. Nous mentionnons encore quelques petites rivières du sud, qui ont une importance particulière d'un point de vue biogéographique: La Sô venant de la dépression de la Lama avec son affluent Hlan traversant la forêt de Lama et la forêt inondée de Lokoli, et l'Iguidi vers la frontière Nigeriane. L'Iguidi et l'Hlan sont les seules rivières forestières et permanentes du pays. Les plaines de l'Ouémé et de la Sô sont inondées selon les années sur une superficie de100 km x 50 km, formant ainsi une des plus grandes plaines d'inondation de l'Afrique de l'Ouest. "},{"text":"  "},{"text":"  "}],"sieverID":"621b5440-3dac-45a3-b729-aca635176a29","abstract":"iii 1 Information de base pour développer une Liste Rouge pour le Bénin Basic information for developing a Red List for Benin"}

data/part_3/0c9b728052eedeebdc147f3cea021f39.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0c9b728052eedeebdc147f3cea021f39","source":"gardian_index","url":"https://dataverse.harvard.edu/api/access/datafile/:persistentId/?persistentId=doi:10.7910/DVN/AW2HNO/X0WEN1"},"pageCount":13,"title":"Understanding smallholder private irrigation in Abaji, Federal Capital Territory, Nigeria Questionnaires","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":11,"text":"Enumerator, please ask the interviewee to identify the largest irrigated plot."}]},{"head":"2.1","index":2,"paragraphs":[{"index":1,"size":45,"text":"What is the land tenure status of this plot? 1 = purchased with title (skip to 2.4) 2 = purchased without title (skip to 2.4) 3 = rented from local indigenes for a fee 4 = rented for free without a fee (skip to 2.3)"}]},{"head":"2.2","index":3,"paragraphs":[{"index":1,"size":12,"text":"How much did you pay for rent for the most recent season? "}]},{"head":"2.3","index":4,"paragraphs":[]},{"head":"C. Irrigation water sources","index":5,"paragraphs":[{"index":1,"size":30,"text":"Water source for the rainy season may be inland, if the river expands during the rainy season. If so, please ask the farmer their locations as well, and ask questions."},{"index":2,"size":14,"text":"We would like to know the water sources from which you extract irrigation water "}]},{"head":"3.16","index":6,"paragraphs":[{"index":1,"size":14,"text":"What is approximat e distance from this water source to the plots irrigated (meter)?"}]},{"head":"3.17","index":7,"paragraphs":[{"index":1,"size":13,"text":"For how many years have you been using this water source for irrigation?"}]},{"head":"3.18","index":8,"paragraphs":[{"index":1,"size":7,"text":"How did you learn about this source?  "}]},{"head":"4.12","index":9,"paragraphs":[{"index":1,"size":41,"text":"Between land preparation and planting, what is the maximum depth the irrigation water reaches for this crop on this plot? 1. below ankle 2. above ankle and below knee 3. upto knee 4. above knee and below waist 5. above waist"}]},{"head":"4.13","index":10,"paragraphs":[{"index":1,"size":22,"text":"Typically, how many days of the week is the plot for this crop covered with irrigation water (between land preparation and planting)?"}]},{"head":"4.14","index":11,"paragraphs":[{"index":1,"size":39,"text":"Between planting and harvesting, what is the maximum depth of water for irrigating this crop on this plot? 1. below ankle 2. above ankle and below knee 3. upto knee 4. above knee and below waist 5. above waist"}]},{"head":"4.15","index":12,"paragraphs":[{"index":1,"size":21,"text":"Typically, how many days of the week is the plot for this crop covered with irrigation water (Between planting and harvesting)?"}]},{"head":"E. Irrigation related inputs uses -Labor uses for irrigation related activities","index":13,"paragraphs":[{"index":1,"size":9,"text":"Please ask the questions for the largest irrigated plot. "}]}],"figures":[{"text":" Please ask about the water sources used to irrigated the largest irrigated plot only. "},{"text":"1 Coversheet 1.1 Farmer no. 1.2 Farmer name 1.3 Cell Phone Number (Interviewer: record the best phone number at which to reach the interviewee) 1.4 Interviewer name 1.5 Date of interview [dd/mm/yy] 2 Plot A. Largest irrigated plot-crop   "},{"text":"3 Irrigation equipment, sources B. Irrigation equipment owned 3.1 How many irrigation pumps do you currently own? (if \"zero\", skip to 3.7)  Pump            Pump Pump ID 3.2  3.3  3.4  3.5   3.6  Pump ID3.23.33.43.53.6  What is the horsepower In which year did What was the price If you were to sell What is the What is the horsepowerIn which year didWhat was the priceIf you were to sellWhat is the  of this pump? you obtain this of this pump when this pump today, primary fuel for of this pump?you obtain thisof this pump whenthis pump today,primary fuel for    pump?  purchased? (Naira) how much do you this pump? pump?purchased? (Naira)how much do youthis pump?  99 = don't know 99 = don't know 99 = don't know 2.4 2.5 receive? (Naira) 2.6 1 = petroleum 2 = diesel 2.7 99 = don't know99 = don't know99 = don't know2.42.5 receive? (Naira)2.6 1 = petroleum 2 = diesel2.7     Do you hire Did you irrigate Which season did For the most For the most recent Do you hireDid you irrigateWhich season didFor the mostFor the most recent     the land owner rice on this plot you irrigate rice recent production season, the land ownerrice on this plotyou irrigate ricerecentproduction season,     or their family in the past 12 on this [plot]? production in which month did or their familyin the past 12on this [plot]?productionin which month did     members for months?    season, in you harvest rice on members formonths?season, inyou harvest rice on Hose 3.7 3.8 3.9 farming on this plot? 1 = yes 2 = no Do you own the hose that takes water from the river to the pump? (suction hose) 1 = yes 2 = no (skip to 2.8) Amount Unit (naira) 1 = per season 2 = per year How many suction hoses do you own? 3 = % of harvest If you were to sell all suction hoses today, how much would you receive? (What are the total 1 = dry season only 2 = rainy season only 3 = both seasons 1 = yes 2 = no (skip to 3.10) which month this [plot]? did you plant rice on this [plot]? Hose 3.7 3.8 3.9farming on this plot? 1 = yes 2 = no Do you own the hose that takes water from the river to the pump? (suction hose) 1 = yes 2 = no (skip to 2.8) Amount Unit (naira) 1 = per season 2 = per year How many suction hoses do you own? 3 = % of harvest If you were to sell all suction hoses today, how much would you receive? (What are the total 1 = dry season only 2 = rainy season only 3 = both seasons 1 = yes 2 = no (skip to 3.10) which month this [plot]? did you plant rice on this [plot]?  values of suction hoses owned?) (Naira)        values of suction hoses owned?) (Naira) 3.10 Do you own the hose that delivers water from the pump to the plots? (delivery hose)  1 = yes 2 = no (skip to 3.13) 3.10Do you own the hose that delivers water from the pump to the plots? (delivery hose)1 = yes 2 = no (skip to 3.13) 3.11 How many delivery hoses do you own?        3.11How many delivery hoses do you own? 2.8 Did you 3.12 2.9 Which If you were to buy one delivery hose today, how much would you pay (What are the total 2.10 For the 2.11 For the 2.12 Did you 2.13 Which 2.14 For the 2.15 For the values of delivery hoses owned?)? 2.16 Did you 2.17 Which 2.18 For the 2.19 For the 2.8 Did you 3.122.9 Which If you were to buy one delivery hose today, how much would you pay (What are the total 2.10 For the 2.11 For the 2.12 Did you 2.13 Which 2.14 For the 2.15 For the values of delivery hoses owned?)?2.16 Did you2.17 Which2.18 For the2.19 For the irrigate season did most most recent irrigate season did most  most  irrigate season did most most irrigateseason didmostmost recentirrigateseason didmostmostirrigateseason didmostmost maize on you recent production pepper on you irrigate recent recent  okra on you irrigate recent recent maize onyourecentproductionpepper onyou irrigaterecentrecentokra onyou irrigaterecentrecent this plot in irrigate productio season, in this plot in pepper on productio production this plot in okra on this productio production this plot inirrigateproductioseason, inthis plot inpepper onproductioproductionthis plot inokra on thisproductioproduction the past 12 maize on n season, which the past 12 this [plot]? n season, season, in the past 12 [plot]? n season, season, in the past 12maize onn season,whichthe past 12this [plot]?n season,season, inthe past 12[plot]?n season,season, in months? this [plot]? in which month did months?  in which which  months?  in which which months?this [plot]?in whichmonth didmonths?in whichwhichmonths?in whichwhich  1 = Dry season only 2 = rainy season only 3 = both month did you plant maize on this [plot]? you harvest maize on this [plot]? 1 = yes 2 = no (skip to 2.12) 1 = Dry season only 2 = rainy season only 3 = both seasons month did you plant pepper on this month did you harvest pepper on this [plot]? 1 = yes 2 = no (skip to the next plot) 1 = Dry season only 2 = rainy season only 3 = both seasons month did you plant okra on this [plot]? month did you harvest okra on this [plot]? 1 = Dry season only 2 = rainy season only 3 = bothmonth did you plant maize on this [plot]?you harvest maize on this [plot]?1 = yes 2 = no (skip to 2.12)1 = Dry season only 2 = rainy season only 3 = both seasonsmonth did you plant pepper on thismonth did you harvest pepper on this [plot]?1 = yes 2 = no (skip to the next plot)1 = Dry season only 2 = rainy season only 3 = both seasonsmonth did you plant okra on this [plot]?month did you harvest okra on this [plot]?  seasons     [plot]?     seasons[plot]?  "},{"text":"Figure 1. Location of water source to collect GPS coordinates Largest   3.19 3.20 3.193.20  How many hours How much How many hoursHow much  did you spend (Naira) did you did you spend(Naira) did you  maintaining spend for maintainingspend for 1 = self-discovery 2 = family member (cleaning, repairing) this water source, in maintaining this water source, in the last 1 = self-discovery 2 = family member(cleaning, repairing) this water source, inmaintaining this water source, in the last 3 = other farmers the last production 3 = other farmersthe lastproduction 4 = other friends 5 = extension agents 9 = others production season? (exclude the maintenance season? (exclude the maintenance on 4 = other friends 5 = extension agents 9 = othersproduction season? (exclude the maintenanceseason? (exclude the maintenance on  on channels) channels) on channels)channels)  "},{"text":"source 4 Inputs uses on the largest irrigated plot D. Irrigation related: water-quantities used for irrigation a. Channel / river-diversion based: Through gate  Crops irrigated 4.1  4.2 4.3 4.4 4.5 Crops irrigated4.14.24.34.44.5 on this plot  Do you irrigate How many times do you irrigate this Typically, how Each time you Imagine you have to pump on this plotDo you irrigateHow many times do you irrigate thisTypically, howEach time youImagine you have to pump (pre-filled)  through gate crop on this plot during the season? many gates do irrigate this crop on water from the channel, (pre-filled)through gatecrop on this plot during the season?many gates doirrigate this crop onwater from the channel,   from the   you use to this plot, how instead of opening the gate. from theyou use tothis plot, howinstead of opening the gate.   channel, for this  irrigate this crop many hours do you How many hours of pumping channel, for thisirrigate this cropmany hours do youHow many hours of pumping   crop on this  on this plot? leave each gate is needed to provide the same crop on thison this plot?leave each gateis needed to provide the same   plot?    open? amount of water per each plot?open?amount of water per each     Frequency Unit  Dura Unit irrigation? Frequency UnitDuraUnitirrigation?     1 = per day 2 = per week  tion 1 = minute 2 = hour 1 = per day 2 = per weektion1 = minute 2 = hour     3 = per month   3 = per month     4 = per production season   4 = per production season b. Irrigation using pumps    b. Irrigation using pumps Crops 4.6  4.7 4.8 4.9 4.10 4.11 Crops4.64.74.84.94.104.11 irrigated How many ID of How often do you irrigate this Every time How often do you pay for fuel Each time, irrigatedHow manyID ofHow often do you irrigate thisEvery timeHow often do you pay for fuelEach time, (pre- pumps do pumps crop on this plot with pumps? you irrigate to operate the pump during the how much (pre-pumps dopumpscrop on this plot with pumps?you irrigateto operate the pump during thehow much filled) you use to used to  this crop on season? do you filled)you use toused tothis crop onseason?do you  irrigate this irrigate  this plot, how  typically pay irrigate thisirrigatethis plot, howtypically pay  crop on this this plot many hours do  for fuel crop on thisthis plotmany hours dofor fuel  plot?  (from  you typically  (Naira)? plot?(fromyou typically(Naira)?  (if \"zero\", go to next crop) Pump ID) operate each pump?  (if \"zero\", go to next crop)Pump ID)operate each pump?  "},{"text":"Use of labor for assisting the flow of water on the largest irrigated plot 4.24  G.         G. Activities 4.16 4.17 4.18 4.19  4.20 4.21 4.22 4.23 Activities4.164.174.184.194.204.214.224.23  In the dry season, In the dry season, On average, On  In the rainy In the rainy On average, On average, In the dry season,In the dry season,On average,OnIn the rainyIn the rainyOn average,On average,  did you, your for the largest how many average, season, did you, season, for the how many how many did you, yourfor the largesthow manyaverage,season, did you,season, for thehow manyhow many  family members irrigated plot, for person how many your family largest irrigated person hours per family membersirrigated plot, forpersonhow manyyour familylargest irrigatedpersonhours per  or hired workers how many days worked per hours per members or plot, for how worked per day for or hired workershow many daysworked perhours permembers orplot, for howworked perday for  worked for […] ? did you, your day for […] day for hired workers many days did day for […] […](for the worked for […] ?did you, yourday for […]day forhired workersmany days didday for […][…](for the  1 = yes 2 = no (skip to 4.20) family members or hired workers (for the largest […] (for the largest worked for […] ? you, your family members or (for the largest largest irrigated 1 = yes 2 = no (skip to 4.20)family members or hired workers(for the largest[…] (for the largestworked for […] ?you, your family members or(for the largestlargest irrigated   worked for […]? irrigated plot)? irrigated plot)? 1 = yes the next row) 2 = no (skip to worked for […]? hired workers plot)? irrigated plot)? worked for […]?irrigated plot)?irrigated plot)?1 = yes the next row) 2 = no (skip toworked for […]? hired workersplot)? irrigatedplot)? Building water intake channel         Building water intake channel (not drainage)         (not drainage) Maintaining the water intake         Maintaining the water intake channel         channel Setting up motor pumps, pipes to         Setting up motor pumps, pipes to lift water from the river         lift water from the river Maintaining motor pump, pipes         Maintaining motor pump, pipes during production season         during production season Building drainage channel         Building drainage channel Maintaining drainage channel         Maintaining drainage channel Building basins on the plot         Building basins on the plot Building furrows on the plot         Building furrows on the plot Leveling / grading the plot         Leveling / grading the plot F. In the dry season, did 4.25 In the dry season, for 4.26 On average, how 4.27 On average, how 4.28 In the rainy season, 4.29 In the rainy season, 4.30 On average, how 4.31 On average, how F. In the dry season, did4.25 In the dry season, for4.26 On average, how4.27 On average, how4.28 In the rainy season,4.29 In the rainy season,4.30 On average, how4.31 On average, how you, your family the largest irrigated many person many hours per did you, your family for the largest many person many hours per you, your familythe largest irrigatedmany personmany hours perdid you, your familyfor the largestmany personmany hours per members or hired plot, for how many worked per day day for assisting members or hired irrigated plot, for worked per day day for assisting members or hiredplot, for how manyworked per dayday for assistingmembers or hiredirrigated plot, forworked per dayday for assisting workers worked for days did you, your for assisting the the flow of water workers worked for how many days did for assisting the the flow of wate workers worked fordays did you, yourfor assisting thethe flow of waterworkers worked forhow many days didfor assisting thethe flow of wate assisting the flow of family members or flow of water on on the plot for  assisting the flow of you, your family flow of water on on the plot for assisting the flow offamily members orflow of water onon the plot forassisting the flow ofyou, your familyflow of water onon the plot for water on the plot for hired workers the plot for […]? […] (for the  water on the plot for members or hired the plot for […]? […] (for the water on the plot forhired workersthe plot for […]?[…] (for thewater on the plot formembers or hiredthe plot for […]?[…] (for the […]? worked for assisting (for the largest largest irrigated […]?  workers worked for (for the largest largest irrigated […]?worked for assisting(for the largestlargest irrigated[…]?workers worked for(for the largestlargest irrigated 1 = yes 2 = no (skip to 4.28) the flow of water on the plot for […]? irrigated plot)? plot)?  1 = yes row) 2 = no (skip to the next […]? water on the plot for assisting the flow of irrigated plot)? plot)? 1 = yes 2 = no (skip to 4.28)the flow of water on the plot for […]?irrigated plot)?plot)?1 = yes row) 2 = no (skip to the next[…]? water on the plot for assisting the flow ofirrigated plot)?plot)? Rice         Rice Maize         Maize Pepper         Pepper Okra         Okra  "},{"text":"General labor uses for cultivation (largest irrigated plot) (nursery preparation)  Crop 4.56  4.57   4.58  4.59   4.60 4.61 4.62 4.63 4.64 4.65 4.66 4.67 Crop4.564.574.584.594.604.614.624.634.644.654.664.67  I In the dry Each day,  Each day, In the dry  Each day, Each day, In the dry Each day, Each In the dry Each day, Each day, I In the dryEach day,Each day,In the dryEach day,Each day,In the dryEach day,EachIn the dryEach day,Each day, Crop ID D season, how many days did you, your family members, or hired 4.32 In the dry season, how many days did you or hired workers work on nursery how many how season, how workers many many days did worked hours you, your for worked family for this crop? (including nursery bed planting/tr for members, or preparation, seedling maintenance etc) ans-planting/t hired workers 4.33 Each day, how many workers worked on nursery for this crop? how many how many season, how workers hours many days worked for worked for did you, thinning thinning for your family for this this crop on members, or crop on this plot? hired how many 4.34 workers Each day, how many hours worked for day, how season, many how many worked hours days did nursery for this crop? for worked you, your pruning for family for this pruning members, how many workers worked for mulching for this how many hours worked for mulching for this Crop IDD season, how many days did you, your family members, or hired4.32 In the dry season, how many days did you or hired workers work on nursery how many how season, how workers many many days did worked hours you, your for worked family for this crop? (including nursery bed planting/tr for members, or preparation, seedling maintenance etc) ans-planting/t hired workers4.33 Each day, how many workers worked on nursery for this crop? how many how many season, how workers hours many days worked for worked for did you, thinning thinning for your family for this this crop on members, or crop on this plot? hiredhow many 4.34 workers Each day, how many hours worked for day, how season, many how many worked hours days did nursery for this crop? for worked you, your pruning for family for this pruning members,how many workers worked for mulching for thishow many hours worked for mulching for this  workers planting  rans-  work for  this plot? workers crop on for this or hired crop on crop on workersplantingrans-work forthis plot?workerscrop onfor thisor hiredcrop oncrop on  work for for this  planting  thinning for   work for this plot? crop on workers this plot? this plot? work forfor thisplantingthinning forwork forthis plot?crop onworkersthis plot?this plot? planting/tran (main plot) s-planting crop on this plot?  for this crop on  this crop on this plot?   pruning for this crop on this plot? work for mulching planting/tran (main plot) s-plantingcrop on this plot?for this crop onthis crop on this plot?pruning for this crop onthis plot?work for mulching Crop ID 4.35 for this crop  4.36  4.37 this plot?  4.38 4.39 4.40 this plot? 4.41 4.42 for this 4.43 Crop ID 4.35 for this crop4.364.37 this plot?4.384.394.40 this plot?4.414.42 for this4.43  In the dry on this plot?  Each day, Each day, how In the dry Each day, how Each day, how In the dry Each day, how crop on this 4.44 In the dry on this plot?Each day,Each day, howIn the dryEach day, howEach day, howIn the dryEach day, how crop on this4.44   season, how  how many many hours season, how many workers many hours season, how many workers plot? season, howhow manymany hoursseason, howmany workersmany hoursseason, howmany workers plot?   many days did workers  worked for  many days did worked for worked for many days did worked for land many days didworkersworked formany days didworked forworked formany days didworked for land   you, your  worked for land clearing you or hired harrowing for harrowing for you or hired leveling for this you, yourworked forland clearingyou or hiredharrowing forharrowing foryou or hiredleveling for this   family  land clearing for this crop workers work this crop on this crop on workers work crop on this familyland clearingfor this cropworkers workthis crop onthis crop onworkers workcrop on this 4.68 In the dry season, how many weeding did you do members, or hired workers work for land clearing for this 4.69 In the dry season, for each for this crop on this plot? 4.70 Each day, how many time of weeding, workers crop on this how many days worked for plot? did you, your weeding for on this plot? 4.71 Each day, how many hours worked for weeding for for harrowing for this crop on this plot? 4.72 In the dry season, how many days did you, your family this plot? 4.73 Each day, how many workers worked for bird scaring this plot? 4.74 Each day, how many hours worked for bird scaring for land leveling for 4.76 In the dry 4.75 Each day, plot? this crop on season, how how many this plot? many days did workers you, your worked for family harvesting 4.77 Each day, how many hours worked for harvesting 4.68 In the dry season, how many weeding did you domembers, or hired workers work for land clearing for this 4.69 In the dry season, for each for this crop on this plot? 4.70 Each day, how many time of weeding, workers crop on this how many days worked for plot? did you, your weeding foron this plot? 4.71 Each day, how many hours worked for weeding forfor harrowing for this crop on this plot? 4.72 In the dry season, how many days did you, your familythis plot? 4.73 Each day, how many workers worked for bird scaringthis plot? 4.74 Each day, how many hours worked for bird scaringfor land leveling for 4.76 In the dry 4.75 Each day, plot? this crop on season, how how many this plot? many days did workers you, your worked for family harvesting4.77 Each day, how many hours worked for harvesting for this   family members, this crop on  this crop on members, or for this for this members, or for this for this for thisfamily members,this crop onthis crop onmembers, orfor thisfor thismembers, orfor thisfor this crop on this or hired workers this plot?  this plot? hired workers crop on this crop on this hired workers crop on this crop on this crop on thisor hired workersthis plot?this plot?hired workerscrop on thiscrop on thishired workerscrop on thiscrop on this plot?   worked for       work for bird plot? plot? work for plot? plot? plot?worked forwork for birdplot?plot?work forplot?plot? Crop 4.44 4.45 weeding for this  4.46  4.47  4.48 scaring for 4.49 4.50 4.51 harvesting for 4.52 4.53 4.54 4.55 Crop4.444.45 weeding for this4.464.474.48 scaring for4.494.504.51 harvesting for4.524.534.544.55  I In the dry crop on this Each day,  Each day, In the dry Each day, this crop on Each day, In the dry Each day, this crop on Each day, In the dry Each day, Each day, I In the dry crop on this Each day,Each day,In the dryEach day, this crop onEach day,In the dryEach day, this crop onEach day,In the dryEach day,Each day,  D season, how plot? how many how  season, how how this plot? how season, how how many this plot? how many season, how how many how many D season, how plot?how manyhowseason, howhow this plot?howseason, howhow many this plot?how manyseason, howhow manyhow many  many days workers  many  many days  many many many days did workers hours many days workers hours many daysworkersmanymany daysmanymanymany days didworkershoursmany daysworkershours  did you, worked  hours  did you or  workers hours you or hired worked for worked for did you or worked worked did you,workedhoursdid you orworkershoursyou or hiredworked forworked fordid you orworkedworked  your family for   worked  hired workers worked worked workers work ridging/mo ridging/mo hired for for your familyforworkedhired workersworkedworkedworkers workridging/moridging/mohiredforfor members, or hired workers work for plowing for In the dry season, how 4.78 many days did you, your family members, or hired workers work this crop on for threshing for this this plot? crop on this plot? plowing for this crop on this plot? 4.79 Each day, how many workers worked for threshing for for plowing for this crop on this plot? 4.80 Each day, work for puddling for this crop on this plot? 4.81 In the dry season, for puddling for this crop on this plot? how many how many days did hours you, your family worked for members, or hired threshing for workers work for this crop on this crop on winnowing for this for puddling for this crop on this plot? 4.82 Each day, how many workers worked for for ridging/mound -making for this crop on this plot? 4.83 Each day, how many hours worked und-making for this crop on this plot? 4.84 In the dry season, und-making for this crop on this plot? 4.85 workers work for bunding for this crop on 4.86 bunding for this crop on this plot? Each day, Each day, how how many days did how many many hours you, your family workers worked for this plot? for members, or hired worked for bagging for winnowing winnowing workers worked for bagging for this crop on for this crop for this crop bagging for this this crop on this plot? bunding for this crop on this plot? members, or hired workers work for plowing for In the dry season, how 4.78 many days did you, your family members, or hired workers work this crop on for threshing for this this plot? crop on this plot?plowing for this crop on this plot? 4.79 Each day, how many workers worked for threshing for for plowing for this crop on this plot? 4.80 Each day, work for puddling for this crop on this plot? 4.81 In the dry season, for puddling for this crop on this plot? how many how many days did hours you, your family worked for members, or hired threshing for workers work for this crop on this crop on winnowing for thisfor puddling for this crop on this plot? 4.82 Each day, how many workers worked for for ridging/mound -making for this crop on this plot? 4.83 Each day, how many hours worked und-making for this crop on this plot? 4.84 In the dry season, und-making for this crop on this plot? 4.85 workers work for bunding for this crop on 4.86 bunding for this crop on this plot? Each day, Each day, how how many days did how many many hours you, your family workers worked for this plot? for members, or hired worked for bagging for winnowing winnowing workers worked for bagging for this crop on for this crop for this crop bagging for this this crop on this plot?bunding for this crop on this plot?     this plot? this plot? crop on this plot? on this plot? on this plot? crop on this plot? this plot? this plot?this plot?crop on this plot?on this plot?on this plot?crop on this plot?this plot?  "}],"sieverID":"73331cc1-b7fc-4cbb-ba55-92d0ad5d5965","abstract":"Thank you for the opportunity to speak with you. We are a research team from IFPRI. We are conducting a survey under the project called \"Understanding smallholder private irrigation in North Central Nigeria\". The survey aims to learn about the recent and current nature of the irrigation practices in Abaji area. You have been selected to participate in an interview that includes questions on topics such as the nature of your irrigation practices, irrigation equipment uses, and irrigation related labor uses. These questions in total will take approximately 1-2 hours to complete and your participation is entirely voluntary. It is possible that you may feel tired as the interview proceeds. You can refuse to participate. If you agree to participate, you can choose to stop at any time or to skip any questions you do not want to answer. Your answers will be completely confidential; we will not share information that identifies you with anyone. After entering the questionnaire into a data base, we will destroy all information such as your name which will link these responses to you. There is no direct benefits to you from participating in this interview. However, the information collected from you can significantly help the government and donors to improve their support programs for the irrigation sector in Abaji area as well as the whole of Nigeria.You can ask questions about the research anytime during the interview. If in the future you have any questions regarding survey and the interview, or concerns or complaints we welcome you to contact the following:"}

data/part_3/0cece3d7ae0a239d45e0e0975aa936dd.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0cece3d7ae0a239d45e0e0975aa936dd","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8dcf6cbb-cf7d-4843-9237-7cf04364f9d2/retrieve"},"pageCount":16,"title":"","keywords":[],"chapters":[{"head":"¿POR QUÉ ES IMPORTANTE REALIZAR ANALISIS DE PAISAJE EN SAF DE CACAO?","index":1,"paragraphs":[{"index":1,"size":15,"text":"• Los sistemas productivos de cacao se desarrollan en entornos biofísicos de alta vulnerabilidad ecológica"},{"index":2,"size":27,"text":"• Dualidad: Deforestación para implementación de SAF cacao con sombrío monocultural (incluso cacao a libre exposición), pero también contribuyen a mejorar estructura del paisaje en coberturas multiespecie"},{"index":3,"size":48,"text":"• Los SAF son multifuncionales. La paz ha sido reseñada como una función social de los paisajes (Renting, et al., 2009) • Existen preguntas sobre como diversificar el ingreso económico en los SAF -conocer los PSE, certificaciones basadas en manejo de paisaje, puede ser un paso hacia adelante"}]},{"head":"¿QUÉ ES Y POR QUÉ ES IMPORTANTE LA EAP?","index":2,"paragraphs":[{"index":1,"size":26,"text":"¿Cómo son las características biofísicas de la EAP en sistemas productivos de cacao, que deben ser consideradas en el co-diseño de acciones a nivel de paisaje?"},{"index":2,"size":20,"text":"• Es un indicador multicriterio y multifuncional que supone la interacción entre las fincas (individualmente) con el entorno: paisaje productivo"},{"index":3,"size":22,"text":"• Complementa otro tipo de análisis (riqueza, diversidad) que entregan información de diagnóstico a escala de paisaje para procesos de planificación: co-diseño"},{"index":4,"size":21,"text":"• Los procesos de co-diseño demandan información para focalizar acciones de mayor impacto. La EAP indica cuáles son algunos caminos posibles."},{"index":5,"size":5,"text":"Estudio de caso: METODOLOGÍA 1."},{"index":6,"size":1,"text":"2."}]},{"head":"3","index":3,"paragraphs":[{"index":1,"size":29,"text":"• 100 unidades productivas de cacao -serán 345 en total • Georefenciación participativa • Validación con imágenes satelitales • Procesamiento de imágenes y medición de atributos con SIG (ArcGIS)"}]},{"head":"Determinación de variables","index":4,"paragraphs":[{"index":1,"size":19,"text":"1. Localización de UPAS 2. Determinación de centroide del polígono 3. Determinación del Área de influencia de la finca"},{"index":2,"size":77,"text":"Cálculo distancia de UPA a EEP 4. Descarga de SHP de coberturas boscosas de los territorios 5. Identificación de coberturas boscosas en el área de influencia 6. Medir las distancias del centroide a cada parche de vegetación 7. Sumatoria de las distancias de cada parche Cálculo de densidad boscosa en el área de influencia 8. Calcular el área de cada parche de bosque dentro del área de influencia 9. Sumatoria de áreas de bosque en cada UPA"}]},{"head":"CONEXIÓN CON LA EEP","index":5,"paragraphs":[{"index":1,"size":21,"text":"No se incluye parámetro de conectividad con cuerpos de agua, pues en este caso son inexistentes dentro de áreas de influencia."},{"index":2,"size":24,"text":"Caracterización de aspectos y elementos de las UPAS (Linderos con cerca viva/ sin cerca viva, conectores con fragmentos de bosque y áreas de conservación)"}]},{"head":"Levantamiento predial","index":6,"paragraphs":[{"index":1,"size":47,"text":"Identificación de elementos que contiene cada UPA Medición de distancias de cada uno de los elementos de importancia (ArcGIS). Sumatoria de las distancias de todos los elementos de importancia de la finca Determinación del porcentaje de linderos con cerca viva respecto al perímetro total de la UPA"}]},{"head":"Calculo de la conectividad","index":7,"paragraphs":[]},{"head":"EXTENSIÓN DE CONECTORES -EXTERNOS E INTERNOS RESULTADOS CONEXIÓN CON LA EEP","index":8,"paragraphs":[{"index":1,"size":24,"text":"La mayoría de las fincas son de tamaño pequeño, y a la vez tienen poca densidad de coberturas boscosas en su área de influencia."},{"index":2,"size":18,"text":"Independientemente de si él área de influencia tiene zonas boscosas o no, las fincas tienen coberturas poco diversificadas"}]},{"head":"Indicador -Extensión de conectores externos","index":9,"paragraphs":[{"index":1,"size":145,"text":"Alto Mira y Frontera 4 3 % d e l a s f i n c a s presentan una extensión de perímetro con cercas vivas de 0, es decir que tienen una extensión < 12% 6 % p r e s e n t a n u n a e x t e n s i ó n d e 3 q u e corresponde a un rango del 12 -25% 1 0 % p r e s e n t a n u n a e x t e n s i ó n d e 6 q u e corresponde a un rango del 25 -50% 3 % p r e s e n t a n u n a e x t e n s i ó n d e 8 q u e corresponde a un rango del 50 -75% "}]},{"head":"RESULTADOS ALGUNAS CONCLUSIONES PRELIMINARES…","index":10,"paragraphs":[{"index":1,"size":26,"text":"• Fincas pequeñas de los agricultores están desconectadas de la estructura ecológica principal. Tienen poca diversidad interna de coberturas, cercos vivos externos discontinuos e internos discontinuos."},{"index":2,"size":48,"text":"• Es necesario completar el análisis de los siete subindicadores de la EAP para precisar las acciones a continuar… sin embargo… • Acciones individuales • establecimiento de cercas vivas externas e internas (especies de sombrío común, que provean bienes y servicios dentro de la finca) • Acciones grupales"},{"index":3,"size":25,"text":"• Mejora de densidad boscosa en áreas de influencia. Definir zonas comunes para parches de bosques, corredores verdes. Especies de sucesión tardía y sombrío común"},{"index":4,"size":29,"text":"• Estas acciones de diversidad planeada derivan en mejora de valores ecológicos del paisaje (incluso con biodiversidad no planeada) y favorecen los valores ecológicos dentro de la finca -multifuncionalidad"}]}],"figures":[{"text":"RESULTADOS Indicador -Extensión de conectores externos  Alto Mira y Frontera 61% de las fincas con d e e x t e n s i ó n d e conectores de 0, es 12% extensión muy baja < decir que tienen una Bajo Mira y Frontera 31% de las fincas de Alto Mira y Frontera con 0 1% presentan una extensión de 3 1% presentan una extensión de 6 Bajo Mira y Frontera 35% de las fincas co 0 del 25 -50% km corresponde a un rango extensión de 6 que 2 % presentan una Porcentaje de UPAS con Conectores externos 11% VI 6 VI 3 7% 4 % V I 1 0 4 % Porcentaje de UPAS con Conectores internos V I 8 2% 1% 1% De la extensión de los conectores externos de las UPAS presentan: -74% perímetro extremadamente discontinuo (Valor de indicador 0) -11% perímetro discontinuo (Valor de indicador 6) Extensión lineal de conectores de vegetación sobre el total de la longitud de las divisiones internas de la finca que separan las diferentes áreas productivas de las UPAS son: Alto Mira y Frontera 61% de las fincas con d e e x t e n s i ó n d e conectores de 0, es 12% extensión muy baja < decir que tienen unaBajo Mira y Frontera 31% de las fincas de Alto Mira y Frontera con 0 1% presentan una extensión de 3 1% presentan una extensión de 6 Bajo Mira y Frontera 35% de las fincas co 0 del 25 -50% km corresponde a un rango extensión de 6 que 2 % presentan unaPorcentaje de UPAS con Conectores externos 11% VI 6 VI 3 7% 4 % V I 1 0 4 % Porcentaje de UPAS con Conectores internos V I 8 2% 1% 1%De la extensión de los conectores externos de las UPAS presentan: -74% perímetro extremadamente discontinuo (Valor de indicador 0) -11% perímetro discontinuo (Valor de indicador 6) Extensión lineal de conectores de vegetación sobre el total de la longitud de las divisiones internas de la finca que separan las diferentes áreas productivas de las UPAS son: 1 % presentan una extensión de 8 que corresponde a un rango del 50 -75% km 1% presentan una extensión de 8 4% presentan una extensión de 10 que corresponde a un rango del 75 -100% km 1 % p r e s e n t a n u n a extensión de 10 que corresponde a un rango del 75 -100% km 74% Valor de indicador 0 -7% Perímetro fuertemente discontinuo (Valor de indicador 3) -4% perímetro moderadamente -96% Conexión muy baja -2% Conexión mediana -1% Conexión muy alta -1% conexión alta 1 % presentan una extensión de 8 que corresponde a un rango del 50 -75% km1% presentan una extensión de 8 4% presentan una extensión de 10 que corresponde a un rango del 75 -100% km 1 % p r e s e n t a n u n a extensión de 10 que corresponde a un rango del 75 -100% km74% Valor de indicador 0-7% Perímetro fuertemente discontinuo (Valor de indicador 3) -4% perímetro moderadamente -96% Conexión muy baja -2% Conexión mediana -1% Conexión muy alta -1% conexión alta   96% Valor de indicador 0 continuo (Valor de indicador 8) -4% Perímetro continuo 96% Valor de indicador 0continuo (Valor de indicador 8) -4% Perímetro continuo    (Valor de indicador 10) (Valor de indicador 10)   Total de UPAS: 100 Total de UPAS: 100  Total de UPAS: 100 Total de UPAS: 100  "}],"sieverID":"76bc78e2-1174-4e20-b7ab-6ae64c271f62","abstract":""}

data/part_3/0db74f5d679bfce5637df422d02cb8c0.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0db74f5d679bfce5637df422d02cb8c0","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H042038.pdf"},"pageCount":12,"title":"Converting Rain into Grain: Opportunities for Realizing the Potential of Rain-fed Agriculture in India","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":134,"text":"India ranks first among the rain-fed agriculture practicing countries of the world both in terms of extent (86 M ha) and value of the produce. Due to low opportunities and higher population of landless households and agricultural laborers as well as low land and labor productivity, poverty is concentrated in rain-fed regions (Singh 2001). Yield gap analyses, undertaken by Comprehensive Assessment of Water in Agriculture (CA 2007) for major rain-fed crops found farmer's yield being a factor 2-4 times lower than achievable yields for major rain-fed crops. Grain yield oscillates around 1-2 t/ha compared with attainable yields of over 4-5 t/ha (Falkenmark and Rockstrom1993). The large yield gap between attainable yields and farmers' practice as well as between attainable and potential yields shows that a large potential of rainfed agriculture remains to be tapped."},{"index":2,"size":200,"text":"Rainfall is a truly random factor in the rain-fed production system and its variation and intensity is high in areas of low rainfall. Semi-arid regions, however, may receive enough annual rainfall to support crops but it is distributed so unevenly in time or space that rainfed agriculture becomes unviable (Reij et al. 1988). Rockstrom and Falkenmark 2000 note that due to the high rainfall variation, a decrease of one standard deviation from the mean annual rainfall often leads to the complete loss of crop. Agricultural droughts, where primarily a skewed distribution of rainfall causes drought in the root zone, are more frequent than the real meteorological droughts. Dry spells (or monsoon breaks), which generally are 2-4 weeks of no rainfall during critical stages of plant growth causing partial or complete crop failures, often occur every cropping season. Therefore, besides several other factors related to agriculture sector as a whole, adverse meteorological conditions resulting in long dry spells and droughts, unseasonal rains and extended moisture stress periods with no mechanisms for storing and conserving the surplus rain to tide over the scarcity/ deficit periods were identified as the major cause for non-remunerative yields and heightened distress in rainfed regions (Kanwar 1999)."},{"index":3,"size":43,"text":"Supplemental (or deficit) irrigation is a key strategy, so far underutilized on a regional basis, to unlock rain-fed yield potentials. Supplemental irrigation to bridge dry spells in rain-fed agriculture has the potential of increasing yields and minimizing risks for rain induced yield loss."},{"index":4,"size":217,"text":"The existing evidence indicates that supplemental irrigation ranging from 50-200 mm/ season (500-2,000 m3/ha) is sufficient to mediate yield reducing dry spells in most years and rainfed systems, and thereby stabilize and optimize yield levels (Wani and Ramakishna 2005). Since irrigation water productivity is much higher when used conjunctively with rainwater (supplemental), it is logical that under limited water resources priority in water allocation may be given to supplementary irrigation (Agarwal 2000;Joshi et al. 2005). Collecting small amounts using limited macro-catchments, water harvesting during rainy season in the potential regions/ districts can achieve this. Under the 'Strategic Analyses of India's National River Linking Project', a study was, therefore, made to estimate the available runoff in the potential regions to mitigate the terminal drought in the dominant rain-fed districts of India. The study developed a criterion and identified the dominant rain-fed districts for major rainfed crops in India, made an assessment of the surplus runoff available for water harvesting and supplemental irrigation in these districts, estimated the regional water use efficiency and increase in production due to supplemental irrigation for different crops across the dominant districts and made a preliminary estimate of the economics of the proposed intervention. The next sections of the paper describe in brief the methodology and assumptions; and results and conclusions of the study."}]},{"head":"Identification of Dominant Rain-fed Districts","index":2,"paragraphs":[{"index":1,"size":246,"text":"A district (with an average size of ~ 0.5 M ha) is identified as the administrative and planning unit in India and all data sets pertaining to agriculture, water resources, climate, human development and related parameters are available for the district; so, 'district' was considered as unit of analysis for this research. Rain-fed crops in varying proportions are cultivated throughout the rural landscape of the country. The earlier classifications of rainfed areas were based on fixed or variable percentages of irrigated area (Kerr et al. 1996) in the district irrespective of the area under major rain-fed crops. An improved criterion for the identification of rain-fed districts for a given crop was based on the total rain-fed area under the crop in the district (CRIDA 1998). For the present analysis, districts in the descending order of area coverage limiting to cumulative 85 % of total rain-fed area for each crop were identified and termed as 'dominant rain-fed districts' for a given crop. Crops covered were sunflower, soybean, rapeseed mustard, groundnut, castor, cotton, sorghum, pearl millet, maize and pigeon peas in kharif (rainy season) and linseed and chickpeas in rabi (winter season). The 5-year averages (1995)(1996)(1997)(1998)(1999)(2000) of the irrigated area, production and the total cropped area were prepared on district basis. Crop-specific dominant rainfed districts helped to delineate the major region for the given crop. Details on total districts in rain-fed states and 'dominant districts' covering 85 % of the rain-fed crop area are given in Table 1."},{"index":2,"size":49,"text":"Such identification shows that each of the rain-fed crops has a particular agro-climatic niche and its cultivation is concentrated in certain selected districts. Productivity and other development activities related to a specific crop should be taken up first in these identified districts to ensure a major impact on productivity. "}]},{"head":"Assessment of Available Surplus Runoff for Water Harvesting and Supplemental Irrigation","index":3,"paragraphs":[{"index":1,"size":498,"text":"The total rainfall in India is spread over few rainy days and fewer rain events (about 100 hours in the season) with high intensity resulting in large surface runoff and erosion and temporary stagnation. In either of the cases this 'green water' is not available for plant growth and has very low productivity. Local harvesting of a small part of this water and utilizing the same for supplementary/ protective irrigation to mitigate the impacts of devastating dry spells offers a good opportunity in the fragile rain-fed systems (Rockstrom 2001;Sharma et al. 2005;Wani et al. 2003). For national/ regional level planning on supplementary irrigation, one needs to make an assessment of the total and available surplus runoff and potential for its gainful utilization. In the present study, both crop season-wise and annual water balance analyses were done for each of the selected crops cultivated in the identified districts. Whereas, annual water balance analysis assessed the surplus and/or deficit during the year to estimate the water availability and losses through evaporation, the seasonal crop water balance analysis assessed changes in the temporal availability of rainfall and plant water requirements. Water requirement satisfaction index was used for assessing the sufficiency of rainfall vis-à-vis the crop water requirements. The total surplus from a district is obtained by the multiplication of seasonal surplus with the rain-fed area under the given crop .The total surplus available from a cropped region is obtained by adding the surplus from individual dominant districts identified for each crop. An estimated amount of 11.5 M ha-m runoff is generated through 39 M ha of the prioritized rain-fed area. Out of the surplus of 11.5 M ha-m, 4.1 M ha-m is generated by about 6.5 M ha of rain-fed rice alone. Another 1.32 and 1.30 M ha-m of runoff is generated from soybeans (2.8 M ha) and chickpea (3.35 M ha), respectively. Total rain-fed coarse cereals (10.7 M ha) generate about 2.1M ha-m of runoff. Spatial distribution of runoff on agro-ecological sub-region river basin wise is shown in Figure 1. However, based on experiences from watershed management research and large-scale development efforts, practical harvesting of runoff is possible only when the harvestable amount is greater than 50 mm or greater than 10 % of the seasonal rainfall (minimum utilizable runoff, CRIDA 2001). This constitutes about 10.5 M ha of rain-fed area which generates a seasonal runoff of less than 50 mm (10.25 M ha) or less than 10 % of the seasonal rainfall (0.25 M ha). Thus, the total estimated runoff surplus for various rain-fed crops is about 11.4 million ha-m (114.02 billion cubic meters, BCM) from about 28.5 million ha which could be considered for water harvesting (Table 2). Among individual crops, rain-fed rice contributes a higher surplus (4.12 M ha-m from an area of 6.33 M ha) followed by soybeans (1.30 M ha-m from 2.8 M ha). The deficit of rainfall for meeting crop water requirement is also visible for crops like groundnut, cotton, chickpea and pigeon pea."},{"index":2,"size":226,"text":"Long-and short-term agricultural droughts and more pronounced meteorological droughts are a common and recurrent phenomenon in the rain-fed areas served by monsoons. Though there is a good amount of surplus available as runoff in a season, all the runoff is not available at one time during the season. For the southwest Indian monsoon, usually there are two peaks of rainfall, the first occurring immediately after the onset of monsoon and the second during its withdrawal phase. During these two periods, there is a likely certainty of overflows (Ramakrishna et al. 1998) which can be harvested in suitable structures to mediate the randomness and enhance the structured supply of rainwater. Normally, farmers (depending on the method of irrigation) apply an irrigation to a depth of 30 to 50 mm as supplemental/ deficit irrigation in rain-fed areas. Actually the objective of supplemental irrigation is to adequately recharge the upper dry soil profile and connect it with the moist profile prevailing in the deeper soil layers so as to provide continuity to the flow process. In the present study, an amount of 100 mm was considered per irrigation including the conveyance and other losses. This quantity of irrigation may appear to be high but was forced due to a vast number of untrained water managers, uneven farm lands and the lack of suitable irrigation infrastructure available with rain-fed farmers."},{"index":3,"size":186,"text":"Based on this available surplus, the irrigable area was estimated for a single supplemental irrigation of 100 mm at the reproductive stage of the crop. This was estimated for both normal rainfall and drought years. Runoff during a drought year is assumed to be 50 % of the runoff/ surplus during a normal rainfall year (based on authors' estimates for selected districts and rain-fed crops in Andhra Pradesh). The potential irrigable area (through supplementary irrigation) for both scenarios is given below (Table 3). Out of 114 billion cubic meters available as surplus, about 28 billion cubic meters (19.4 %) is needed for supplemental irrigation to irrigate an area of 25 million ha during a normal monsoon year thus leaving about 86 M ha-m (80.6 %) to meet river/environmental flow and other requirements. During drought years also about 31 billion cubic meters is still available even after making provision for irrigating 20.6 million ha. Thus it can be seen that water harvesting and supplemental irrigation may not seriously jeopardize the available flows in rivers even during drought years or cause significant downstream effects in the normal years."}]},{"head":"Rainwater Use Efficiency and Production Potential of Rain-fed Crops","index":4,"paragraphs":[{"index":1,"size":534,"text":"Water use efficiency (WUE), is normally defined as grain yield (or value of the produce) per unit of water used/ transpired, measured in kilograms (or monetary units) per hectare per millimeter of water (kg/ha/mm, $/ha/mm) applied/ used (Molden 2001). At a regional scale, the estimation of rainwater use efficiency (RWUE) could be obtained by aggregating the rainwater use efficiency available at field scale. However, it is not a viable practical solution as the data requirement is quite large (in terms of productivity values from each parcel of land, inflow/outflow as surface/ sub-surface flow from cultivated fields etc.). Thus, a simple method to estimate RWUE at regional scale is to utilize the existing database of productivity statistics (available at district level) and to derive the estimate of rainfall utilized for production purposes (i.e., rain water use efficiency as a ratio of productivity at district level to the effective rainfall).Water use efficiency under rainfed agriculture is not a consistent value as evidenced in irrigated agriculture. In rain-fed areas, the WUE varies from district to district and from year to year based on the pattern of rainfall occurrence with drought years giving a higher value of water use efficiency. The present study aggregates water use efficiency at district level for major rain-fed crops. At the field level, the effective rainfall was estimated by the procedure developed under CROPWAT and water productivity was estimated as the ratio of crop productivity at district level (5-year average) to the effective rainfall received at the district. This analysis was carried out for various rain-fed crops in respective dominant rain-fed districts. Achievable yields from on-farm trials and longterm average rainfall for each dominant rain-fed district and for different rain-fed crops were used for estimating the 'achievable' water use efficiency (Table 4). Production projections were made for different crops in the respective rain-fed districts using the information on regional rainwater use efficiency from both scenarios, namely; district averages and on farm trials hereafter referred to as 'traditional practices' and 'improved technologies', respectively and supplemental irrigation of 100 mm at reproductive stage. Secured crop water supply (though of a limited amount) during critical drought spells reduces the risks for crop failure, thereby increasing farmers' incentives to invest in farm inputs, such as fertilizers, improved seeds, crop protection and diversification (Falkenmark et al. 2001). Trials of water harvesting and its strategic application (supplementary irrigation) in Burkina Faso, Kenya, Niger, Sudan and Tanzania have also shown increased yields of 2-3 times of those achieved in dryland farming (FAO 2002). The improved technologies involve the adoption of improved varieties, application of recommended doses of fertilizers, better management and follow-up on recommended package of practices etc. The estimated production projections for each crop and district and aggregates based on individual crop with improved practices and over two types of seasons (normal and drought) summarized for crops and groups of crops are given in Table 5. Additional production was a product of irrigable area, water use efficiency and the amount of irrigation. The irrigable area through supplemental irrigation (at 100 mm) for different crops during drought season varies between 50-98 % (98 % for rice crop to 50 % for sunflower districts) of the irrigable area during normal season."},{"index":2,"size":167,"text":"Improved technologies, along with water, play an important part to harness the potential benefits. Under improved management practices an average of 50 % increase in total production cutting across drought and normal seasons is realizable with supplemental irrigation from rainfed area of 27.5 M ha (Table 5). Production enhancement in drought season in case of rice crop is high due to higher water application efficiency and due to the sufficient surplus to bring almost the entire rice cultivated area under supplemental irrigation. This would also indicate that large tracts of rain-fed rice cultivated area are covered under high rainfall zones with sufficient surplus for rainwater harvesting. Similar situation could be observed for soybean, which also reflects the concentration of crop growing area in high rainfall zones. In case of other crops, though water application efficiency is higher during the drought scenario, lack of surplus to cover entire area reduces the total production. Significant production improvements can be realized in rice, sorghum, maize, cotton, sesame, soybeans and chickpea."},{"index":3,"size":204,"text":"The success of Green Revolution in irrigated areas is one solid example built upon irrigation and improved technologies. Everyone of the stakeholders from supplier to farmer to market responded with equal enthusiasm. A second Green Revolution is not in the offing for a long time for the reason that this needs to be staged in water scarcity/insufficiency zone. In the absence of stabilized yields, a production system of marketable value could not be put in place unlike in irrigated rice-wheat and other intensive production systems. The various stakeholders from start to end could not be enthused. However, the improved watersheds did to a little extent what irrigation could do to large assured areas. The mechanisms and processes for both scaling-out and scaling-up the impacts generated at the 'bright spots' have still eluded the development planners and implementing agencies in India (Sharma et al. 2005). Still, it has been observed that the input use like hybrid seed, fertilizers, and plant protection are on the increase with watershed activities especially associated with increase in supplemental irrigation and cropping intensity (Joy and Paranjape 2004). Concerted efforts are required through development of the local water resources to stretch the boundaries of these oases to cover the vast drylands."}]},{"head":"Economics of Water Harvesting and Supplemental Irrigation","index":5,"paragraphs":[{"index":1,"size":338,"text":"While it appears that supplemental irrigation offers scope for enhancing production from rainfed crops across different agro-ecologies/districts, it is also essential that the same need to be economically viable. Numerous such structures have been constructed under varying agroclimatic conditions under state sponsored programs, by nongovernmental organizations and even with individual initiatives. The available literature also has good evidence on the technical and financial viability of the construction of such water harvesting structures for the improvement of productivity and diversification of agriculture in the rain-fed areas (Oweis 1997;Kurien 2005). The cost of provision of supplemental irrigation through construction water harvesting structures varies a great deal between states/ regions and locations between the same state (Sharda 2003;Samra 2007, personal communication;Table 6). Hence a simple analysis based on the national average cost for rainwater harvesting structures (INR 18,500 per hectare) was carried out for the provision of supplemental irrigation to rain-fed crops. The crop-wise annualized cost, considering the useful life of lined structures as 20 years, is given in Table 7. It suggests that an estimated INR 50 billion is annually required to provide supplemental irrigation to around 28 million hectares of rain-fed-cultivated land and about half of that amount is required for rice and coarse cereal production only. The benefit is evaluated based on the price of the crop and the yield difference from supplemental irrigation. With the adoption of improved practices in conjunction with supplemental irrigation, net benefits become positive for all crops except pearl millet indicating the need for development/ general adoption of high yielding varieties of pearl millet, which are responsive to irrigation and improved practices (Table 7). Pearl millet, sorghum and maize continue to be the crops with a very low harvest index. However, the data indicate that the net benefits improve by about, three-times for rice, four-times for pulses and six-times for oilseeds. Droughts appear to have very mild impact when farmers are equipped with supplemental irrigation and the net benefits remain stable even when runoff during a drought period gets reduced by 50 %."}]},{"head":"Conclusion","index":6,"paragraphs":[{"index":1,"size":277,"text":"Rain-fed agriculture is mainly and negatively influenced by the random behavior of rainfall, causing intermittent dry spells during the cropping season and especially, at critical growth stages coinciding with the terminal growth stage. District level analysis for different rain-fed crops in India showed that the difference in the district average yields for rain-fed crops among different rainfall zones was not very high, indicating that the total water availability may not be the major problem in different rainfall zones. Further, for each crop, there were few dominant districts which contributed most to the total rain-fed crop production. The most effective potential strategy to realize the potential of rain-fed agriculture in India (and elsewhere) appears to be harvesting a small part of available surplus runoff and reutilizing it for supplemental irrigation at different critical crop growth stages. The study identified about 27.5 M ha of potential rain-fed area, which accounted for most of the rain-fed production and generated sufficient runoff (114 BCM) for harvesting and reutilization. It was possible to raise the rainfed production by 50 % over this entire area through application of one supplementary irrigation (28 BCM) and some follow up on the improved practices. Extensive area coverage rather than intensive irrigation needs to be done in regions with higher than 750 mm/ annum rainfall, since there is a larger possibility of alleviating the in-season drought spells and ensuring the second crop with limited water application. This component may be made an integral part of the ongoing and new development schemes in the identified rural districts. The proposed strategy is environmentally benign, equitable, poverty-targeted and financially attractive to realize the untapped potential of rain-fed agriculture in India."}]}],"figures":[{"text":"Figure 1 . Figure 1. Spatial distribution of surplus runoff (ha-m) across dominant rain-fed districts and river basins. "},{"text":"Table 1 . Total and 'dominant districts' for the important rain-fed crops in India. Crop Rain-fed states Districts covering CropRain-fed statesDistricts covering   cumulative 85 % of rain-fed area cumulative 85 % of rain-fed area   (dominant districts) (dominant districts) Sunflower 224 11 Sunflower22411 Soybean 202 21 Soybean20221 Rapeseed mustard 265 29 Rapeseed mustard26529 Groundnut 316 50 Groundnut31650 Castor 202 12 Castor20212 Cotton 296 30 Cotton29630 Sorghum 346 71 Sorghum34671 Pearlmillet 346 43 Pearlmillet34643 Maize 346 67 Maize34667 Pigeon pea 266 83 Pigeon pea26683 Chickpea 346 85 Chickpea34685  "},{"text":"Table 2 . Potentially harvestable surplus runoff available for supplemental irrigation under different rain-fed crops of India. Crop group Crop Rain-fed crop area Surplus Deficit Crop groupCropRain-fed crop areaSurplusDeficit   ('000 ha) (ha-m) (ha-m) ('000 ha)(ha-m)(ha-m) Cereals Rice 6,329 4,121,851 0 CerealsRice6,3294,121,8510 Coarse cereals Finger millet 303 153,852 0 Coarse cerealsFinger millet303153,8520  Maize 2,443 771,890 0 Maize2,443771,8900  Pearl millet 1,818 359,991 0 Pearl millet1,818359,9910  Sorghum 2,938 771,660 0 Sorghum2,938771,6600 Total (coarse cereals)  7,502 2,057,393 0 Total (coarse cereals)7,5022,057,3930 Fiber Cotton 3,177 757,575 8,848 FiberCotton3,177757,5758,848 Oilseeds Castor 28 14,489 0 OilseedsCastor2814,4890  Groundnut 1,663 342,673 1,646 Groundnut1,663342,6731,646  Linseed 590 306,360 0 Linseed590306,3600  Sesame 1,052 416,638 0 Sesame1,052416,6380  Soybeans 2,843 1,329,251 0 Soybeans2,8431,329,2510  Sunflower 98 11811 0 Sunflower98118110 Total (oilseeds)  6,273 2,421,222 1,646 Total (oilseeds)6,2732,421,2221,646 Pulses Chickpea 3,006 1,304,6829,166  PulsesChickpea3,0061,304,6829,166  Green gram 458 80135 0 Green gram458801350  Pigeon pea 1,823 659,328 238 Pigeon pea1,823659,328238 Total (pulses)  5,288 2,044,145 9,404 Total (pulses)5,2882,044,1459,404 Grand total  28,568 11,402,186 19,898 Grand total28,56811,402,18619,898  "},{"text":"Table 3 . Irrigable area ('000 ha) through supplemental irrigation (100 mm per irrigation) during normal and drought years under different rain-fed crops. Crop group Crop Rain-fed crop area Irrigable area Irrigable area Crop groupCropRain-fed crop areaIrrigable areaIrrigable area   ('000 ha) ('000 ha) during ('000 ha) during ('000 ha)('000 ha) during ('000 ha) during    normal monsoon drought season normal monsoondrought season Cereals Rice 6,329 6,329 6,215 CerealsRice6,3296,3296,215 Coarse cereals Finger millet 303 266 224 Coarse cerealsFinger millet303266224  Maize 2,443 2,251 1,684 Maize2,4432,2511,684  Pearl millet 1,818 1,370 837 Pearl millet1,8181,370837  Sorghum 2,938 2,628 1,856 Sorghum2,9382,6281,856 Total (coarse cereals)  7,502 6,515 4,601 Total (coarse cereals)7,5026,5154,601 Fiber Cotton 3,177 2,656 1,725 FiberCotton3,1772,6561,725 Oilseeds Castor 28 25 22 OilseedsCastor282522  Groundnut 1,663 1,096 710 Groundnut1,6631,096710  Sesame 1,052 919 741 Sesame1,052919741  Soya beans 2,843 2,843 2,667 Soya beans2,8432,8432,667  Sunflower 98 59 30 Sunflower985930 Total (cilseeds)  5,684 4,942 4,171 Total (cilseeds)5,6844,9424,171 Pulses Chickpea 3,006 2,925 2,560 PulsesChickpea3,0062,9252,560  Pigeon pea 1,823 1,710 1,374 Pigeon pea1,8231,7101,374 Total (pulses)  4,829 4,634 3,934 Total (pulses)4,8294,6343,934 Grand total  27,520 25,076 20,647 Grand total27,52025,07620,647  "},{"text":"Table 4 . Estimated water use efficiency values based on 'achievable yields' (improved technologies) for different rain-fed crops*. Crop group Crop  Water use efficiency (kg/ha/mm) Crop groupCropWater use efficiency (kg/ha/mm)   Average Maximum Minimum AverageMaximumMinimum Cereals Rice 9.40 7.34 11.29 CerealsRice9.407.3411.29 Coarse cereals Finger millet 6.80 6.30 8.01 Coarse cerealsFinger millet6.806.308.01  Maize 10.97 8.44 13.70 Maize10.978.4413.70  Pearl millet 8.67 6.96 11.31 Pearl millet8.676.9611.31  Sorghum 13.51 11.22 17.72 Sorghum13.5111.2217.72 Fiber Cotton 1.60 1.23 1.97 FiberCotton1.601.231.97 Oilseeds Castor 3.50 3.18 3.67 OilseedsCastor3.503.183.67  Groundnut 3.75 2.88 4.69 Groundnut3.752.884.69  Sesame 3.11 2.48 3.68 Sesame3.112.483.68  Soybean 7.11 5.38 8.15 Soybean7.115.388.15  Sunflower 3.05 2.97 3.13 Sunflower3.052.973.13 Pulses Chickpea 5.19 3.90 6.25 PulsesChickpea5.193.906.25  Pigeon pea 2.44 1.86 2.96 Pigeon pea2.441.862.96  "},{"text":"Table 5 . Yield increases with supplemental irrigation (SI) in normal and drought seasons at two irrigation efficiencies (based on WUE of improved technologies). Crop Crop Rain-Traditional Irrigable area  Additional production CropCropRain-TraditionalIrrigable areaAdditional production group  fed production ('000 ha)  ('000 tonnes)  groupfedproduction('000 ha)('000 tonnes)   cropped ('000   Normal monsoon Drought season cropped('000Normal monsoonDrought season   area ('000 ha) tonnes) Normal Drought 60 % season 1 season 1 SI 70 % SI 65 % SI 75 % SI area ('000 ha)tonnes)Normal Drought 60 % season 1 season 1 SI70 % SI65 % SI75 % SI       effi effi effi effi effieffieffieffi       ciency ciency ciency ciency ciencyciencyciency ciency Cereals Rice 6,329 7,612 6,329 6,215 3,549 4,141 3,776 4,357 CerealsRice6,3297,6126,329 6,2153,5494,1413,7764,357 Coarse Finger millet 303 271 266 224 107 124 97 112 CoarseFinger millet30327126622410712497112 cereals Maize 2,443 2,996 2,251 1,684 1,495 1,744 1,221 1,408 cerealsMaize2,4432,9962,251 1,6841,4951,7441,2211,408  Pearl millet 1,818 1,902 1,370 837 717 836 481 555 Pearl millet1,8181,9021,370837717836481555  Sorghum 2,938 3,131 2,628 1,856 2,091 2,439 1,616 1,864 Sorghum2,9383,1312,628 1,8562,0912,4391,6161,864  Total coarse 7,502 8,300 6,515 4,601 4,409 5,144 3,414 3,939 Total coarse7,5028,3006,515 4,6014,4095,1443,4143,939  cereals         cereals Fiber Cotton 3,177 430 2,656 1,725 252 294 178 206 FiberCotton3,1774302,656 1,725252294178206 Oilseeds Castor 28 10 25 22 5 6 5 6 Oilseeds Castor281025225656  Groundnut 1,663 1,182 1,096 710 244 284 176 203 Groundnut1,6631,1821,096710244284176203  Sesame 1,052 365 919 741 173 202 153 176 Sesame1,052365919741173202153176  Soya beans 2,843 2,607 2,843 2,667 1,225 1,429 1,250 1,443 Soya beans2,8432,6072,843 2,6671,2251,4291,2501,443  Sunflower 98 49 59 30 11 12 6 7 Sunflower98495930111267  Total oilseeds 5,684 4,214 4,942 4,171 1,657 1,933 1,590 1,834 Total oilseeds 5,6844,2144,942 4,1711,6571,9331,5901,834 Pulses Chickpea 3,006 2,367 2,925 2,560 910 1,061 866 1,000 PulsesChickpea3,0062,3672,925 2,5609101,061866 1,000  Pigeon pea 1,823 1,350 1,710 1,374 242 282 212 245 Pigeon pea1,8231,3501,710 1,374242282212245  Total pulses 4,829 3,717 4,635 3,934 1,152 1,344 1,078 1,244 Total pulses4,8293,7174,635 3,9341,1521,3441,0781,244 Grand total  27,520 24,272 25,076 20,647 11,020 12,856 10,037 11,581 Grand total27,52024,27225,076 20,647 11,020 12,856 10,037 11,581  "},{"text":"Table 6 . Cost of different water harvesting structures per hectare of the service area at different locations in India. Location Cost ( Indian Rs.*.) of water harvesting structures LocationCost ( Indian Rs.*.) of water harvesting structures   (2000 price level)  (2000 price level)  Minimum Maximum Average MinimumMaximumAverage Bagbahrar (Chhatisgarh) 4,100 29,200 11,000 Bagbahrar (Chhatisgarh)4,10029,20011,000 Dindori (Madhya Pradesh) 6,800 25,000 18,000 Dindori (Madhya Pradesh)6,80025,00018,000 Keonjhar(Orissa) 19,400 35,000 27,000 Keonjhar(Orissa)19,40035,00027,000 Darisai(Jharkhand) 8,300 27,800 18,000 Darisai(Jharkhand)8,30027,80018,000 National average 18,500   National average18,500 Note: *1 USD= Indian Rs. 42    Note: *1 USD= Indian Rs. 42  "},{"text":"Table 7 . Crop-wise net benefits from supplemental irrigation under traditional practices and improved technologies during normal and drought conditions. Net benefits under improved Net benefits under improved technologies(Billion Rs.) technologies(Billion Rs.)  "}],"sieverID":"86a07faf-4ad5-4553-8038-a386a87bbce4","abstract":""}

data/part_3/0dd1f82b740c205c50147eddd6c1c372.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0dd1f82b740c205c50147eddd6c1c372","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7ee73cfa-a2d0-44cf-a726-dbcb1c7e05ca/retrieve"},"pageCount":1,"title":"Why Conservation Agriculture in Rainfed Drylands in Morocco","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":10,"text":"To support this initiative, ICARDA together with its partners, will: "}]}],"figures":[{"text":"Figure : Figure: Trade-off among agronomic, economic and soil fertility indicators under five years of CA and CT system in Morocco "},{"text":"( i ) Reinforce a strategic R&D to improve spatially explicit CA recommendations in Morocco; (ii) Strengthen the skills in CA through capacity development activities; and (iii) Broaden the network of R&D partners by bringing together various CGIAR Centers, Advance Research Institutions, private sector, NGOs, others.. Project: Promotion du Semis Direct Sur 1 Mha á I'horizon 2030 Map showing soil organic matter (SOM) content in major crop growing region, Morocco Challenges for adoption at scaling Government of Morocco has planned to reach 1.0 M ha area under CA by 2030 Land suitability map for CA: based on the bio-physical environment, 63% of ~ 6.1 M ha are highly to moderately suitable to CA in Morocco "},{"text":"According to recent IPCC report, in Morocco ➢ Rainfall will be reduced by 20% ➢ Temperature will be increased by +2 o C by 2050   Low      Low  Medium      Medium  High      High  Very high      Very high Decades       Decades Indicators Components CT CA % change over  Avilable soil moisture (+14%; **) IndicatorsComponentsCTCA% change overAvilable soil moisture (+14%; **)     CT   CT Grain yield (kg/ha) Average yield 1300+700 1800+500 + 30%  Straw yield (+8%; *) Grain yield (kg/ha)Average yield1300+7001800+500+ 30%Straw yield (+8%; *)  Yield (dry year) 0-600 1000-1200 (+100%) Total income (+19%; **) (+20%; **) Grain yield Yield (dry year)0-6001000-1200(+100%)Total income (+19%; **)(+20%; **) Grain yield Mitigation Carbon sequestration < 1.5% > 2% (+33%)   MitigationCarbon sequestration < 1.5%> 2%(+33%) Adaptation Yield stability Less stable More stable (+ stability) Net return (+41%; ***) Soil potassium level (+4%; ns) AdaptationYield stabilityLess stableMore stable(+ stability)Net return (+41%; ***)Soil potassium level (+4%; ns)  Soil erosion High (30 t/ha Low (-50%) Soil organic matter (+7%); * Soil phosphorus level (+6%; *) Soil erosionHigh (30 t/haLow(-50%)Soil organic matter (+7%); *Soil phosphorus level (+6%; *)      Conventional tillage Conservation Agriculture Conventional tillageConservation Agriculture       Low cost No- Low cost No-       till seeders till seeders  "},{"text":"of research conducted by ICARDA and the National Research team have demonstrated that CA can be an appropriate technology for adaptation to such climate change. It helps sustainably improving the productivity and range of agronomic, economic and soil fertility indicators in variable rainfed drylands. The table below resumes the main research results of long-term research comparing CA vs CT in different regions in Morocco.   "}],"sieverID":"cce865ce-eaa5-4694-b58e-9ae53fc8ead9","abstract":""}

data/part_3/0e7a66aeaf415ba92e154100cd93e26e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0e7a66aeaf415ba92e154100cd93e26e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c8160586-fb8f-495c-9fe0-3641604b6ded/retrieve"},"pageCount":2,"title":"A panel of single nucleotide polymorphisms (SNPs) for genomic imputation and admixture proportion analysis in East African dairy crossbreed breeds","keywords":["P728 -Activity 1","2","1: Genomic Tools Development and Application Contributing CRPs/Platforms: • Livestock -Livestock"],"chapters":[],"figures":[],"sieverID":"450b3d33-8ac1-4c46-b175-e985633f25f5","abstract":"Description of the innovation: Cost-effective high-density (HD) genotypes of livestock species can be obtained by genotyping a proportion of the population using a HD panel and the remainder using a cheaper low-density panel, and then imputing the missing genotypes that are not directly assayed in the low-density panel."}