Upload 1006 files to data/part_2

data/part_2/0034f48c619f6677435db33319352c50.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0034f48c619f6677435db33319352c50","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H_21371i.pdf"},"pageCount":217,"title":"","keywords":[],"chapters":[],"figures":[],"sieverID":"a3e59cac-e54a-4c22-b97f-282d500b70d1","abstract":""}

data/part_2/00a822e38c9646bca6e1033639e6433c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"00a822e38c9646bca6e1033639e6433c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/55357f1f-91b7-49ba-b18f-948432058a63/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"Pacific FL15 and Golfo FL 16: two (2) high-yielding and long-grained rice varieties available for seeds production and commercialization in Mexico","index":1,"paragraphs":[]},{"head":"Milestones:","index":2,"paragraphs":[{"index":1,"size":15,"text":"• 60 lines nominated for release with 15% higher yield and meeting national quality requirements"}]},{"head":"Sub-IDOs:","index":3,"paragraphs":[{"index":1,"size":13,"text":"• 11 -Adoption of CGIAR materials with enhanced genetic gains Contributing Centers/PPA partners:"},{"index":2,"size":15,"text":"• CIAT (Alliance) -Alliance of Bioversity and CIAT -Regional Hub (Centro Internacional de Agricultura Tropical)"}]}],"figures":[{"text":"Project Title: P1671 -CIAT contribution to flagship project 5 Description of the innovation: During 2012-2015 these varieties were selected, from advanced inbred lines delivered by CIAT/FLAR: FL07562-7P-3-3P-2P-M-150pZa-250pZa0Za and FL08224-3P-2-1P-3P-M-150pZa-250pZa-0Za. They have stable yield potential, both in the Pacific and the Gulf of Mexico regions. In 2016 these varieties were released by the National Institute of Forestry, Agricultural and Livestock Research (INIFAP, by its acronym in Spanish) and registered by the National Seed Inspection and Certification Service, named as Pacific FL15 and Golfo FL 16 New Innovation: No Innovation type: Genetic (varieties and breeds) Stage of innovation: Stage 3: available/ ready for uptake (AV) Basic seed was produced by INIFAP in October 2016 and delivered to the Mexican Rice Council in 2017. The first lot of certified seed of both varieties was 300,000 tons Name of lead organization/entity to take innovation to this stage: CIAT (Alliance) -Alliance of Bioversity and CIAT -Regional Hub (Centro Internacional de Agricultura Tropical) Names of top five contributing organizations/entities to this stage: • INIFAP -National Institute of Forestry, Agricultural and Livestock Research / Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias "}],"sieverID":"c6d6a96f-979d-40a1-915c-52cff2535052","abstract":""}

data/part_2/00ced0bb11a736e3d33ec1dcadcd8267.json

@@ -0,0 +1 @@
+{"metadata":{"id":"00ced0bb11a736e3d33ec1dcadcd8267","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/231eb02a-9ee6-43f2-8ad8-7c87a43e2f3a/retrieve"},"pageCount":18,"title":"AMMI and GGE Biplot Analyses for Mega-Environment Identification and Selection of Some High-Yielding Oat (Avena sativa L.) Genotypes for Multiple Environments","keywords":["Wodebo, K.Y.","Tolemariam, T.","Demeke, S.","Garedew, W.","Tesfaye, T.","Zeleke, M.","Gemiyu, D.","Bedeke, W.","Wamatu, J.","Sharma, M. AMMI oat (Avena sativa L.)","biomass yield","GXE Interaction","AMMI","GGE"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":98,"text":"The livestock subsector in Ethiopia significantly contributes to the national income [1] and rural and urban residents' means of subsistence. However, because of a lack of feed and an imbalanced supply of feed, animal output remains poor [2]. The mean oat biomass production of 9.67 t/ha in this study is promising for developing nations like Ethiopia. This country is known for its lengthy dry season, during which there is inadequate plant Plants 2023, 12, 3064 2 of 18 biomass left over from the wet season to maintain domestic livestock species and key issues with feeding livestock arise [3]."},{"index":2,"size":197,"text":"Avena sativa, sometimes known as oat, is a significant multi-use cereal crop that is grown on more than 9 million hectares worldwide for grain, feed, fodder, and straw [4]. It is not very selective in terms of soils and climate and thus can reliably be grown in infertile soils and cool and humid climates [5]. One of the well-adapted and significant fodder crops that grow in Ethiopia's highlands, primarily under rain-fed conditions, is Avena sativa. It is also one of the crucial fodder crops that are frequently cultivated in the winter, when animals confront a shortage of green fodder and the majority of the feed starts to deteriorate and eventually dry out [6]. In terms of cereal output, it comes in sixth place behind wheat, maize, rice, barley, and sorghum. Oats are excellent for making hay in climates that are suitable for them. Oats ensile effectively for use on farms. Compared with wheat or barley straw, oat straw is a more appealing and nutritious feed option for livestock. However, because there are not many breeding programs for fodder oats, cultivars are often developed and produced primarily for grain, and the same cultivars are used for both [7]."},{"index":3,"size":136,"text":"For quantitative variables like yield, a strong genotype-by-environment interaction might limit the relevance of inferences that would otherwise be true and significantly limit the ability to select superior genotypes [8][9][10]. The difference in the genetic ranking of genotypes in relation to the environment-for example, a genotype performing well in wellwatered conditions but poorly in dry situations-is how [11] define genotype-environment interaction. The development of genotypes that can be adapted to a wide range of various settings is the ultimate goal of plant breeders in crop improvement efforts [11]. Finding genotypes whose performance remains stable in a variety of conditions can be accomplished using yield stability analysis [12,13]. The genotypes of oats that perform the best in target conditions and those that are most adaptable to other habitats can thus be found through comparing performance across environments."},{"index":4,"size":27,"text":"Different statistical approaches for analyzing genotype stability can help with the difficult task of discovering superior genotypes in the context of significant G × E interactions [12]."},{"index":5,"size":160,"text":"The genotype, environmental factors, and their interaction have a considerable impact on yield and characteristics [14][15][16]. According to [15], genotype-environment interactions (GEIs) cause genotypes to behave differently in various settings. Breeders want to determine the best growing conditions for their genotype in addition to quantifying the GEI [16]. An ideal stable genotype is one that consistently produces good results for agronomic and quality factors over a wide range of environmental conditions. According to [17], the genotype-environment interaction is usually assessed according to the AMMI (additive main effects and multiplicative interaction) model and GGE biplot analyses in order to predict phenotypic responses to environmental changes in the examined genotypes. In the AMMI approach, principal component analysis (PCA) with multiplicative parameters and analysis of variance (ANOVA) with additive parameters are combined into a single analysis. The main and interaction effects for environments and genotypes are displayed together in the AMMI biplot. Additionally, Ref. [18] offered a solitary examination of the genotype-by-environment interaction."},{"index":6,"size":238,"text":"Powerful methods for examining and providing commentary on multi-environment data structures in breeding operations include the AMMI and GGE biplot models [19,20]. Researchers interested in agriculture are particularly interested in these two statistical analyses (AMMI and GGE). This is due to the fact that they may be applied to any two-way data matrix, even those involving a number of genotypes examined across many sites [21]. These analyses include principal component analysis (PCA) and analysis of variance (ANOVA) [22]. The GGE biplot analysis and the AMMI biplot analysis differ in that the former is based on an environment-centered PCA, while the latter is based on a doublecentered PCA [23]. The majority of genotypes have been reported to exhibit narrow adaptability and significant genotype-by-environment interaction (GEI) effects, despite the fact that oats typically adapt to a broad range of environmental scenarios [24,25]. The significance of extending research efforts to examine the variations in biomass yield across oat genotypes and across settings was studied in this report. This study will help researchers plan the further breeding and production of promising, specific, and widely adapted genotypes. The examination of the performance of oat genotypes in various conditions in Ethiopia is still in its infancy. Therefore, the objectives of this study were to (1) estimate the magnitude of the genotype-by-environment interaction, (2) identify stable genotypes with a high biomass yield based on dry matter, and (3) identify mega-environments to guide future testing strategies."}]},{"head":"Results and Discussion","index":2,"paragraphs":[]},{"head":"AMMI ANOVA","index":3,"paragraphs":[{"index":1,"size":330,"text":"Eleven oat genotypes were examined in four locations using the AMMI model, and the results showed that the environment (E), genotype (G), and genotype-environment interaction (GEI) all had a significant (p < 0.001) impact on the yield of oat (t ha −1 ). AMMI (IPCA1) was highly significant (p < 0.001) according to the AMMI model's analysis of variance (Table 1). This showed that strong genotype-by-environment (GE) interaction caused a significant difference in yield performance among the oat genotypes across the studied environments. As a result, it might be possible to create stable genotypes or entries for a certain environment. This discovery is consistent with several studies that have discovered significant interactions between the environment and genotypes of oats [24][25][26]. Oat biomass dry matter yield was influenced by the genotype-by-environment (GE) interaction effect (49.46%), genotype effect (34.94%), and environment effect (15.60%), according to the total percentage explained by sum-of-squares factors (Table 1). The genotypic response differed significantly among environments, as seen by the fact that the GEI sum-of-squares component was greater than the genotype sum-of-squares factor. Since the GE interaction or the sum of squares contributes more to the overall variance, there is a greater likelihood that cultivars will evolve for a particular environment. In line with these findings, Ref. [25] revealed that the genotype-by-environment interaction effect, followed by genotype and environment, contributed to the biggest overall sum of squares. The result is in contrast to Adjebeng-Danquah [27], who reported that the environment contributed a greater proportion of the treatment sum of squares, followed by the genotype and genotype-by-environment interaction. This was in contrast to findings from [26], who reported that the environment is the most contributing, followed by the genotype-by-environment interaction effect and the genotype effect. Both studies found that environmental conditions had a significant impact on production. This study result shows the yield greatly depends on the environment. However, genotype (G) and genotype-byenvironment interaction (GEI) are relevant to genotype evaluation, whereas the significant environmental influence is irrelevant [26]."},{"index":2,"size":69,"text":"According to [18], the first two IPCAs can be used to forecast the AMMI model that is the most accurate. Several authors took the first two IPCAs for GGE biplot analysis because the greater percentage of genotype-by-environment interaction (GEI), in most cases, were explained by the first IPCA, such as for maize [28], bread wheat [29,30], common bean [29], for finger millet [30], field pea [31] and oat [14,32]."},{"index":3,"size":164,"text":"The AMMI with IPCA1 and IPCA2 is the most effective predictive model for the crossvalidation of the yield variation explained by the GEI [33]. Considering IPCA1 (73.43%) and IPCA2 (14.97%) together, the sums of squares from IPCA1 and IPCA2 contributed 87.43% of the total GEI, with the IPCA1 having a larger sum of squares than genotypes. The entire genotype-by-environment interaction component was adequately explained by the model [34]. Given that it removes the bulk of the real variation, this suggests that the AMMI model with the IPCA1 and IPCA2 were suitable for cross validating the oat biomass dry matter yield variation supplied by GEI in the given data set. The GEI contributes more than genotypes, suggesting a need for research into the basis of the diverse ways that genotypes respond to their surroundings (Table 1). Because GEI weakens the usefulness of genotypes through mystifying their yield performance by means of decreasing the relationship between genotypic and phenotypic characteristics [35,36], GEI complicates the selection process."},{"index":4,"size":110,"text":"The average genotype biomass dry matter yield ranged from 8.65 t ha −1 (ILRI_15152A = #G7) to 12.52 t ha −1 (ILRI_5527A = #G6), while the average environment biomass dry matter yield ranged from 8.50 t ha −1 at Hulla to 10.67 t ha −1 at Adiyo (Table 2). As shown by genotype yield rankings that varied between environments, with the exception of genotypes G6 and G5, some GEI genotypes were of a crossover type (Table 2). The highest biomass dry matter yield across conditions was consistent for genotypes G6 and G5. Thus, the top-ranking genotypes in Chencha, Adiyo, Doyegena, and Hula, respectively, were genotypes G6 and G5 (Table 2). "}]},{"head":"AMMI Biplot","index":4,"paragraphs":[{"index":1,"size":150,"text":"Four parts make up the AMMI1 biplot space (Figure 1), ranging from high-yielding environments in parts 2 (upper right) and 3 (low right) to low-yielding environments in sections 1 (higher left) and 4 (low left). The biplot in Figure 1 clearly shows that the points for the genotypes are more dispersed than the points for the environment, indicating that genotype variability is greater than environment-related variability, which is consistent with ANOVA (Table 2). The points for the typically adapted genotypes on the biplot would be close to the IPCA = 0 line (which shows negligible or no GE interaction) and on the right side of the grand mean levels (suggesting high mean performance). In this regard, the AMMI biplot was set up with two oat genotypes, such as G6 and G5, with two environments, such as Doyogena and Adiyo, on the right side of the perpendicular vertical line (Figure 1). "}]},{"head":"AMMI Biplot","index":5,"paragraphs":[{"index":1,"size":210,"text":"Four parts make up the AMMI1 biplot space (Figure 1), ranging from high-yielding environments in parts 2 (upper right) and 3 (low right) to low-yielding environments in sections 1 (higher left) and 4 (low left). The biplot in Figure 1 clearly shows that the points for the genotypes are more dispersed than the points for the environment, indicating that genotype variability is greater than environment-related variability, which is consistent with ANOVA (Table 2). The points for the typically adapted genotypes on the biplot would be close to the IPCA = 0 line (which shows negligible or no GE interaction) and on the right side of the grand mean levels (suggesting high mean performance). In this regard, the AMMI biplot was set up with two oat genotypes, such as G6 and G5, with two environments, such as Doyogena and Adiyo, on the right side of the perpendicular vertical line (Figure 1). The oat genotypes (G5, G6, G9, and G11) are weakly influenced by environmental factors (lower interaction effect). The genotypes' (G2, G3, and G7) dry matter yield was strongly influenced by environmental factors (higher interaction effect), as shown in Figure 1. However, the dry matter yield response may not be higher for the genotypes that were less sensitive to environmental influences."},{"index":2,"size":74,"text":"Oat genotype ILRI_5527A (G6), which was closest to the IPCA 0, was more adaptable, high-yielding, and stable throughout the tested settings, so it was excellent. Along with G6, G5 also achieve a high dry matter yield and was adaptive in all of the studied situations. In contrast to the optimum genotype ILRI_5527A9G6), the genotypes G7, G2, and G3 were far from the IPCA 0 of the biplot and yielded low dry matter (Figure 1)."},{"index":3,"size":112,"text":"Genotypes close to the IPCA 0 of the biplot are not susceptible to environmental interaction, whereas genotypes further from the origin of the biplot are sensitive and have significant interaction effects, according to [19,35,37]. Additionally, Ref. [35] claims that the best genotypes have small absolute IPC2 scores (great stability) and large IPC1 The oat genotypes (G5, G6, G9, and G11) are weakly influenced by environmental factors (lower interaction effect). The genotypes' (G2, G3, and G7) dry matter yield was strongly influenced by environmental factors (higher interaction effect), as shown in Figure 1. However, the dry matter yield response may not be higher for the genotypes that were less sensitive to environmental influences."},{"index":4,"size":74,"text":"Oat genotype ILRI_5527A (G6), which was closest to the IPCA 0, was more adaptable, high-yielding, and stable throughout the tested settings, so it was excellent. Along with G6, G5 also achieve a high dry matter yield and was adaptive in all of the studied situations. In contrast to the optimum genotype ILRI_5527A9G6), the genotypes G7, G2, and G3 were far from the IPCA 0 of the biplot and yielded low dry matter (Figure 1)."},{"index":5,"size":103,"text":"Genotypes close to the IPCA 0 of the biplot are not susceptible to environmental interaction, whereas genotypes further from the origin of the biplot are sensitive and have significant interaction effects, according to [19,35,37]. Additionally, Ref. [35] claims that the best genotypes have small absolute IPC2 scores (great stability) and large IPC1 scores (wider adaptability). Figure 1 shows how the environments Adiyo and Hulla differed from Doyogena and Chencha in terms of the genotypes' dry matter yield performance. According to [36], environments with short spokes impose weak interacting pressures on the performance of oat genotypes, whereas settings with long spokes exert high interaction."},{"index":6,"size":131,"text":"On the other hand, certain environment (Figure 1) stood out as having a modest, moderate, or significant contribution to the interaction (Doyogena), Chencha, Hulla, and Adiyo, respectively. These environments (Adiyo and Doyogena) produced a mean dry matter yield that was higher than the overall mean (9.67 t ha −1 ), demonstrating that they were the best places to find high means. The settings with the highest potential (Hulla) showed variable genotype performance for dry matter yield and had a strong positive IPCA1 score (Figure 1). All genotypes progressed poorly in the low-yielding environment (IV), which had the lowest yield but a negative IPCA1 score. Similar observations were reported by different authors [36,38]. Settings with varying contribution relationships in both high-yielding and low-yielding conditions were also part of different observed findings [39]."}]},{"head":"AMMI Stability Value (ASV)","index":6,"paragraphs":[{"index":1,"size":192,"text":"An AMMI stability value was computed to determine the stability of the genotypes (Table 3). ASV is the distance from zero in a two-dimensional scatter graph comparing IPCA1 (interaction principal component analysis axis 1) scores to IPCA2 scores. The difference in stability measurements between the two primary components can be made up for using the proportional difference between the IPCAs (1:2), which can then be calculated using the Pythagorean theorem to account for the AMMI stability value [40]. The AMMI stability value (ASV) quantifies and ranks genotypes based on their yield stability rather than providing a quantitative stability indicator [38]. In this respect, greater ASV values are associated with unstable genotypes, whereas genotypes with lower ASV values are associated with more stable genotypes. The genotypes G7, G2, and G3 were the most unstable, with ASV values of 4.9, 1.79, and 1.45, respectively (Table 3). Genotype G9 was the most stable, with an ASV value of 0.27, followed by genotypes G6 and G11, with ASV values of 0.29 and 1.08, respectively, in biomass dry matter. Refs. [13,[41][42][43] all employed a similar technique and discovered a more stable genotype with a lower ASV value."}]},{"head":"Genotype Selection Index (GSI) Analysis","index":7,"paragraphs":[{"index":1,"size":157,"text":"There is a need for methods that combine mean and stability into a single criterion since the most stable genotypes may not always produce the best yield performance. Stability should not, however, be the primary parameter for selection. In this regard, because ASV considers both IPCA1 and IPCA2, which account for the majority of the variation in GE interaction, the rank of ASV and rank of mean yield are combined to form the Genotype Selection Index (GSI), a single selection index [41]. Because the most stable genotypes may Plants 2023, 12, 3064 7 of 18 not always produce the highest yields, stability is not the main factor in selection. Only when it is connected to average performance does the phrase \"high stability\" have any real meaning [42]. Therefore, methods that combine mean yield and stability into a single indicator are required [43]. The lowest GSI value, with a high mean yield, is regarded as the most stable."},{"index":2,"size":106,"text":"The smallest GSI is considered the most stable (Table 3); in that regard, the most stable genotypes with the highest biomass dry matter yield were G6 and G5, which had the lowest GSI values of 3 and 6, respectively. These genotypes were followed by G11 and G4, which had GSI values of 7 and 12, respectively, suggesting that they were stable and high yielding. This result is consistent with other research that found stable genotypes with high yields could be found through analyzing the genotype selection index based on ranking mean yield and ranking AMMI stability value [41][42][43]. These outcomes matched those of the biplot graph."}]},{"head":"GGE Biplot 2.5.1. Which-Won-Where View of GGE Biplot","index":8,"paragraphs":[{"index":1,"size":129,"text":"In order to identify the winning genotypes through showing the patterns of interaction between genotypes and environments, a polygon view of the GGE biplot graphic analysis is shown (Figure 2) [34]. In multi-location yield experiments, it is useful for detecting crossover and non-crossover genotype-by-environment interactions as well as the potential existence of several mega-environments [14,20]. G2, G3, G6, and G7 were the vertex genotypes, as shown by the genotypes in Figure 2. Because they are the farthest from the origin of the biplot, these genotypes perform better or worse in some or all environments [34], and they are regarded as specifically suited genotypes because they are more responsive to environmental change. In the GGE's polygon-view biplot, they thrive in environments that are a part of their particular sector [34]."},{"index":2,"size":150,"text":"There is a need for methods that combine mean and stability into a single criterion since the most stable genotypes may not always produce the best yield performance. Stability should not, however, be the primary parameter for selection. In this regard, because ASV considers both IPCA1 and IPCA2, which account for the majority of the variation in GE interaction, the rank of ASV and rank of mean yield are combined to form the Genotype Selection Index (GSI), a single selection index [41]. Because the most stable genotypes may not always produce the highest yields, stability is not the main factor in selection. Only when it is connected to average performance does the phrase \"high stability\" have any real meaning [42]. Therefore, methods that combine mean yield and stability into a single indicator are required [43]. The lowest GSI value, with a high mean yield, is regarded as the most stable."},{"index":3,"size":106,"text":"The smallest GSI is considered the most stable (Table 3); in that regard, the most stable genotypes with the highest biomass dry matter yield were G6 and G5, which had the lowest GSI values of 3 and 6, respectively. These genotypes were followed by G11 and G4, which had GSI values of 7 and 12, respectively, suggesting that they were stable and high yielding. This result is consistent with other research that found stable genotypes with high yields could be found through analyzing the genotype selection index based on ranking mean yield and ranking AMMI stability value [41][42][43]. These outcomes matched those of the biplot graph."}]},{"head":"GGE Biplot","index":9,"paragraphs":[]},{"head":"Which-Won-Where View of GGE Biplot","index":10,"paragraphs":[{"index":1,"size":613,"text":"In order to identify the winning genotypes through showing the patterns of interaction between genotypes and environments, a polygon view of the GGE biplot graphic analysis is shown (Figure 2) [34]. In multi-location yield experiments, it is useful for detecting crossover and non-crossover genotype-by-environment interactions as well as the potential existence of several mega-environments [14,20]. G2, G3, G6, and G7 were the vertex genotypes, as shown by the genotypes in Figure 2. Because they are the farthest from the origin of the biplot, these genotypes perform better or worse in some or all environments [34], and they are regarded as specifically suited genotypes because they are more responsive to environmental change. In the GGE's polygon-view biplot, they thrive in environments that are a part of their particular sector [34]. The two genotypes that performed best in each of the four environments-Hulla Chencha, Adiyo, and Doyogena-were G6 and G5. On the other hand, because they were located on the other side of the test environments and the furthest from the biplot's origin, the vertex genotypes-except G6, the rest: G2, G3, and G7-were the ones that performed the poorest over practically the entire set of test settings. Similar findings reported on genotypes' which-won-where patterns [26,[44][45][46] agree with this study's finding. They discovered that certain genotypes performed better than others in a particular environment and that certain genotypes performed worse in certain contexts. The red-color equality lines in Figure 2 separate the biplot into four portions. While the genotypes were spread over all four sectorial areas, the environments were only scattered across one. These were only one mega-environment: Hulla, Chencha, Adiyo, and Doyogena. This implies that similar genotypes perform well in an environment of homogeneity. In order to manage the genotype-by-environment interactions and subsequently relate the findings to similar agroclimatic regions, the identified mega-environments may be helpful. The most productive genotypes in a sector are those that are located close to the vertex [16]. The first (I) sectors, which were devoid of any environment, included seven and eight genotypes, respectively (Figure 2). In the second sector (II), there were four environments that were found: Hulla, Chena, Adiyo, and Doyogena. The G5 and G6 genotypes were included in this region (Figure 2). G6 is the vertex (winner) at the four environments of the sector. The third sector (III) contained four genotypes (G1, G2, G3, and G10) without any environments; G2 and G3 were the vertex genotypes, indicating that these were the better genotypes for sector III (Figure 2). Without any environments, G9 and G11 were located in the fourth sector (IV), with no vertex genotype in this sector. The GEI variance was higher in the vertex genotypes than in the genotypes close to the origin. Resulting around average performance, the G1, G4, G5, G8, G9, G10, and G11 genotypes were close to the biplot origin, and their GEI variation was lower than that of the vertex genotypes. The results were similar to those reported by [40,42,[47][48][49][50], who stated that the testing environment was divided into various mega-environments with winning genotypes and sectors with different numbers of genotypes. The effects of GE interaction influence the accuracy of predicting the performance of some genotypes in new environments. This was observed for genotypes ranked third and above, for example, genotype eleven (G11), which is ranked as third in the environment of Chencha but not found within the top-five ranking in the Doyegena environment. Similarly, genotype two (G2) ranked third in Doyegena but was not found among the top five in Chencha and Hulla. The results show new promising genotypes (G6 and G5) which were high yielding and stable in all environments, which is recommended for the breeder for further production."}]},{"head":"Relationship among Environments","index":11,"paragraphs":[{"index":1,"size":123,"text":"According to Figure 3 of the GGE biplot, the first (PC1) and second (PC2) principal components together accounted for 87% of the total variation, showing that this biplot may be utilized to distinguish between interrelationships across the environments. The correlation coefficient is related to the angle between the biplot origin and the test environment markers [35]. Additionally, a high degree of genotype discrimination is conferred by the length of an environmental vector [19]. In the current study, Doyogena was the environment that was most discriminating (held more information) about the genotypes with the longest vectors from the origin, followed by Hulla and Chencha, which were moderately discriminating, and the Adiyo environment, which was either barely or not discriminating about genotype differences (Figure 3)."},{"index":2,"size":43,"text":"The use of non-discriminating (non-informative) test environments is discouraged since they offer little information regarding genotypes [42]. Additionally, test environments with acute, obtuse, and right-angle relationships, respectively, have positive, negative, and zero correlation between environments predominantly found using the biplot vector view [16]."},{"index":3,"size":103,"text":"The four environments were divided into two groups based on the angle test between environment vectors. Figure 3 shows that the first group had a modest angle between the environments Hulla, Chencha, and Adiyo; a strong positive correlation between them; and similar genetic information. It means that their capacity to distinguish between genotypes is compromised by the environment. Breeders should be able to use fewer test environments, lowering testing costs and increasing breeding effectiveness, if they can obtain trustworthy information about environment similarity and clustering. The second group is in possession of the broad angle between Doyogena and the rest of the environments."},{"index":4,"size":137,"text":"Plants 2023, 12, x FOR PEER REVIEW 9 of 19 ments with acute, obtuse, and right-angle relationships, respectively, have positive, negative, and zero correlation between environments predominantly found using the biplot vector view [16]. The four environments were divided into two groups based on the angle test between environment vectors. Figure 3 shows that the first group had a modest angle between the environments Hulla, Chencha, and Adiyo; a strong positive correlation between them; and similar genetic information. It means that their capacity to distinguish between genotypes is compromised by the environment. Breeders should be able to use fewer test environments, lowering testing costs and increasing breeding effectiveness, if they can obtain trustworthy information about environment similarity and clustering. The second group is in possession of the broad angle between Doyogena and the rest of the environments."},{"index":5,"size":195,"text":"The performance of the genotype in an environment is better than average if the angle between its vector and the environment's vector is less than 90. And, it is less than average if the angle is greater than 90° and near average if the angle is about 90° [16]. In this regard, G6 and G5 performed well in environments Chencha, Hulla, Adiyo, and Doyogena. Wide obtuse angles are a sign of strong crossover GE in the test conditions, and the biggest angle is somewhat wider than 90°, suggesting that the GE is moderately large. Therefore, except for G6 and G5, the rest of the genotypes showed varying performance in different environments. Similar findings in the link between environments defined using the angle method were reported by [40,51,52]. When compared to associations with small angles, which showed significant positive correlations and provided information about genotypes, they discovered that some settings between them had huge angles or low or negative correlations. The GGE biplot graph shows relationships among test environments, where 1 up to 11 stands for genotypes from 1 up to 11, consecutively. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively."},{"index":6,"size":163,"text":"The performance of the genotype in an environment is better than average if the angle between its vector and the environment's vector is less than 90. And, it is less than average if the angle is greater than 90 • and near average if the angle is about 90 • [16]. In this regard, G6 and G5 performed well in environments Chencha, Hulla, Adiyo, and Doyogena. Wide obtuse angles are a sign of strong crossover GE in the test conditions, and the biggest angle is somewhat wider than 90 • , suggesting that the GE is moderately large. Therefore, except for G6 and G5, the rest of the genotypes showed varying performance in different environments. Similar findings in the link between environments defined using the angle method were reported by [40,51,52]. When compared to associations with small angles, which showed significant positive correlations and provided information about genotypes, they discovered that some settings between them had huge angles or low or negative correlations."}]},{"head":"Evaluation of Genotypes Based on the Ideal Genotype","index":12,"paragraphs":[{"index":1,"size":231,"text":"An interesting application for comparing genotypes to a desirable genotype is the GGE biplot model. An ideal genotype has a high mean performance as well as a high level of stability across locations; a number of publications, including [18,45,53,54], claim that the optimal position-the center of the concentric circle-was used to identify the genotype with the highest mean performance and stability. Large PC1 scores (high mean yield) and small (absolute) PC2 scores (high stability) characterize an optimal genotype. Even though such an \"ideal\" genotype could not exist in the real world, it might be utilized as a standard for assessing genotypes [52]. To more clearly show the disparity between genotypes and the ideal genotype, concentric circles were created in a GGE biplot graph based on genotype-focused scaling [18,23]. Early breeding cycles can be used to rule out genotypes that are quite different from the ideal genotype, whereas later testing can take into account genotypes that are relatively similar to it [55]. When a genotype is nearer to the \"ideal\" genotype, which is shown in the first concentric circle of the GGE biplot graphic, it is considered to be more desirable [56]. The genotype G6 was located in the first concentric circle, as shown in the GGE biplot graph (Figure 4). It follows that G6 was the preferred genotype position, followed by G5, making it the preferred genotype among those of oat."},{"index":2,"size":189,"text":"rule out genotypes that are quite different from the ideal genotype, whereas later testing can take into account genotypes that are relatively similar to it [55]. When a genotype is nearer to the \"ideal\" genotype, which is shown in the first concentric circle of the GGE biplot graphic, it is considered to be more desirable [56]. The genotype G6 was located in the first concentric circle, as shown in the GGE biplot graph (Figure 4). It follows that G6 was the preferred genotype position, followed by G5, making it the preferred genotype among those of oat. This is comparable to the findings of [35,44,54] who showed that the first and second concentric circles, respectively, include one optimal genotype and a few other suitable genotypes. Similar to this, Ref. [26] found desired genotypes using various strategies. Their criteria were that an ideal genotype should have big PC1 scores (high mean yield) and a small absolute PC2 score (high stability); however, their strategy was unsuccessful in doing so. The highest-yielding genotypes are those that are drawn on the concentric and/or average environmental coordinate (AEC) center closest to the ideal genotype [57,58]."},{"index":3,"size":132,"text":"In the consideration of AMMI and GGE biplot analysis of oat genotype based on the dry matter yield performance, genotypes G6 (ideal genotype) and G5 yielded more dry-matter biomass than the remaining tested oat genotypes across the tested environ- This is comparable to the findings of [35,44,54] who showed that the first and second concentric circles, respectively, include one optimal genotype and a few other suitable genotypes. Similar to this, Ref. [26] found desired genotypes using various strategies. Their criteria were that an ideal genotype should have big PC1 scores (high mean yield) and a small absolute PC2 score (high stability); however, their strategy was unsuccessful in doing so. The highest-yielding genotypes are those that are drawn on the concentric and/or average environmental coordinate (AEC) center closest to the ideal genotype [57,58]."},{"index":4,"size":51,"text":"In the consideration of AMMI and GGE biplot analysis of oat genotype based on the dry matter yield performance, genotypes G6 (ideal genotype) and G5 yielded more dry-matter biomass than the remaining tested oat genotypes across the tested environments. Therefore, these genotypes are relatively wider in adaptation across the tested environments."}]},{"head":"Evaluation of Environments Relative to Ideal Environments","index":13,"paragraphs":[{"index":1,"size":115,"text":"The desired environments are those that are closest to the ideal environment, which is located in the first concentric circle of the environment-focused GGE biplot. Hulla has been in the perfect environment and is in the first concentric circle in this regard (Figure 5). Hulla had a robust PC1 score but a reduced PC2 score. Therefore, genotype evaluation in the Hulla environment increased the observed genotypic diversity across genotypes for the biomass dry matter yield of the tested oat genotypes and should be regarded as the most appropriate to identify broadly suited genotypes. Chencha's and Adiyo's habitats have been recognized as desirable environments (Figure 5), since they are quite similar to the ideal environment (Hulla)."},{"index":2,"size":102,"text":"The Doyogena environments, on the other hand, were placed far from ideal conditions, making them unsuitable (fewer representatives) environments for choosing cultivars with broad adaptations but useful for choosing those with particular adaptations. Soil fertility, rainfall, and other environmental variability between environmental systems can be linked to this variation. The discriminating power of a place is influenced by the genotype composition, but the existence of GEI makes selecting a suitable test location more challenging [35]. Furthermore, they suggested that the most representative environments can be used for widely adapted genotype selection, while non-representing environments can be useful for specifically adapted genotype selection."},{"index":3,"size":217,"text":"The desired environments are those that are closest to the ideal environment, which is located in the first concentric circle of the environment-focused GGE biplot. Hulla has been in the perfect environment and is in the first concentric circle in this regard (Figure 5). Hulla had a robust PC1 score but a reduced PC2 score. Therefore, genotype evaluation in the Hulla environment increased the observed genotypic diversity across genotypes for the biomass dry matter yield of the tested oat genotypes and should be regarded as the most appropriate to identify broadly suited genotypes. Chencha's and Adiyo's habitats have been recognized as desirable environments (Figure 5), since they are quite similar to the ideal environment (Hulla). The Doyogena environments, on the other hand, were placed far from ideal conditions, making them unsuitable (fewer representatives) environments for choosing cultivars with broad adaptations but useful for choosing those with particular adaptations. Soil fertility, rainfall, and other environmental variability between environmental systems can be linked to this variation. The discriminating power of a place is influenced by the genotype composition, but the existence of GEI makes selecting a suitable test location more challenging [35]. Furthermore, they suggested that the most representative environments can be used for widely adapted genotype selection, while non-representing environments can be useful for specifically adapted genotype selection."}]},{"head":"Ranking of Genotypes Based on Mean Yield and Stability Performance","index":14,"paragraphs":[{"index":1,"size":41,"text":"The average environment (tester) coordinate (AEC) methods were used in the GGE biplot to determine mean dry matter yield and genotype stability (Figure 6) [59]. The average PC1 and PC2 scores across all environments are used to define the average en- "}]},{"head":"Ranking of Genotypes Based on Mean Yield and Stability Performance","index":15,"paragraphs":[{"index":1,"size":150,"text":"The average environment (tester) coordinate (AEC) methods were used in the GGE biplot to determine mean dry matter yield and genotype stability (Figure 6) [59]. The average PC1 and PC2 scores across all environments are used to define the average environmental (tester) coordinate (AEC) [34]. The mean dry matter yield performance axis of genotypes is indicated by the AEC X axis (PC1) line that goes through the biplot's origin and has an arrow pointing in the direction of the positive end. The stability of genotypes (PC2) is measured using the line which runs through the origin and is perpendicular to the average environmental axis (Figure 6). Stable genotypes had PC2 scores that were practically zero, were close to AEC (PC1), and had the lowest number of perpendicular lines. Away from the biplot origin, however, any direction on the axis denotes a greater GE interaction and a lower level of stability."},{"index":2,"size":126,"text":"The best genotypes for selection criteria are those with both high mean yield and high stability. In this regard, in the present study (Figure 6), the single arrowed line pointed to higher yield across environments. Therefore, genotype G6 had the highest mean yield, followed by G5. They were the most stable, while G7, G3, and G2 were highly unstable, and among them, G7 performed poorly. The present study's findings are in line with the report made by [60]. They ranked genotypes based on mean performance and stability across environments. In this way, they found some genotypes to be the most stable with a high mean yield and some unstable high yielders, while some other genotypes were unstable with a poor yield and a stable low yielder."},{"index":3,"size":208,"text":"origin and has an arrow pointing in the direction of the positive end. The stability of genotypes (PC2) is measured using the line which runs through the origin and is perpendicular to the average environmental axis (Figure 6). Stable genotypes had PC2 scores that were practically zero, were close to AEC (PC1), and had the lowest number of perpendicular lines. Away from the biplot origin, however, any direction on the axis denotes a greater GE interaction and a lower level of stability. The best genotypes for selection criteria are those with both high mean yield and high stability. In this regard, in the present study (Figure 6), the single arrowed line pointed to higher yield across environments. Therefore, genotype G6 had the highest mean yield, followed by G5. They were the most stable, while G7, G3, and G2 were highly unstable, and among them, G7 performed poorly. The present study's findings are in line with the report made by [60]. They ranked genotypes based on mean performance and stability across environments. In this way, they found some genotypes to be the most stable with a high mean yield and some unstable high yielders, while some other genotypes were unstable with a poor yield and a stable low yielder."},{"index":4,"size":357,"text":"The AMMI model has been successfully applied in many studies to analyze GEI [32,35]. The AMMI model, put out by [61], makes use of analysis of variance and principal component analysis for a better understanding of GEI, its causes, and effects. The GGE biplot analysis, which prioritizes both genotype main effects and GEI effects for the study, was proposed by [59]. Only the beginning analysis steps-where GGE examines G plus GE (or GEI) while AMMI separates G from GE-and the final analysis processes, where the biplot for the interpretation are built, distinguish these models from one another. The environmental stratification provided by the AMMI biplot is complemented by the GGE biplot, which enables the identification of mega-settings and genotypes that perform best in these environments [62]. These distinctions, however, do not suggest that either approach is better than the other [58]. The graphic analysis offered by the AMMI biplot offers a very straightforward analysis for breeding researchers. Conclu- The AMMI model has been successfully applied in many studies to analyze GEI [32,35]. The AMMI model, put out by [61], makes use of analysis of variance and principal component analysis for a better understanding of GEI, its causes, and effects. The GGE biplot analysis, which prioritizes both genotype main effects and GEI effects for the study, was proposed by [59]. Only the beginning analysis steps-where GGE examines G plus GE (or GEI) while AMMI separates G from GE-and the final analysis processes, where the biplot for the interpretation are built, distinguish these models from one another. The environmental stratification provided by the AMMI biplot is complemented by the GGE biplot, which enables the identification of mega-settings and genotypes that perform best in these environments [62]. These distinctions, however, do not suggest that either approach is better than the other [58]. The graphic analysis offered by the AMMI biplot offers a very straightforward analysis for breeding researchers. Conclusions about phenotypic stability, genotype behavior, genetic divergence between genotypes, and environments with the best performance can be made based on the data. Accordingly, the stable and high-yielding genotypes G6 and G5 are advised for breeding researchers to use in breeding programs."}]},{"head":"Materials and Methods","index":16,"paragraphs":[]},{"head":"Description of Study Area","index":17,"paragraphs":[{"index":1,"size":25,"text":"During the primary growing season of 2018-2019, the field experiment was carried out in four different environments. The study areas are shown in Figure 7."},{"index":2,"size":33,"text":"The soil type, altitude, and mean annual rainfall at these locations are different from each other (Table 4). Consequently, each place was regarded as having its own ecosystem and considered an individual environment."},{"index":3,"size":13,"text":"Plants 2023, 12, 3064 13 of 18 researchers to use in breeding programs."}]},{"head":"Materials and Methods","index":18,"paragraphs":[]},{"head":"Description of Study Area","index":19,"paragraphs":[{"index":1,"size":58,"text":"During the primary growing season of 2018-2019, the field experiment was carried out in four different environments. The study areas are shown in Figure 7. The soil type, altitude, and mean annual rainfall at these locations are different from each other (Table 4). Consequently, each place was regarded as having its own ecosystem and considered an individual environment. "}]},{"head":"Experimental Materials","index":20,"paragraphs":[{"index":1,"size":26,"text":"Eleven oat genotypes used in the study are displayed in Table 5. From the total genotypes, SRCPX80AB2291 and SRCPX80AB2806 were released, and the rest were promising.   "}]},{"head":"Experimental Materials","index":21,"paragraphs":[{"index":1,"size":26,"text":"Eleven oat genotypes used in the study are displayed in Table 5. From the total genotypes, SRCPX80AB2291 and SRCPX80AB2806 were released, and the rest were promising. "}]},{"head":"Experimental Design and Management","index":22,"paragraphs":[{"index":1,"size":130,"text":"The experiment was laid out in an RCBD design, with three replications. The design had three blocks and there were 33 plots, each with a dimension of 2 m × 3 m and a plot area of 6 m 2 . The space between rows, blocks, and plots was 20, 150, and 100 cm, respectively. Each plot had 10 rows. The experimental seeds were planted through drilling into the soil. Each plot requirement of the seeds was measured through calculating the oat seed plantation rate of 100 kg/ha. NPS and urea fertilizers were applied at 100 kg/ha each. Data on biomass yield at the milk stage were collected from the three central rows excluding the outside rows; it was weighed and then converted tons per hectare (t ha −1 )."}]},{"head":"Data Analysis","index":23,"paragraphs":[{"index":1,"size":94,"text":"Utilizing Genstat, as reported by [63], statistical analyses were carried out. Each environment's data were subjected to an analysis of variance (ANOVA) and a normality test prior to performing the combined analysis of variance across environments. After validating the homogeneity of the variances, the combined analysis of variances across sites was carried out. Bartlett's tests of homogeneity of variances were used to determine the homogeneity of the error variances of the individual location experiments. With genotypes acting as fixed factors and surroundings acting as random variables, a combined ANOVA was created using the AMMI"}]},{"head":"AMMI Analysis","index":24,"paragraphs":[{"index":1,"size":106,"text":"The AMMI model's biomass dry matter yield was examined. AMMI stands for additive main effect and multiplicative interaction. Because in the validity test, the MS component of the RCBD design for the block within replication is less than the residual error across all sites, the analysis of variance was a combined analysis based on the RCBD. According to [64], the AMMI analysis was utilized to modify both the multiplicative effects of the GE interaction by the principal component analysis and the main or additive genotype and environmental effects by analysis of variance. The following model was proposed by [64] for the AMMI analysis of variance (ANOVA):"},{"index":2,"size":83,"text":"where Y ij is the mean yield of the ith genotype in the jth environment; µ is the grand mean; G i and E j are the genotype and environment deviation from grand mean, respectively; α ik and γ jk are the genotype and environment principal component scores for axis k; n is the maximum number of multiplicative terms; γ k is the kth singular value of x (square root of the eigenvalue of xx' or x'x); ε ij is the error term."}]},{"head":"AMMI Stability Value (ASV) Analysis","index":25,"paragraphs":[{"index":1,"size":68,"text":"Because the AMMI analysis does not offer a quantitative measure of stability, Purchase et al.'s [40] recommendation was to utilize an ASV measure to quantify and categorize genotypes according to their yield stability. The stability of a genotype is evaluated using the ASV. Weighted IPCA1 and IPCA2 scores indicate that the stronger the stability, the lower the value [40]. The following formula was used to determine the ASV."},{"index":2,"size":13,"text":"The AMMI stability value (ASV) as described by [40] was calculated as follows:"},{"index":3,"size":5,"text":"where SS IPCA1 SS IPCA2"},{"index":4,"size":50,"text":"is the weight given to the IPCA1 value through dividing the IPCA1 sum of squares by the IPCA2 sum of squares. The larger the IPCA score, either negative or positive, the more specifically adapted a genotype is to certain environments. Smaller ASV scores indicate a more stable genotype across environments."}]},{"head":"Genotype Selection Index (GSI) Analysis","index":26,"paragraphs":[{"index":1,"size":105,"text":"The genotype selection index was calculated using the equation GSI = RASV + RY [43]. The terms RASV and RY in this context stand for genotype mean yield ranking across environments and AMMI stability value ranking, respectively. The author claims that GSI combines stability and mean yield into a single criterion, with a low score suggesting stable genotypes with a high mean yield. Therefore, it is assumed that the GSI with the lowest value is the most stable and has the maximum biomass dry matter yield. A genotype is better suited to particular surroundings when it has a higher IPCA score, whether positive or negative."}]},{"head":"Gene Gene Environment Biplot","index":27,"paragraphs":[{"index":1,"size":20,"text":"Based on the singular value decomposition of the first two principal components, the model for a GGE biplot [35] is"},{"index":2,"size":82,"text":"where Y ij is the mean for the ith genotype in the jth environment, µ is the grand mean, βj is the main effect of environment j, λ 1 and λ 2 are the singular values of the first and second principal components (PC1 and PC2), ξi1 and ξi2 are the PC1 and PC2 scores, respectively, for genotype ith, η j1 and η j2 are the eigenvectors for the jth environment for PC1 and PC2, and ε is the residual error term."}]},{"head":"Conclusions","index":28,"paragraphs":[{"index":1,"size":359,"text":"The findings of this study support the need to test genotypes in representative environmental settings in order to find the most stable and productive genotypes. To lessen the impact of GE interaction and to increase the precision and refinement of genotype selection, the yield and stability of performance should be taken into account simultaneously. The genotypes, environments, interaction of genotype × environments, and AMMI component were significant in the analysis of variance for the AMMI model of oat biomass yield based on dry matter. Therefore, it is important to include yield along with PCA1 and PCA2 scores at the same time in order to maximize the useful effects of GEI and increase the accuracy of genotype recommendations. It was possible to find genotypes with superior and consistent biomass yield based on dry matter production using a graphical interpretation of the AMMI analysis and GSI index, which combined the ASV and the yield potential of various genotypes into a single non-parametric index. Based on YSI or GSI indices, G6 and G5 revealed the highest yield and stability. Generally, AMMI analysis is advantageous for identifying high-yielding and stable genotypes (G6 and G5), whereas GGE is advantageous for identifying genotypes that are specifically or broadly adapted. According to GGE, the same genotypes (G6 and G5) were broadly adapted. The two methodologies of analysis (AMMI and GGE) approve selecting G6 and G5 for a further breeding program or for high-production growers in the study area. This study may need to be repeated after a number of years because there will be a change in environments over a number of years, which is a challenge of this study. A limitation of the study is that the graphical analysis of GGE estimates about 87% of the reason, not 100%; i.e., a greater proportion could be explained with a better alternative methodology. Institutional Review Board Statement: The current study does not directly involve either human beings or animals for data and sample collection. Rather, the study was conducted at four locations in an experimental field. The study was reviewed by professionals from Jimma University College of Agriculture and Veterinary Medicine and the Ethiopian Agricultural Research Institute."}]}],"figures":[{"text":"Figure 1 . Figure 1. Graphics of AMMI biplot of dry matter yield of oat genotypes using symmetrical scaling of both genotypes and environments. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 1 . Figure 1. Graphics of AMMI biplot of dry matter yield of oat genotypes using symmetrical scaling of both genotypes and environments. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 2 . Figure 2. The GGE biplot shows which genotype won where and their related mega-environments. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 3 . Figure 3. The GGE biplot graph shows relationships among test environments, where 1 up to 11 stands for genotypes from 1 up to 11, consecutively. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 3 . Figure 3.The GGE biplot graph shows relationships among test environments, where 1 up to 11 stands for genotypes from 1 up to 11, consecutively. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 4 . Figure 4. GGE biplot graph based on genotypic focused scaling for comparison genotype with ideal genotype represented by the center of concentric circles and an arrow pointing to it. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 4 . Figure 4. GGE biplot graph based on genotypic focused scaling for comparison genotype with ideal genotype represented by the center of concentric circles and an arrow pointing to it. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 5 . Figure 5. GGE biplot graph based on environment focused scaling for comparison of an environment with an ideal environment represented by the center of concentric circles and an arrow pointing to it. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 5 . Figure 5. GGE biplot graph based on environment focused scaling for comparison of an environment with an ideal environment represented by the center of concentric circles and an arrow pointing to it. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 6 . Figure 6. Average environment coordinates view of the GGE biplot graph showing the ranking of genotypes represented by an arrow pointing to it for mean biomass yield based on dry matter and stability performance over environments. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 6 . Figure 6. Average environment coordinates view of the GGE biplot graph showing the ranking of genotypes represented by an arrow pointing to it for mean biomass yield based on dry matter and stability performance over environments. HUL, CHE, DOY, and ADY stand for Hulla, Chencha, Doyogena, and Adiyo, respectively. "},{"text":"Figure 7 . Figure 7. Map of the study area. "},{"text":"Figure 7 . Figure 7. Map of the study area. "},{"text":" writing-review and editing, K.Y.W., T.T. (Tessema Tesfaye), S.D., W.G., T.T. (Taye Tolemariam), M.Z., D.G., W.B., J.W. and M.S.; visualization, K.Y.W., T.T. (Tessema Tesfaye), S.D., W.G., T.T. (Taye Tolemariam), M.Z., D.G., W.B., J.W. and M.S.; supervision, T.T. (Tessema Tesfaye), S.D. and W.G.; project administration, K.Y.W., T.T. (Tessema Tesfaye), S.D., W.G., T.T. (Taye Tolemariam), M.Z., D.G., W.B., J.W. and M.S.; funding acquisition, K.Y.W., J.W. and M.Z. All authors have read and agreed to the published version of the manuscript. Funding: The current work was funded by South Agricultural Research Institute, Bonga Agricultural Research Center, and International Centre for Agricultural Research in Dry Areas. "},{"text":"Table 1 . Combined analysis of variance from AMMI model for dry matter yield of genotypes. Source D.F. S.S. M.S. (%) SS Explained SourceD.F.S.S.M.S.(%) SS Explained Total 263 3052.9 11.61  Total2633052.911.61 Treatments 43 1052.3 24.47 ***  Treatments431052.324.47 *** Genotypes 10 367.6 36.76 *** 34.94 Genotypes10367.636.76 ***34.94 Environments 3 164.2 54.72 ** 15.60 Environments3164.254.72 **15.60 Block 8 92.7 11.59  Block892.711.59 Interactions 30 520.5 17.35 ** 49.46 Interactions30520.517.35 **49.46 IPCA 1 12 381.8 31.81 *** 73.35 IPCA 112381.831.81 ***73.35 IPCA 2 10 77.9 7.79 14.97 IPCA 21077.97.7914.97 Residuals −6 0 0  Residuals−600 Error 212 1907.9 9  Error2121907.99  "},{"text":"Table 2 . Combined analysis of variance for biomass yield under different locations (t/ha). Code Genotypes Name Chencha Environments Adiyo Doyogena Hulla Genotypic Mean Rank CodeGenotypesNameChenchaEnvironments Adiyo DoyogenaHullaGenotypic MeanRank G1 ILRI_5431A 8.30 10.26 11.11 8.85 9.63 3 G1ILRI_5431A8.3010.2611.118.859.633 G2 ILRI_5444A 7.08 11.38 11.55 7.02 9.26 6 G2ILRI_5444A7.0811.3811.557.029.266 G3 ILRI_5490A 9.47 7.88 10.93 6.72 8.75 10 G3ILRI_5490A9.477.8810.936.728.7510 G4 ILRI_5499A 8.89 9.75 10.67 7.82 9.29 5 G4ILRI_5499A8.899.7510.677.829.295 G5 ILRI_5526A 11.51 11.67 11.65 11.75 11.65 2 G5ILRI_5526A11.5111.6711.6511.7511.652 G6 ILRI_5527A 12.48 12.65 12.77 12.17 12.52 1 G6ILRI_5527A12.4812.6512.7712.1712.521 G7 ILRI_15152A 10.47 11.11 3.01 9.99 8.65 11 G7ILRI_15152A10.4711.113.019.998.6511 G8 ILRI_15153A 8.99 11.38 8.60 7.72 9.17 7 G8ILRI_15153A8.9911.388.607.729.177 G9 ILRI_16101A 8.75 9.88 9.69 7.82 9.03 9 G9ILRI_16101A8.759.889.697.829.039 G10 SRCPX80AB2291 8.23 10.09 10.31 7.53 9.04 8 G10SRCPX80AB22918.2310.0910.317.539.048 G11 SRCPX80AB2806 10.69 11.36 9.52 11.36 9.43 4 G11SRCPX80AB280610.6911.369.5211.369.434 Environmental Mean 9.53(3) 10.67(1) 9.98(2) 8.50(4) 9.67 Environmental Mean9.53(3)10.67(1)9.98(2)8.50(4)9.67 LSD (5%)  2.81 2.88 3.55 3.12  LSD (5%)2.812.883.553.12 CV (%)  15.46 14.93 18.75 21.72  CV (%)15.4614.9318.7521.72 F value  ** *** * **  F value********   Key: *** p ≤ 0.001, ** p ≤ 0.05, and * p ≤ 0.1.   Key: *** p ≤ 0.001, ** p ≤ 0.05, and * p ≤ 0.1.  "},{"text":"Table 3 . Grand mean biomass yield based on dry matter (BDMY) tha −1 , RY, GSI, ASV, RASV, IPCA1, and IPCA2 of 11 oat genotypes across environments. Genotypes BYDM RY GSI ASV RASV IPCA1 IPCA2 GenotypesBYDMRYGSIASVRASVIPCA1IPCA2 G1 9.63 3 11 0.937532498 8 −0.46271 0.32331 G19.633110.9375324988−0.462710.32331 G2 9.26 6 16 1.793726372 10 −0.88151 −0.73616 G29.266161.79372637210−0.88151−0.73616 G3 8.75 10 19 1.45376979 9 −0.7156 0.56232 G38.7510191.453769799−0.71560.56232 G4 9.29 5 12 0.86520405 7 −0.42998 0.16699 G49.295120.865204057−0.429980.16699 G5 11.65 2 6 0.492768176 4 0.18251 0.80585 G511.65260.49276817640.182510.80585 G6 12.52 1 3 0.290958358 2 0.06914 0.62493 G612.52130.29095835820.069140.62493 G7 8.65 11 22 4.900847781 11 2.4432 −0.01007 G78.6511224.900847781112.4432−0.01007 G8 9.17 7 12 0.679687821 5 0.314 −0.62413 G89.177120.67968782150.314−0.62413 G9 9.03 9 10 0.277265348 1 −0.13761 0.06356 G99.039100.2772653481−0.137610.06356 G10 9.04 8 14 1.982438484 6 −0.40402 −0.09492 G109.048141.9824384846−0.40402−0.09492 G11 9.43 4 7 1.08732656 3 0.02258 −1.08168 G119.43471.0873265630.02258−1.08168  "},{"text":"Table 4 . Description of test environments. Location Altitude (m.a.s.l) Annual Av RF (mm) Soil Type Max T° Min T° pH LocationAltitude (m.a.s.l)Annual Av RF (mm)Soil TypeMax T°Min T°pH Adiyo 2573 2042.43 Clay loam 23.11 14.07 5.2 Adiyo25732042.43Clay loam23.1114.075.2 Doyogena 2535 1823.13 Clay loam 24.49 13.98 6.5 Doyogena25351823.13Clay loam24.4913.986.5 Hulla 2959 1255.39 Clay silt 25.15 13.99 5.0 Hulla29591255.39Clay silt25.1513.995.0 Chencha 2985 1857.95 Nitosols 26.28 15.57 4.5 Chencha29851857.95Nitosols26.2815.574.5  "},{"text":"Table 5 . Description of oat genotypes used for the study. Genotype Name Genotype Code Status Genotype NameGenotype CodeStatus ILRI_5431A G1 Promising ILRI_5431AG1Promising ILRI_5444A G2 Promising ILRI_5444AG2Promising  "},{"text":"Table 4 . Description of test environments. Soil Type Max T • Min T • pH Soil TypeMax T •Min T •pH  "},{"text":"Table 5 . Description of oat genotypes used for the study. Genotype Name Genotype Code Status Genotype NameGenotype CodeStatus ILRI_5431A G1 Promising ILRI_5431AG1Promising ILRI_5444A G2 Promising ILRI_5444AG2Promising ILRI_5490A G3 Promising ILRI_5490AG3Promising ILRI_5499A G4 Promising ILRI_5499AG4Promising ILRI_5526A G5 Promising ILRI_5526AG5Promising ILRI_5527A G6 Promising ILRI_5527AG6Promising ILRI_15152A G7 Promising ILRI_15152AG7Promising ILRI_15153A G8 Promising ILRI_15153AG8Promising ILRI_16101A G9 Promising ILRI_16101AG9Promising SRCPX80AB2291 G10 Released SRCPX80AB2291G10Released SRCPX80AB2806 G11 Released SRCPX80AB2806G11Released  "}],"sieverID":"b78e0835-0c69-45f3-b758-feb2ef87c347","abstract":"This paper reports an evaluation of eleven oat genotypes in four environments for two consecutive years to identify high-biomass-yielding, stable, and broadly adapted genotypes in selected parts of Ethiopia. Genotypes were planted and evaluated with a randomized complete block design, which was repeated three times. The additive main effect and multiplicative interaction analysis of variances revealed that the environment, genotype, and genotype-environment interaction had a significant (p ≤ 0.001) influence on the biomass yield in the dry matter base (t ha −1 ). The interaction of the first and second principal component analysis accounted for 73.43% and 14.97% of the genotype according to the environment interaction sum of squares, respectively. G6 and G5 were the most stable and widely adapted genotypes and were selected as superior genotypes. The genotype-by-environment interaction showed a 49.46% contribution to the total treatment of sum-of-squares variation, while genotype and environment effects explained 34.94% and 15.60%, respectively. The highest mean yield was obtained from G6 (12.52 kg/ha), and the lowest mean yield was obtained from G7 (8.65 kg/ha). According to the additive main effect and multiplicative interaction biplot, G6 and G5 were high-yielding genotypes, whereas G7 was a low-yielding genotype. Furthermore, according to the genotype and genotype-environment interaction biplot, G6 was the winning genotype in all environments. However, G7 was a low-yielding genotype in all environments. Finally, G6 was an ideal genotype with a higher mean yield and relatively good stability. However, G7 was a poor-yielding and unstable genotype. The genotype, environment, and genotype x environment interaction had extremely important effects on the biomass yield of oats. The findings of the graphic stability methods (additive main effect and multiplicative interaction and the genotype and genotypeenvironment interaction) for identifying high-yielding and stable oat genotypes were very similar."}

data/part_2/00ebad8e7ee4dab0720ffe362ce4ceba.json

@@ -0,0 +1 @@
+{"metadata":{"id":"00ebad8e7ee4dab0720ffe362ce4ceba","source":"gardian_index","url":"https://data.cimmyt.org/api/access/datafile/:persistentId/?persistentId=hdl:11529/10548605/8"},"pageCount":53,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":52,"text":"you agree to participate, you can choose to stop at any time or to skip any questions you do not want to answer. Your answers will be completely confidential; we will not share information that identifies you with anyone and your name and location will be kept safe using a coding system."},{"index":2,"size":105,"text":"After entering the questionnaire into a database, we will also restrict access to all information such as your name which will link these responses to you so that you can not be identified and will remain completely anonymous. Your participation will be highly appreciated. The answers you give will help provide better information to policy-makers, development practitioners, agricultural extension agents, and program managers so that they can plan for better services that will respond to your needs. If in the future you have any questions regarding study and the interview, or concerns or complaints we welcome you to ask our (the data collector) contact details.   "}]}],"figures":[{"text":" agricultural income derived from ${1} crop (%)(approximate value over the last five years) for ${1} crop sold to market (Rs / quintal) (average over the last five years) "}],"sieverID":"54e7b473-4351-4799-bffa-234c57563c44","abstract":"Variable Name Question Text Saved Value collectionDate Hidden from user Today's date wc Hi ! Welcome to CROP YIELD & PRODUCTION PRACTICES SURVEY form. Kindly read the instructions carefully for each question before you fill in. Unless otherwise indicated, all responses correspond to information from __ the largest plot __ for selected crop on each farm ! Thank you for filling out ! User entered text consentDisclaimer Thank you for the opportunity to speak with you. I would like to interview you and your household for a survey. Our investigation aims at getting insight into different crop production practices & grain yield. We are inviting you to be a participant in this study. We value your opinion and there are no right or wrong answers to the questions we will be asking in the interview. All we ask is for your honest answer and opinion. The interview takes approximately around forty minutes to complete. If"}

data/part_2/00f2a747f2393f60277f601a39674b65.json

@@ -0,0 +1 @@
+{"metadata":{"id":"00f2a747f2393f60277f601a39674b65","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/abcf29be-7d4c-4359-86b6-9e71e651204f/retrieve"},"pageCount":13,"title":"Este estudio se realiza como parte del proyecto socio-económico \"Estudio de sistemas de pequeños ganaderos eco eficientes hacia diferenciación de productos y pago de servicios ambientales en los municipios de Patía y Mercaderes, Cauca\", contribuyendo al cumplimiento del objetivo general \"Valorar el beneficio de sistemas ganaderos eco-eficientes, con enfoque en diferenciación de productos y pagos de servicios ambientales\". Dicho proyecto se encuentra en el marco del programa de investigación \"Desarrollo y uso de recursos forrajeros para sistemas sostenibles de producción bovina para el departamento del Cauca\", realizado entre la Universidad del Cauca y el Programa de Forrajes Tropicales del CIAT, y financiado por Sistema General de Regalías (SGR). El programa está compuesto por cinco proyectos basados en el uso de forrajes tropicales que responden a los siguientes componentes: Germoplasma, Agua, Ambiente, Suelos, y Socio-económico","keywords":[],"chapters":[{"head":"Paola Llanos, Stefan Burkart Centro Internacional de Agricultura Tropical (CIAT)","index":1,"paragraphs":[{"index":1,"size":20,"text":"Análisis de la disposición a pagar por servicios ambientales y una carne diferenciada por parte de los restaurantes y comercializadoras"}]},{"head":"Introducción","index":2,"paragraphs":[{"index":1,"size":478,"text":"La producción pecuaria tiene un gran impacto en recursos globales como el agua, la tierra y la biodiversidad y contribuye significativamente al cambio climático. La ganadería es, con gran diferencia, la actividad humana que ocupa una mayor superficie de tierra. En total, a la producción ganadera se destina el 70 por ciento de la superficie agrícola y el 30 por ciento de la superficie terrestre del planeta. La expansión de la producción ganadera es un factor fundamental en la deforestación, especialmente en América Latina. El sector ganadero reviste una importancia fundamental ya que es responsable del 18 por ciento de las emisiones de gases de efecto invernadero medidos en equivalentes de CO2, un porcentaje mayor que el correspondiente a los medios de transporte. También responsable en medida aún más significativa de la emisión de algunos gases que tienen un mayor potencial de calentamiento de la atmósfera. (FAO, 2006) La ganadería bovina es una de las principales actividades en los procesos de desarrollo rural, no solo por el incremento de ingresos sino también por ser una fuente generadora de empleo, al punto que participa con el 53 por ciento del Producto Interno Bruto pecuario, el 19,5 por ciento del agropecuario y el 1,3 por ciento del PIB nacional. (FEDEGAN, 2014) En la actualidad, 34,9 millones de hectáreas (32% del territorio nacional) se utilizan como pastos para 23,5 millones de animales, la Población Bovina en el país está distribuida en 514.794 predios y constituida aproximadamente por 23'475.022 animales, ubicados principalmente en los departamentos de Antioquia (11,75%), Córdoba (8,74%), Casanare (7,93%), Meta (7,38%), Caquetá (6,33%), Santander (6,14%) Cesar (5,56%), Magdalena (5,13%) y Cundinamarca (4,88%) que agrupan el 63,84% de la población total nacional. (ICA, 2016) En Colombia, la Federación Colombiana de Ganaderos (FEDEGAN), y el gobierno nacional a través del Programa de Transformación Productiva (PTP), afirman que la situación y las tendencias en el mercado mundial de carne bovina, representan oportunidades para que Colombia se convierta en líder productor y exportador de productos cárnicos en el mundo. Además, describen a Colombia como un país con alto potencial exportador para este mercado con productos de valor agregado (Lafaurie, J.F, Mayo de 2011) \"La ganadería nacional y sus productos derivados, se han destacado por ser capaces de abastecer por si solos la demanda interna, no obstante, tanto el sector privado como el gobierno nacional, han emprendido acciones para alcanzar los mercados internacionales a través de mejorar su productividad y competitividad\" (Departamento Nacional de Planeación (DNP), 2010, p.8) Según en el Documento CONPES 3676 de 2010 \"en los mercados mundiales se han posicionado progresivamente productos cuyas características favorecen la percepción de calidad del consumidor en lo relativo a la salud humana, el bienestar animal y el cuidado del ecosistema\", por lo que no se trata únicamente de producir más carne, sino de producir bajo unos estándares que permitan cumplir con las exigencias del mercado."},{"index":2,"size":174,"text":"A nivel mundial, la eco-eficiencia es un concepto que ha tomado fuerza, pues la optimización de los recursos económicos, sociales y ambientales representa un factor generador de competitividad e innovación, y es considerado de gran importancia en temas como cambio climático, seguridad alimentaria y comercio internacional, entre otros. El Centro Internacional de Agricultura Tropical (CIAT), describe la agricultura eco-eficiente como amigable con el medio ambiente, competitiva y rentable así como sostenible y resiliente (Centro Internacional De Agricultura Tropical, 2014) Con el propósito de contribuir con estos estudios el Centro Internacional de Agricultura Tropical -CIAT en convenio con la Universidad del Cauca y productores de los municipios de Patía y Mercaderes del departamento del Cauca, implementan el programa de investigación: Desarrollo de recursos forrajeros en sistemas sostenibles de producción bovina para el departamento del Cauca, financiado por el Sistema General de Regalías, que consiste de cinco proyectos enfocados al uso eficiente del agua, recuperación de suelos degradados, medición de gases efecto invernadero, evaluación de especies forrajeras y el pago por servicios ambientales y productos diferenciados."},{"index":3,"size":85,"text":"El objetivo principal de este informe es presentar un análisis de la disposición de las comercializadoras y restaurantes de carne de la ciudad de Cali para pagar por servicios ambientales (carne producida bajo sistemas ganaderos eco-eficientes), como un mercado potencial para la carne producida en el municipio del Patía. Además de conocer el nivel de conciencia ambiental y el interés por comercializar productos diferenciados que generan una menor huella en el medio ambiente y que a su vez les permitan retornar beneficios a los productores."}]},{"head":"Estado del arte","index":3,"paragraphs":[{"index":1,"size":81,"text":"Diversos estudios indican que el comportamiento de los consumidores es un proceso que requiere de investigación de mercado para el posicionamiento de un producto alimenticio, más aún, teniendo en cuenta las nuevas tendencias de consumo saludable y cuidado del medio ambiente. La calidad de la carne tradicionalmente se ha determinado por los aspectos sensoriales como la textura, frescura, sabor y color. Sin embargo, los aspectos de nutrición y bienestar animal han ganado mucha importancia como atributos relevantes al momento de comprar."},{"index":2,"size":26,"text":"A continuación se mencionan algunos estudios realizados durante los últimos años relacionados con la disponibilidad a pagar, la carne diferenciada y los pagos por servicios ambientales."}]},{"head":"Disponiblidad a pagar","index":4,"paragraphs":[{"index":1,"size":147,"text":"Según (Charry, 2017), el segmento inicial para explorar el potencial de un producto cárnico diferenciado por beneficios ambientales, está caracterizado principalmente por mayores niveles de ingreso y educación. Con los hallazgos de esta investigación se obtiene un punto de partida para la estrategia de desarrollo de productos diferenciados de sistemas silvopastoriles con pasturas mejoradas. Teniendo un estimado de la disposición a pagar por estos productos, se sugiere continuar el proceso con la definición de características específicas para el desarrollo de un producto ajustado a los requerimientos del segmento identificado, considerando factores como empaque, puntos de distribución, presentación, etc. Los resultados obtenidos durante las etapas de este estudio son consistentes y permiten concluir que existe un potencial para el desarrollo de un producto cárnico con diferenciación por beneficios ambientales y de bienestar animal en el segmento de consumidores de ingresos medios y altos en la ciudad de Cali."}]},{"head":"Carne de res diferenciada o sostenible","index":5,"paragraphs":[{"index":1,"size":61,"text":"La Mesa Redonda Global para la Ganadería Sostenible reconoce que la industria de la ganadería juega un papel importante en las vidas de las personas y comunidades que producen y consumen la carne; en el bienestar de los animales bajo nuestro cuidado, en el manejo de los recursos naturales y al satisfacer las demandas mundiales de proteína animal de manera eficiente."},{"index":2,"size":241,"text":"Define la carne sostenible como un producto socialmente responsable, que respeta al ambiente y que es viable a nivel económico; a su vez, también es aquél que prioriza al Planeta (principios más De acuerdo con (Zapata,2007) La falta de capital para el establecimiento, la escasa disponibilidad de semillas y el poco conocimiento de los SSP (Dagang y Nair 2003) han sido las principales barreras para la adopción de estos sistemas en la zona, a pesar de que se han encontrado incrementos en la producción de leche (entre 40 y 60%) con SSP intensivos y bancos forrajeros multiestrato (Murgueitio et ál. 2006). El proyecto Enfoques Silvopastoriles Integrados para el Manejo de Ecosistemas (GEF-Silvopastoril, financiado por GEF, FAO y Banco Mundial e implementado por CATIE en Costa Rica, Nitlapán en Nicaragua y CIPAV en Colombia) en el Quindío evaluó el impacto del pago por servicios ambientales (PSA) en el cambio de uso de la tierra para establecer sistemas ganaderos amigables con el ambiente. En este período hubo un incremento de un 8% en las ganancias de los productores, mostrando la tendencia hacia usos de la tierra con mayores beneficios ambientales (carbono y biodiversidad). Esto demuestra que el PSA tuvo un impacto positivo en fomentar los cambios de usos de la tierra hacia sistemas más amigables con el ambiente. El financiamiento en la fase de establecimiento es primordial para que los pequeños productores puedan implementar estos sistemas. (Zapata, Murgueitio, Mejía, Zuluaga, & Ibrahim, 2007) "}]},{"head":"Diseño metodológico","index":6,"paragraphs":[]},{"head":"Exploración de literatura:","index":7,"paragraphs":[{"index":1,"size":70,"text":"Para iniciar se realizó la búsqueda de información donde se indican los beneficios ambientales de prácticas ganaderas sostenibles, específicamente de los sistemas silvopastoriles con pasturas mejoradas. Se obtuvo información para determinar la reducción de emisiones de GEI, en comparación con las emisiones de los sistemas ganaderos tradicionales. Adicionalmente se obtuvo información sobre los beneficios de la cadena de valor y su efecto en la retribución de beneficios a los productores."}]},{"head":"Técnica de recolección de datos:","index":8,"paragraphs":[{"index":1,"size":72,"text":"Se hizo el diseño, aplicación y análisis de una encuesta para indagar la percepción sobre el cambio climático y la disponibilidad a pagar por productos diferenciados entre los gerentes de los restaurantes y comercializadoras, como clientes potenciales para la carne producida en el municipio de Patía, con el propósito de identificar sus opiniones, políticas e intereses sobre estos temas y crear conciencia de la importancia de su papel en la cadena cárnica."}]},{"head":"Caracterización de la muestra:","index":9,"paragraphs":[{"index":1,"size":94,"text":"La muestra fue seleccionada de forma aleatoria entre los restaurantes ubicados en la ciudad de Cali, de alto nivel adquisitivo, pertenecientes a estratos económicos 5 y 6. Se realizó la entrevista directa con los gerentes o funcionarios a cargo de las compras en 7 restaurantes que promocionaran productos de carne de res. Se hizo la prueba piloto, recolección de información, captura y depuración de datos. Se utilizó un único formulario de la entrevista semi-estructurada con elementos cualitativos y cuantitativos, para reunir información sobre las políticas de compra y disponibilidad a pagar por productos diferenciados."}]},{"head":"Herramientas de consulta:","index":10,"paragraphs":[{"index":1,"size":69,"text":"Inicialmente se consulto acerca de las preferencias y políticas de compra de la carne de res, la procedencia de la carne (Nacional o importada), las características físicas que debe cumplir el producto, la ciudad de origen, la trazabilidad, proveedores y razas de ganado. Fue importante conocer la cantidad de carne que se compra mensualmente, los cortes que más se venden y la preferencia entre res, cerdo, pollo y pescado."},{"index":2,"size":42,"text":"Algunas preguntas relevantes fueron sobre el interés en comercializar productos diferenciados, si los conoce o los distribuye, si le han solicitado estos productos, y si venderían carne de res sostenible pagando un mayor valor, y cuál sería el porcentaje adicional que pagaría."},{"index":3,"size":42,"text":"Finalmente se entregó un cuestionario para ser diligenciado, en el que se relacionan preguntas sobre conocimiento ambiental, impacto de la ganadería, conciencia ecológica, prácticas eco-eficientes o si realizan algún tipo de manejo en su restaurante para mejorar y/o ayudar el medio ambiente."},{"index":4,"size":25,"text":"Se hizo énfasis en la posibilidad de comercializar productos diferenciados y/o con valor agregado y su disposición para retribuir los beneficios obtenidos con los productores."}]},{"head":"Resultados","index":11,"paragraphs":[]},{"head":"Características de compra y oportunidades para la distribución de productos diferenciados","index":12,"paragraphs":[{"index":1,"size":81,"text":"Las políticas de los establecimientos definen que los elementos principales a tener en cuenta al momento de comprar carne de res, son el olor, el color, la textura de la carne y el tamaño de la pieza, es importante conocer la trazabilidad del producto ya que la temperatura, el transporte y las plantas de sacrificio juegan un papel importante en el resultado del producto final. El punto de maduración es relevante ya que esta característica es muy solicitada por los restaurantes."},{"index":2,"size":99,"text":"La raza Angus se destaca entre los compradores por el sabor diferente de la carne, generalmente se consigue importada ya que hay piezas que salen a mejor precio y de mejor calidad en el mercado importado, como la tira, que se consigue en países como Argentina y Uruguay, piezas como el lomo redondo se compran en Estados Unidos. El corte que se encontró común entre los entrevistados es el lomo viche que se populariza por la terneza lo que permite que sea fácil de trabajar, además, se compra sobrebarriga, lengua y jarrete, que se compran en el mercado nacional."},{"index":3,"size":117,"text":"Se identificó un proveedor en común que surte a los principales restaurantes de la ciudad, quien se encarga de seleccionar las piezas entre distintas comercializadoras y productores, en su mayoría lomo viche, según las características que le solicitan, él es quien se encarga del proceso de maduración de la carne y la distribuye entre los establecimientos. Esto hace que el costo sea mayor pero cuenta con la garantía de la calidad del producto. Actualmente se comercializa alrededor de 500kg/mes de carne de res, distribuida entre lomo y sobrebarriga, en algunos casos se presentan hasta 40 piezas de lomo mensuales. Es el quien confirma que la carne que se distribuye entre los restaurantes proviene de la costa colombiana."},{"index":4,"size":37,"text":"Se los comerciantes tienen el referente de que el departamento del Cauca es mal proveedor para la carne ya que es más dura que la de otras regiones, pero que es mejor para la producción de leche."},{"index":5,"size":38,"text":"Existe un mercado potencial para la producción ganadera de la región por las características de su ubicación geográfica contando con variedad de pisos térmicos permitiendo la explotación de diferentes razas bovinas productoras de carne, leche y doble propósito."},{"index":6,"size":78,"text":"Los productos diferenciados tienen una gran acogida en estos mercados, ya que promueven el consumo de alimentos orgánicos, artesanales, con sellos de bienestar animal, o que brinden algún beneficio al medio ambiente. Platos que incluyen cordero, el pescado obtenido con la pesca artesanal y el uso de vegetales orgánicos le dan un valor agregado al establecimiento que los ofrece sus productos con esta premisa, por ende, su costo es más alto, valor que finalmente será retribuido al productor."}]},{"head":"DAP por carne diferenciada, generando retribución de beneficios a los productores.","index":13,"paragraphs":[{"index":1,"size":84,"text":"La producción de la carne de res ha sido uno de los productos que genera gran impacto ambiental, por lo que la producción bajo sistemas eco -eficientes que generan una menor huella en el medio ambiente, fue bien acogida entre los propietarios de los establecimientos quienes aseguraron que estarían dispuestos a pagar más por kilo de carne, siempre que el producto conserve la calidad que se requiere, ya que, aunque tenga certificaciones y sellos ambientales, lo más importante es el sabor y la textura."},{"index":2,"size":49,"text":"Los participantes declararon estar dispuestos a pagar entre un 8% y un 10% más por carne de res que sea igual a la carne convencional en todos los aspectos de calidad, mientras que esta haya sido producida bajo condiciones que reduzcan los impactos ambientales negativos que se mencionaron anteriormente."}]},{"head":"Conciencia ambiental de restaurantes y comercializadoras de carne y la promoción de productos diferenciados.","index":14,"paragraphs":[{"index":1,"size":98,"text":"En Cali encontramos que en los establecimientos de consumo tienen gran interés en el tema de la conciencia ambiental, no solo en su manejo interno, sino promoviéndolo con sus clientes. Se están implementando estrategias de ahorro en el consumo para reutilizar los recursos de forma eficiente, como el uso de aguas lluvias para las labores de aseo, el uso de pitillos de papel, no se entregan pitillos si no lo piden, residuos líquidos en botellas, papel ecológico en los menús y sobre manteles; manejo apropiado de desperdicios clasificando y minimizando la cantidad de residuo, por mencionar algunas estrategias."},{"index":2,"size":86,"text":"Encontramos que hay restaurantes que están en el proceso de certificarse como una empresa B, el cual le da un reconocimiento mundial, ya que la idea no es que sean las mejores empresas del mundo, sino que sean las mejores empresas para el mundo. La propuesta de Sistema B apunta a una economía que pueda crear valor integral para el Mundo y la Tierra, promoviendo formas de organización económica que puedan ser medidas desde el bienestar de las personas, las sociedades y la Tierra (SistemaB, n.d.)"}]},{"head":"Discusión","index":15,"paragraphs":[{"index":1,"size":66,"text":"Es de gran importancia reconocer que los encuestados coincidieron en que están dispuestos a pagar un mayor valor por carne con un menor impacto ambiental, siempre que conserven sus características de calidad. Esto indica que existe un mercado potencial siendo necesario el desarrollo de estrategias que permitan comercializar productos sostenibles producidos en el Patía, promocionados bajo la premisa de carne sostenible producida con nuevas tecnologías forrajeras."},{"index":2,"size":45,"text":"Estos resultados van acordes a los hallados en estudios similares y ayudan a generar la caracterización del comercializador y distribuidor de carne \"eco-amigable\" en la ciudad. Se requiere un ejercicio de segmentación de la población objetivo a mayor escala para obtener un análisis más detallado."},{"index":3,"size":148,"text":"Entre los productos diferenciados más comunes se encontró el uso de la carne de raza Angus, la principal característica de esta (y de los animales producto de cruzamiento con ella) es tal vez su tamaño medio, característica que explica en gran porcentaje su calidad de carne, que proveniente de animales que logran terminarse a menor edad y menor peso que otras razas y por tanto, de ejemplares más jóvenes, es determinante para la terneza de su carne. (Peláez M., 2015) Este tipo de carne tiene un costo mayor, en comparación con otras razas, siendo este un valor agregado que ofrecen los establecimientos y que por su puesto, esta implícito en el valor del producto final. Por ello, si el consumidor está dispuesto a pagar el valor adicional, habrá una retribución al productor, siendo así, este ingreso adicional funcionaría como incentivo para la adopción de las prácticas mencionadas anteriormente."},{"index":4,"size":87,"text":"Para garantizar que los ingresos adicionales obtenidos por los productos diferenciados no sean capturados por intermediarios, distribuidores o élites, es necesario continuar con el fortalecimiento del poder de negociación de los pequeños productores y desarrollar un marco institucional que promueva la inclusión y garantice la distribución justa de los beneficios a lo largo de la cadena. Solo garantizando que el valor agregado esta efectivamente llegando al pequeño productor, tiene sentido implementar una estrategia de productos diferenciados para fomentar la adopción de prácticas productivas más sostenibles (Charry, 2017)."}]},{"head":"Conclusiones y recomendaciones","index":16,"paragraphs":[{"index":1,"size":63,"text":"Las nuevas tendencias alimenticias en el mundo están girando en torno a los mercados verdes, productos orgánicos, el interés por el bienestar animal y el cuidado del medio ambiente, por lo que los establecimientos de consumo deben estar en una actualización constante con el fin de llegar de manera más certera a sus clientes y aprovechar las nuevas oportunidades que ofrece el mercado."},{"index":2,"size":13,"text":"La economía mundial ha experimentado una expansión sin precedentes durante las últimas décadas."},{"index":3,"size":137,"text":"El crecimiento de la población, junto con los adelantos científicos y técnicos, los cambios políticos y económicos y la liberalización del comercio, han contribuido al crecimiento económico. En los países en desarrollo este crecimiento se ha traducido en un aumento de los ingresos per cápita y en una clase media emergente con un poder adquisitivo por encima de sus necesidades básicas. (FAO, 2006) Estos factores confirman que existe un mercado para los productos diferenciados como la carne de res producida bajo sistemas amigables con el medio ambiente. Para aprovechar ese potencial se necesita abrir nuevos canales de comercialización y fortalecer y formalizar los existentes, así como las vías de acceso y la regulación del transporte. La comercialización debe abordarse desde las políticas nacionales, formalizando los medios de producción, procesamiento y distribución de carne en los establecimientos expendedores."},{"index":4,"size":95,"text":"Parte del éxito estará entonces en saber aprovechar los Tratados de Libre Comercio que se tienen, a los que Colombia podría exportar miles de toneladas, sin desabastecer el mercado interno. El panorama nacional de los productos cárnicos está caracterizado por desafíos que plantean variables como los altos costos de alimentación, un consumo estancado y una rentabilidad decreciente. Es importante que los eslabones de la cadena de la carne funcionen de manera articulada y las acciones estén encaminadas a satisfacer el mercado con productos que no solo generen rentabilidad, sino un mayor bienestar social y ambiental."},{"index":5,"size":69,"text":"En cerca de 1000ha dedicadas a la ganadería en Valle del Patía, se han implementado sistemas silvopastoriles produciendo carne sostenible, si el comercializador está dispuesto a pagar un mayor valor por carne sostenible, este pago por servicios ambientales resulta beneficioso tanto para los productores como para el medio ambiente y puede funcionar como incentivo para promover distintas regiones el establecimiento de sistemas silvopastoriles y la implementación de prácticas eco-eficientes."},{"index":6,"size":55,"text":"Con los datos obtenidos de este informe se da un punto de partida para nuevas investigaciones sobre los productos diferenciados en la adopción de tecnologías forrajeras, conociendo la disponibilidad a pagar por carne sostenible, se sugiere continuar con el proceso de concientización, divulgación y promoción, definiendo las herramientas para cumplir con los requerimientos del mercado."}]}],"figures":[{"text":" relevantes: Recursos Naturales, Eficiencia e Innovación; Individuos y Comunidad); a los Individuos (principios más relevantes: Individuos y la Comunidad y sus Alimentos); a los Animales (principios más relevantes: Salud y bienestar animal, Alimentos, Eficiencia e Innovación) y al Progreso (principios relevantes: Recursos Naturales, Personas y Comunidad, Salud y Bienestar Animal, Alimentos, Eficiencia e Innovación) (MSRGGS, 2017) Pago por Servicios ambientales (PSA) "}],"sieverID":"e587dce4-5595-40ac-a353-4e9040ec5e07","abstract":""}

data/part_2/011c5e0f19c7e2568288b945b03bba4a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"011c5e0f19c7e2568288b945b03bba4a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7df1a123-f998-4b15-8fe9-28c2fc0a74c1/retrieve"},"pageCount":6,"title":"Monitoring, evaluating and learning for education and extension-a framework for Index Based Livestock Insurance I Date year","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":177,"text":"Though IBLI has seen its measures of success, one of the areas where it still faces considerable challenges is high transaction costs associated with operations and the marketing and distribution of the product. Several interrogations and evaluation studies have led to changes in the distribution model of IBLI in Kenya. In Ethiopia, the evaluations and interrogations have taken off only recently. At the heart of all these examinations have been the agents who sell IBLI and the clients who purchase them. As much as the delivery models are community-based with more or less structured hierarchy in both Kenya and Ethiopia, there is lack of standardised and systematic method of monitoring and evaluating the performance and behaviour of sales agents, and the subsequent effect of different education and extension methods on both clients and agents. This brief introduces a monitoring, evaluating and learning framework for both agents and clients, which the authors believe could lead to efficiency in delivery and creation of informed demand among beneficiaries in the pastoral communities if adopted and integrated into the operational process."}]},{"head":"Justification","index":2,"paragraphs":[{"index":1,"size":77,"text":"Monitoring, evaluation and learning (MEL) frameworks are largely recognized as integral parts of successful and thoughtful development interventions (Winderl and Colville 2009). Aside from collecting data that may help inform substantive impact assessment, monitoring practices allow for course correction if a project deviates from an intended outcome. The learning component of MEL supports this consistent self-evaluation and assumes that corrections will have to be made when implementing a complex intervention, such as building resilience with pastoralist communities."},{"index":2,"size":24,"text":"The proposed MEL framework focuses specifically on extension and education initiatives for both the agents (the service deliverers) and the clients (the service consumers)."}]},{"head":"ILRI EXTENSION BRIEF May 2019","index":3,"paragraphs":[{"index":1,"size":95,"text":"In the context of IBLI, extension refers to marketing, educating and interfacing with potential and existing pastoralist clients. Extension activities include direct marketing, such as signage and radio spots; face-to-face outreach done by sales agents, lead agents or village insurance promoters (VIPs); and customer service support, such as planned SMS or interactive voice response (IVR) question-and-answer systems. On the other side of the coin, education refers to the training and support provided for IBLI sales agents to enhance their capacity. These programs include face-to-face or digital sales training and monitoring of agent progress and performance."},{"index":2,"size":106,"text":"We hypothesize that monitoring education and extension practices is critical to scaling IBLI to other geographies and pastoralist contexts. As previously mentioned, the distribution structure of IBLI, while largely successful, still faces several challenges. In 2016 and 2018, an evaluation was carried out by ILRI in collaboration with Kenya Markets Trust and Cornell University on the current model to identify challenges and provide recommendations towards a cost-effective and sustainable agency structure (Banerjee et al. 2017). The study uncovered constant challenges with sales agent training efficacy, specifically with lead agents (LAs) and subagents in Kenya, which results in subpar sales performance or misleading customers into contract sales."},{"index":3,"size":125,"text":"In both Kenya and Ethiopia, there are no formalized processes for monitoring and assessing the performance of sales agents, tracking IBLI contract renewals and rewarding performance. This lack of tracking has adverse effects on agent retention and motivation in Kenya, with many qualified sales agents feeling discouraged with only an eight percent sales commission and no other incentives to work towards, such as recognition for consistent high performance. In Ethiopia, while there seems to be strong sense of community service among agents, it will only continue until similar challenges seen in Kenya start surfacing in Ethiopia as well. Understanding how to effectively integrate MEL into an agency-based sales model can fill the current gaps in tracking renewals and in monitoring, assessing and rewarding agent performance."},{"index":4,"size":68,"text":"The following MEL framework is presented as a general framework meant to be customised for a specific geographic context and used as a standard procedure to develop MEL systems. Utilizing standard procedures and best practices for tracking and iterating will allow these systems to scale in conjunction with agency distribution systems and tracking agent performance. Effective methods of stimulating informed demand can lower costs and sustain product distribution."}]},{"head":"Framework development process","index":4,"paragraphs":[{"index":1,"size":83,"text":"The MEL framework development process began by interrogating the relationship between IBLI uptake; client education; and adequate agent training, motivation and monitoring hierarchies. Specifically, the concept of \"informed demand\" underpins this process. Informed demand is not simply demand for the IBLI product; rather, it requires that customers are buying IBLI for the right reasons-because they understand the product, how index-based livestock insurance operates, the conditionalities of indemnity payout and the specific risks it protects against. The key assumptions tied underlying this ToC include:"}]},{"head":"•","index":5,"paragraphs":[{"index":1,"size":21,"text":"The poor uptake of IBLI is primarily a function of inefficient and/or insufficient extension and education efforts rather than other causes."},{"index":2,"size":28,"text":"• Through effective extension methods and welltrained agents, the community and prospective clients will understand IBLI and therefore be compelled to purchase coverage as it fits their needs."},{"index":3,"size":16,"text":"• Informed demand will generate not only new sales, but also facilitate renewals of existing policies."},{"index":4,"size":26,"text":"Finally, an overarching assumption inherent in the IBLI model is that pastoralist households will be protected from drought-related livestock losses and financial shocks through IBLI coverage."},{"index":5,"size":142,"text":"Based on the above theory of change, an initial conceptual framework and workflow was created in consultation with members of the IBLI team who were already leading efforts in improving extension and education methods and tools. The conceptual framework is underpinned by the emphasis given in the ToC to cultivating informed demand through improving education and extension efforts as critical components for IBLI uptake. Following this drafting process, the research team tested key components of the framework through a two-part rapid needs assessment. As a result of this assessment, the research team was able to effectively apply and test different components of the framework to address real issues in the existing agencybased distribution structure in Kenya. Furthermore, the team was able to combine both the MEL framework and key findings from the rapid needs assessment into concrete short, medium and long-term recommendations."},{"index":6,"size":28,"text":"The recommendations pointed out the need for revising existing IBLI extension content; continuing agent profiling activities; and underlining the necessity of an agent profiling, tracking and feedback system."},{"index":7,"size":6,"text":"The monitoring, evaluation and learning framework"},{"index":8,"size":146,"text":"The following MEL model has been conceptualized as being applicable to multiple contexts and agency structures (Figure 2). Ideally, the model can assist in framing MEL systems in different geographical contexts as IBLI scales and expands into new territory. The model assumes effective sales and distribution is dependent on a strong agency structure, of which informed demand is a crucial part. This assumption underscores that assessing education and extension efforts is critical for a robust sales and distribution model. Sales and distribution channels are overarching elements to the MEL framework. Depending on the context, IBLI may be sold and distributed through an individual or shop-based model (such as being largely followed in Kenya) or through group methods (such as currently being done in Ethiopia). Each of the distribution models will have different hierarchies and operational structures depending on the institutional frameworks, delivery channels and commercial partners."},{"index":9,"size":17,"text":"We assume that each sales and distribution structure involves field sales agents and has a hierarchical supervision."},{"index":10,"size":152,"text":"Enforcing of monitoring education and extension processes lies within agency-based sales and distribution systems, such as mandatory refresher courses for existing agents before the beginning of each sales window. Extension and education activities take place through sales and distribution channels and are delivered by the sales agencies. Extension, education and monitoring for these activities is time-bound. These activities should be iterative enough to encompass feedback from clients and agents on how to improve these methods, while seeking to evaluate the overall efficacy of the different methods being used (refer to Figure 2).    Adopting and embedding the MEL framework requires certain process standardizations aimed at developing MEL systems. Utilizing standard procedures and best practices for tracking and iterating allows MEL systems to scale in conjunction with a given agency distribution system. Furthermore, tracking agent performance and identifying which methods are most effective for stimulating informed demand can lower costs and sustain product distribution."}]},{"head":"Recommendations and ways forward","index":6,"paragraphs":[{"index":1,"size":54,"text":"Operationalizing a MEL framework such as this requires short, medium and long-term prerequisites. Some of the main prerequisites are resources and buy-in from commercial and government partners. It is critical for this framework to be embedded in existing hierarchical agencybased structures as a standard operating procedure (SOP) and performance indicator for individual sales agents."},{"index":2,"size":21,"text":"• Short term i. Revising and cataloguing existing extension and education materials using feedback from stakeholders, specifically sales agents and beneficiaries."},{"index":3,"size":28,"text":"ii. Standardizing recruitment, motivation and incentive structures of agency-based distribution systems tied to MEL practices. Enforcement of MEL procedures will not be effective if this is not done."},{"index":4,"size":20,"text":"• Medium term i. Plan and execute comprehensive needs assessments to capture information and considerations in different geographies and contexts."},{"index":5,"size":48,"text":"ii. Profile agent to evaluate an agent population in terms of literacy, languages spoken, digital literacy and comfort levels, current knowledge of livestock markets and local markets, and sales history. This profiling should serve as a baseline metric pool for monitoring of agent sales process and knowledge growth."}]},{"head":"• Long term","index":7,"paragraphs":[{"index":1,"size":32,"text":"Establish agent tracking and feedback systems at either digital level or embedded in hierarchical agency frameworks within commercial partners, enabling MEL procedures to be adopted as SOPs within the agency-based distribution framework."},{"index":2,"size":125,"text":"As a way forward, with support from funders such as International Initiative for Impact Evaluation (3ie), ILRI has started working with the private and public sector on revising, cataloguing and improving the delivery of the existing learning content. This includes designing and testing a digital agent profiling system, which would be rolled out in 2019 to reach the medium-term goals of setting up standard operating procedures and performance indicators for agents. Further support is being provided by the government of Kenya and entities such as the Swiss Capacity Development Fund (SCBF) to achieve the longterm prerequisites of operationalising the MEL framework, which should enable tracking performance and behavioural change of agents in the process of delivering financial services in the arid and semi-arid (ASAL) regions. "}]}],"figures":[{"text":"Figure 1 : Figure 1: Theory of change (ToC) behind the process of improving extension and education as a means of cultivating informed demand, thereby increasing IBLI uptake and improving pastoralist resilience to drought. "},{"text":"Figure 2 : Figure 2: Monitoring evaluation and learning model "},{"text":"- Closely tied with the extension and education process is performance assessment. Performance assessment is the lens through which the potential of extension and education activities to cultivate informed demand is evaluated. The model suggests the use of mixed methods-a combination of quantitative and qualitative methods-to determine what works, what does not work and understand the reasons behind successes and failures. For example, individual client knowledge of IBLI can be assessed through regular surveys and other follow up methods. In addition, commercial partner data, specifically sales and contract renewal data, are critical to performance assessment. Performance assessment operationalization is dependent on timelines, which should also coincide with the monitoring and assessment timeframes. As part of the ultimate goal of improving IBLI delivery, having such structured monitoring and evaluation systems allow for overall reduction of operating and transaction costs of the service providers, while also allowing them to better provide goods and other valuable services to dryland communities.Applicability of the frameworkApplying the agency-based MEL model is contingent on the context. However, there are still key guidelines to follow when operationalizing such frameworks. Operationalizing the performance assessment is dependent on two types of indicators: process-oriented and output-oriented. Processoriented indicators evaluate what can be improved in a given extension or evaluation method, while outcomeoriented indicators directly evaluate what is most effectivein generating informed demand. Process indicators -Group Based -Co-ops, Associations, MFIs -Individual Based -Service providers, traders, agents providing other services -Shop Based -Shop owners Each of these are assumed to have different hierarchy or operational structures Based on trainings given, number of sales, client knowledge, renewals -through mixed methods -Determine incentives being provided to the agents, identifying weak links, capacity development strategies, targeting, best practices among others "},{"text":" Photo credit: Page 1: ILRI/Riccardo Gangale Page 2: ILRI/Stevie Mann Page 3: ILRI/Apollo Habtamu Page 4: ILRI/Riccardo Gangale "},{"text":"  "},{"text":"  "},{"text":"Structured Monitoring and Evaluation Systems Reducing operating and transaction costs  comprise the monitoring aspect of this framework-they comprise the monitoring aspect of this framework-they are meant to signal whether an extension or evaluation are meant to signal whether an extension or evaluation method is being operationalized correctly, and what (if any) method is being operationalized correctly, and what (if any) corrections are necessary to take. Outcome indicators corrections are necessary to take. Outcome indicators feed into the evaluation component of the framework and feed into the evaluation component of the framework and can provide richer information on the overall effects of can provide richer information on the overall effects of extension and education efforts. Both sets of indicators are extension and education efforts. Both sets of indicators are types of agent monitoring, which is critical to maximizing types of agent monitoring, which is critical to maximizing operational efficiency for commercial partners. Monitoring operational efficiency for commercial partners. Monitoring process indicators is critical to the \"express, test and cycle\" process indicators is critical to the \"express, test and cycle\" method of product design. By emphasizing this learning method of product design. By emphasizing this learning component, extension and education interventions can be component, extension and education interventions can be steadily improved. steadily improved. While the two types of indicators can be customized While the two types of indicators can be customized depending on local need, both extension and education depending on local need, both extension and education should have their own process and outcome indicators. should have their own process and outcome indicators. Additionally, each education or extension method must Additionally, each education or extension method must have process and outcome indicators specified. Table 1 have process and outcome indicators specified. Table 1 provides sample indicators for measuring the efficacy of provides sample indicators for measuring the efficacy of different extension methods, such as radio marketing or different extension methods, such as radio marketing or face-to-face sensitization. face-to-face sensitization. Sustainable Sustainable agency structure agency structure helps better helps better provision of provision of goods and goods and services towards services towards ultimately ultimately enhancing the enhancing the livelihoods of livelihoods of the pastoralists the pastoralists  "},{"text":"Table 1 : Sample indicators for extension methods Process indicators Outcome indicators Process indicatorsOutcome indicators Radio message frequency Results of a client phone survey Radio message frequency Results of a client phone survey Number of clients Types of customer support Number of clientsTypes of customer support interacting with customer queries interacting with customerqueries support services (such as  support services (such as IVR or SMS)  IVR or SMS) Number of face-to-face Number of new and renewal sales Number of face-to-faceNumber of new and renewal sales interactions with clients  interactions with clients  "},{"text":"Table 2  provides sample indicators for monitoring provides sample indicators for monitoring agent knowledge levels. It should be pointed out that agent knowledge levels. It should be pointed out that enforcement of agent monitoring must be engendered in enforcement of agent monitoring must be engendered in the hierarchy of the agency system itself. the hierarchy of the agency system itself.  "},{"text":"Table 2 : Sample indicators for education methods Process indicators Outcome indicators Process indicatorsOutcome indicators Agent scores on training tests Sales and renewal sales data Agent scores on training testsSales and renewal sales data and refresher courses by agent and refresher coursesby agent Focus group discussions Compliance monitoring Focus group discussionsCompliance monitoring evaluating agent experience reinforced through agency evaluating agent experiencereinforced through agency with training methods hierarchy with training methodshierarchy Implication for scale  Implication for scale The MEL agency-based framework is a component of The MEL agency-based framework is a component of the IBLI sales and distribution model that can fill the the IBLI sales and distribution model that can fill the current gaps in rewarding, monitoring and assessing agent current gaps in rewarding, monitoring and assessing agent performance, and tracking renewals. All of these are critical performance, and tracking renewals. All of these are critical for scaling IBLI to other pastoralist communities outside of for scaling IBLI to other pastoralist communities outside of northern Kenya and southern Ethiopia. If a MEL model like northern Kenya and southern Ethiopia. If a MEL model like this is adopted and embedded into the operational process this is adopted and embedded into the operational process of IBLI, it will not only increase informed demand by clients, of IBLI, it will not only increase informed demand by clients, but also enable the insurance companies who distribute but also enable the insurance companies who distribute IBLI to take on other valuable complementary services. IBLI to take on other valuable complementary services.  "}],"sieverID":"356e28a0-1426-41d0-8a6e-749592d1c502","abstract":""}

data/part_2/01a5144e832a1800a46440bf852e6499.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01a5144e832a1800a46440bf852e6499","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/50a2573a-29fa-4d5b-8fbf-ea5dd1b278de/retrieve"},"pageCount":2,"title":"New knowledge on how dairy cattle milk yield is affected by heat stress, in smallholder systems in East Africa","keywords":["P730 -Activity 1","2","3: Breeding Schemes <Not Defined> Contributing CRPs/Platforms: • Livestock -Livestock"],"chapters":[],"figures":[],"sieverID":"ff776830-2ba8-41f8-b0f7-43f364322154","abstract":"This research finding is the first to demonstrate the negative effect of increased temperature and humidity on milk yields of dairy cattle kept in smallholder production systems in East Africa. The next users of this information are implementers of genomic selection based breeding programs for dairy cattle, who wish to incorporate ability for cows to cope with increased temperature and humidity (heat stress) as part of their breeding objectives."}

data/part_2/01b1e8b71a73e5aebeecc3280210028c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01b1e8b71a73e5aebeecc3280210028c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/24de85d5-1b3b-4caa-8960-cd574b72a728/retrieve"},"pageCount":15,"title":"Poverty dynamics and the role of livestock in the Peruvian Andes","keywords":["Participatory research","Poverty","Stages-of-Progress","Livestock","Livelihoods"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":195,"text":"Recent national household income and expenditure surveys in Peru show that in 2000, more than half the population were classified as poor in absolute terms, and 15% as extremely poor (UNDP, 2002;INEI, 2002). Almost half of the 1.7 million 'extreme poor' live in highland rural areas, where poverty remains an intractable issue. While there is a considerable amount of literature on poverty and related issues in Peru, very little information exists regarding poverty dynamics over time, particularly for rural Andean households. And since most of these households rely on livelihood strategies based largely upon livestock, information as to the role that livestock play in helping to alleviate poverty is another area where relatively little research has been done. This paper addresses these two knowledge gaps, presenting a participatory poverty dynamics approach that examines households' pathways into and out of poverty over the long run, applied to 40 rural Andean communities in two different regions of Peru. The approach offered a unique 0308-521X/$ -see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.agsy.2006.09.009 opportunity to also study the role that livestock plays for households that have moved into versus out of poverty in these regions."},{"index":2,"size":78,"text":"Estimates of income poverty have been derived from other poverty indicators for Peru's 194 provinces and 1812 districts, and these disaggregated figures show considerable variability across space (Schady, 2002;Escobal and Torero, 2000). There are huge welfare disparities across the country, and a negative correlation between altitude, rainfall and temperature and household economic welfare, with access to public goods and services also playing a significant role in helping to explain some of these welfare disparities (Escobal and Torero, 2000)."},{"index":3,"size":177,"text":"Many of the existing poverty studies for Peru are based on the World Bank's Living Standard Measurement Survey (LSMS), and focus on determinants of poverty and the economic impact of specific policies and services (e.g. Escobal, 2001;Hill, 1988;Sabates, 2000;Schady, 2002;Laderchi, 2001). There are close to one hundred published works that use the Peruvian LSMS data listed on the World Bank LSMS website (see www.worldbank.org/ html/prdph/lsms). The World Bank's most recent study focuses on indigenous peoples, poverty and human development in Latin America over the last 10 years. It concludes that poverty among indigenous households remained virtually the same, at 62.3% in 1994 and 62.8% in 2000. Of all extremely poor households, 52% are indigenous (Patrinos and Hall, 2005). Herrera and Roubard (2003) analyzed panel data for 1720 Peruvian urban households over a period of two years in order to examine movements into and out of poverty. However, such a short period is insufficient to separate out stochastic, or short-term, movements as opposed to long-term or structural reasons for changes in households' poverty status (Carter and May, 1999)."},{"index":4,"size":224,"text":"Participatory poverty assessments have also been undertaken. In particular, a recent DFID and World Bank participatory poverty assessment for Peru was carried out in nine communities (in Lima, Puno, Ayacucho and Piura) and involved 730 participants (DFID and World Bank, 2003). This assessment asked respondents about their perceptions of a good and bad life; their most pressing problems and priorities; the nature of their interactions with public, market and civil society institutions; and changes in gender and social relations (see www.worldbank.org/ poverty/voices). While considerable insights were gained from such an exercise, they do not include information on poverty dynamics, i.e. how households have managed to fall into, or escape, poverty over time. Laderchi et al. (2003) compare poverty measures based on expenditures with more participatory approaches that focus on self-perceptions of poverty. They found that in their rural field site, 29% of those who declared themselves to be poor were not poor according to the monetary indicators, and 42% of those that were poor in monetary terms did not perceive themselves as being poor. Laderchi (1999) also explored whether monetary measures of poverty are a good proxy for multiple dimensions of poverty, captured by child stunting, illness and access to schooling. She concluded that targeting programmes based on monetary poverty measures result in significant targeting errors, a finding confirmed by Franco and Saith (2003)."},{"index":5,"size":123,"text":"These more participatory poverty studies have also tended to focus less on explaining poverty movements than poverty status. This study attempts to fill that gap by looking at household movements into, and out of, poverty over the last 10 and 25 year periods, and the reasons why particular households have experienced such movements. We employ a participatory method that has been used in four other countries with interesting results that allow improved targeting of poverty policies and interventions. Understanding the heterogeneous nature of the situations of poverty experienced by Peruvians, and their perceptions of the reasons for household-level movements into and out of poverty, will help contribute to appropriate targeting of interventions and improve the quality of delivery and sustainability of pro-poor initiatives."},{"index":6,"size":68,"text":"Many poverty researchers are now advocating linking complementary qualitative and quantitative poverty approaches to more fully understand such a complex issue (Booth et al., 1998;Kanbur, 2001;Lawson et al., 2003;Kristjanson et al., 2002). This suggestion, as well others that propose an asset-based approach and consider the issues of poverty traps (Carter and Barrett, 2006;Barrett and Swallow, 2006), relate strongly to the Stages-of-Progress approach taken in this study (Krishna, 2004)."}]},{"head":"Role of livestock","index":2,"paragraphs":[{"index":1,"size":131,"text":"Crop-livestock systems vary considerably across the different agro-ecological zones of Peru, as a result of differences in water availability, altitude, risk of frost, slope, and access to markets and market demands (Leon-Velarde et al., 2000). Livestock species important to rural households' livelihoods include cattle, sheep, goats, camelids (llamas, alpacas, vicuna and guanaco), pigs, guinea pigs, mules, donkey, horses and chickens. Livestock production in the highlands of Peru is largely based on grazing of pasture, supplemented with crop residues, particularly stovers, or agricultural by-products and, in certain cases, with improved feed resources. Thus rangelands, with native grass species, constitute the main feed resource for mixed crop-livestock systems with ruminant species (Leon-Velarde and Inquierdo-Cadeno, 1993). Households rely on livestock for a source of protein, energy, shelter, fertilizer, draught power, transportation, savings and insurance."},{"index":2,"size":127,"text":"Household accumulation of Criollo (indigenous breeds introduced in Latin America from the Iberian Peninsula some four to five hundred years ago, adapted to harsh environments (Drucker et al., 2001)) cattle and sheep is a common practice in the Andes. For poor households, they serve as assets for investments, and sources of savings for consumption in the households (Valdivia and Quiroz, 2003). Improved breeds of cattle are used for dairy production and provide a regular source of nutrition for the household as well as income (Leon-Velarde et al., 2000). Llamas and alpacas are important species in some areas and their wool/fiber is sold. Pigs, chickens and/or guinea pigs are also kept by most poor rural households, for home consumption as well as for selling when household needs arise."},{"index":3,"size":57,"text":"While we know that livestock play an important role in the many and diverse livelihood strategies observed throughout rural Peru (Valdivia and Escobal, 2004;World Bank, 1999), there is little empirical evidence of how important livestock are to the poor, or how they help households escape poverty (or indeed, if they play a role in descent into poverty)."},{"index":4,"size":75,"text":"This research evaluates the reasons that households have moved into and out of poverty over three periods -25 years ago to now, 25 years ago to 10 years ago, and 10 years ago to now -in two quite different regions of Peru, Puno and Cajamarca. It also examines the role that livestock play in poverty dynamics in these two regions where poverty is a serious issue and livestock are important in terms of livelihood strategies."}]},{"head":"Research approach and methods","index":3,"paragraphs":[{"index":1,"size":184,"text":"This study did not attempt to replicate the national representativeness of the large-scale household surveys that are the basis of poverty comparisons in Peru. Instead, selection of the two study regions, Puno and Cajamarca Departments, and the four Provinces within each of these regions, was made on the criteria of, first, high rural poverty rates, and second, areas where livestock plays an important part in rural livelihood strategies. Within the selected Provinces (see Fig. 1), twenty diverse communities were selected. We attempted to capture diversity with respect to five criteria that largely define rural households' livelihood options: altitude, agricultural activities, market access, size of community, and ethnic group and language. The site selection process followed was not designed to make inferences about the larger populations from which the samples were drawn. Rather, the purposive fieldwork selection procedure, from Departments to Provinces to communities, was designed to allow us to identify and describe a range of poor rural households engaged in agricultural activities ranging from mixed crop-livestock to primarily livestock-based systems. Studying livestocks' role vis-a `-vis poverty reduction was an important aspect of this project."},{"index":2,"size":26,"text":"Returning to Fig. 1, some brief observations about the regions and communities selected for research are made that will help in interpreting the results described later."},{"index":3,"size":170,"text":"Puno Department is located in the Peruvian Altiplano, which is a high Andean plain next to Lake Titicaca. The plain rises from the lake level at 3800 m to over 4500 m altitude and is bisected by the international border between Peru and Bolivia. There are four agroecological zones that vary with distance from Lake Titicaca (Swinton and Quiroz, 2001). These are the Lakeside zone, Suni zone A, Suni zone B, and the Dry Puna zone. The communities selected are located in the latter two zones. Suni zone B is characterized by a frost-free period of 3-5 months, relatively risky cropping (compared to the Lakeside and Suni zone A) and range-fed livestock production. The Dry Puna zone (Mazo Cruz in Fig. 1) has a frost-free season of less than 3 months, and annual precipitation of under 600 mm., and the agricultural production systems are predominantly oriented towards grazing, primarily alpacas and sheep. District-level poverty in Puno ranged from 63% to 95% of households with at least one unmet basic need."},{"index":4,"size":47,"text":"The Cajamarca area includes several micro watersheds within the region, which lies between 2800 and 3700 m above the sea. Most households have around forty percent of their land on slopes. Land is classified into three agroecological zones: Jalca (upper hillsides), Hillsides and Valley (including lower hillsides)."},{"index":5,"size":110,"text":"The Hillside production system is based on the cultivation of diverse annual crops including cereals, legumes and Andean roots and tubers. In the past, lack of water between May and September did not permit farmers to grow perennial forages for their livestock on the hills. Recently, however, many farmers have obtained access to irrigation that permits them to grow ryegrass pastures and increase the number of dairy cows they manage. The use of oats and barley hay for animal feeding is also widespread. Cows are also used for animal traction, an important additional benefit for farmers. The feeding of livestock is based on crop residues, natural pasture and cultivated pasture."},{"index":6,"size":73,"text":"Areas of the Jalca (above 3500 m) face lower average temperatures than Hillside areas and therefore many crops from Hillside cannot grow there. However, the deep organic soils have formed there due to the lower temperatures favor water retention and the growing of annual and perennial pasture and off-season potato crops. The cultivation of rye grass for livestock feeding is significant as is supplementation in the dry season with oats and barley hay."},{"index":7,"size":39,"text":"Land-use systems in Cajamarca are different from those found in the central and southern Andes of Peru. For example, unlike Puno, there is not much communally managed land in Cajamarca, and household access to different production zones is limited."},{"index":8,"size":109,"text":"Characteristics of the selected communities (20 in Cajamarca and 20 in Puno) are shown in Table 1. The Puno communities, on average, are located at much higher altitude, and are located further from secondary schools and health facilities than are the Cajamarca communities. Livestock income is more important for the Puno communities, with roughly 3/4 of total community income coming from livestock and livestock-related activities compared to 1/2 in Cajamarca. In general, a greater percentage of Cajamarca communities have access to services within their communities, including access to clean water and telephone services. However, only 15% of the Cajamarca communities, and 10% of the Puno villages visited had electricity."},{"index":9,"size":86,"text":"While virtually all communities in both regions were involved in livestock activities (only 2 out of 40 reported no livestock activities), 55% were engaged in crop agriculture in Puno, compared to 95% in Cajamarca, reflecting the greater agricultural options in the lower altitudes. Fifty-five percent of the communities in Puno describe casual labor as an important economic activity for their community, compared to 30% of the study sites in Cajamarca. Handicrafts are an important economic activity in Cajamarca, while livestock trade is equally important in Puno."}]},{"head":"Stages-of-Progress approach","index":4,"paragraphs":[{"index":1,"size":74,"text":"The Stages-of-Progress approach is described in detail in Krishna (2004) and Krishna et al. (2004). It is described briefly here. What is innovative about this particular study lies in the linking of the stages of progress with the livestock survey, allowing us to examine first the reasons in general that households have managed to escape or fall into poverty, and then to examine in greater detail the livestock-related factors associated with these poverty dynamics."},{"index":2,"size":156,"text":"It is a highly facilitative and participatory approach involving a representative group of a community (or in some cases, the entire community) in an exercise that defines, for their particular village, the typical stages of progress that households make towards improving their levels of well-being. Community members are led by a trained facilitator to consensus on the stages, or assets, that households wish to purchase as they obtain incremental amounts of money, starting from a baseline of an extremely poor household in their village. These stages include purchases or investments in food, clothing, housing, education, livestock, land, etc. While poverty has many dimensions -economic, psychological, social, etc., and can be defined in terms of outcomes (e.g. nutritional or health status) as well as in terms of assets, attempting to capture all of these dimensions with a simple tool is perhaps impossible. For this reason, the Stages-of-Progress methodology focuses solely on material aspects of poverty, i.e. assets."},{"index":3,"size":84,"text":"The group then draws their own poverty lines showing what stage households that are considered poor versus non-poor are at. They then are asked to describe what stage each and every household in their village is at presently, was at 25 years ago, and was at 10 years ago. The final and most interesting step of the Stages-of-Progress approach involves an in-depth exploration and triangulation, at both the community and household-levels, of the reasons that particular households have moved into and out of poverty."},{"index":4,"size":57,"text":"A stratified random sample encompassing roughly 20% of households that had stayed poor, escaped poverty, fallen into poverty and remained non-poor over the last 25 years within each community were visited following the Stagesof-Progress exercise. A formal survey including questions regarding household characteristics and livestock holdings, livestock production and marketing, now and 10 years ago, was implemented."},{"index":5,"size":51,"text":"Before applying these methods extensively in two regions of Peru, a training session and pilot tests were carried out in two communities. The full study was then implemented in 40 communities (with a total of 3817 households), and the household/livestock survey was carried out with 1041 households (Krishna et al., 2006)."}]},{"head":"Stages of progress and position of poverty line","index":5,"paragraphs":[{"index":1,"size":66,"text":"Representative community groups were facilitated through a process that led to a consensus on the stages of progress that a typical household in their community go through as they progress from having very little, to an improved state of well-being. They defined the kinds of expenditures, and the order in which they are typically made, as households gradually climb out of a state of acute poverty."},{"index":2,"size":35,"text":"They were then asked to describe, based on previous discussions of the local terms that people apply to impoverished households, where the cut-off line is between those considered to be poor versus non-poor (Chambers, 1995)."}]},{"head":"Poverty movements of households","index":6,"paragraphs":[{"index":1,"size":53,"text":"A complete list of all households in the village was made and prominently displayed for the community meeting group. Next, researchers worked with the community assembly to identify a clearly understood and commonly remembered milestone to denote the period of 25 years ago, and another to identify the period of 10 years ago."},{"index":2,"size":91,"text":"The next step involved locating each household's location with respect to the stages of progress for the current period, for 10 years ago, and for 25 years ago. The results of this analysis gave the poverty status of each and every household in the 40 villages now, 10 years ago, and 25 years ago. A full examination of the poverty trends over the different time periods can be found in Krishna et al., 2006. Here we focus on the last 10-year period which also relates to the livestock issues pursued below."}]},{"head":"Reasons given by households for poverty status and movements","index":7,"paragraphs":[{"index":1,"size":161,"text":"Having established poverty status and movements for all households in our sampled villages, the next step was to probe in some detail as to the reasons that individual households had experienced their particular poverty trajectory. This step also required rigorous training of enumerators in terms of probing and recording techniques, followed by coding of responses. In particular, the sequence of events or factors mentioned as reasons for poverty status now and before was elicited, rather than a ranking of importance of reasons. This is because it is important to know, for example, whether a debilitating medical condition occurred before or after the acquisition of high-interest private debt. Knowing this sequence helps understand better whether health resulted in debt and contributed to the household's descent into poverty (which is a reasonable supposition if health comes first in the sequence of reasons), or whether deteriorating health results from (or accompanied) worsening family economic conditions, caused primarily by something else (in this case, debt)."},{"index":2,"size":195,"text":"It is important to note that present-day households were the unit of analysis for this exercise. This differs from panel data studies, which consider earlier-period households as the units of analyses. While panel studies lose households that participated in the earlier period but not in the later, this method fails to capture households of 25 years ago from which no single member still lives in the community at the present time, thus some bias may exist. When asking about conditions at the present time, we asked about the present-day household members; when asking about the previous time period, we asked about conditions faced by these same members (or their parents' households for younger families) 25 and 10 years ago. A time period of 25 years ago is roughly the equivalent of a generation, and was chosen to allow us to explore the reasons for movements in chronic, as opposed to transitory, poverty movements of households. While we also explored the last 10-year period, the reasons for movements are presented for the longer term period. With this approach, the time periods chosen can vary if there is good reason to do so (Krishna et al., 2004)."},{"index":3,"size":58,"text":"The community group was asked to describe the circumstances, and the critical reasons or events (and sequence of those events) behind particular households' poverty movements. Household level inquiries (for a random sample of households from each category) delved further into the sequence of events or actions that household members perceived as leading to escapes or descents into poverty."}]},{"head":"Logit analysis","index":8,"paragraphs":[{"index":1,"size":84,"text":"A binary logistic regression analysis (SPSS, 2002) was undertaken to determine which factors were significantly associated with upward and downward poverty movements. The binary logistic regression is most useful when modeling the event probability for a categorical response variable with two outcomes. It is a type of generalized linear model that extends the linear regression model by linking the range of real numbers to the 0-1 range. The model directly estimates the probability of an event occurring. The binary logistic regression is specified as"},{"index":2,"size":49,"text":"The variable p i is the probability of the ith case experiencing the event of interest and z i is the value of the unobserved explanatory variable for the ith case. The model also assumes that z is linearly related to the predictors. Eq. ( 3) is expressed as"},{"index":3,"size":25,"text":"The variable x ij is the jth predictor for the ith case, b j is the jth coefficient, and p is the number of predictors."},{"index":4,"size":58,"text":"In the logistic regression model, the relationship between z and the probability of the event of interest is described by the logit link function. Unlike a common linear regression based on ordinary least squares (OLS), the regression coefficients are estimated through an iterative maximum likelihood method (i.e. the coefficients that make our observed results more likely are selected)."}]},{"head":"The empirical model","index":9,"paragraphs":[{"index":1,"size":98,"text":"Using the binary logistic regression procedure in SPSS, we ran four separate regressions to model the probability of escaping poverty and probability of falling into poverty for each region. First, the analysis was restricted to households that had stayed poor over the 25-year period (classified as 0), and households that were poor 25 years ago but had managed to escape poverty (classified as 1). In other words, we grouped all households that started out poor in order to examine which factors help explain why some previously poor households escaped poverty, while other poor households continued to remain poor."},{"index":2,"size":59,"text":"Similarly, households that were non-poor 25 years ago but were now poor (classified as 1), and households that had stayed non-poor over the 25 year period (classified as 0), were analyzed together in order to look at the most important factors that explain why some previously nonpoor households fell into poverty, while other non-poor households continued to remain non-poor."},{"index":3,"size":169,"text":"In the first case, the reasons for staying poor and factors mentioned as pertinent to household escapes out of poverty, as well as important household-level characteristics such as age of household head, level of education, number of income-earning activities, size of land holdings and gender of household head, were used as explanatory variables in the regression for each region. In the second case, reasons given for descent into poverty and staying non-poor and similar household-level characteristics were used as explanatory variables. The reason/factor-related independent variables were measured as binary variables, i.e. equal to one if the reason was mentioned, and 0 otherwise. Since the reasons were first elicited at the community level, then followed up at the household level, the research team met each evening to triangulate results and discuss cases where there was a discrepancy (which turned out to be a very small percentage of cases, <5%), at which point they made an informed decision as to the final set of reasons that went into the logit analysis."}]},{"head":"Results and discussion","index":10,"paragraphs":[]},{"head":"Stages of progress and position of poverty line","index":11,"paragraphs":[{"index":1,"size":83,"text":"Although there were considerable differences found across the villages studied, remarkably all these communities described virtually the same stages of progress (Table 2). This implies a commonly known and agreedupon understanding of poverty for these villagers. Working with this local, yet common and comparable, definition of poverty is very useful for better understanding the strategies that households pursue in order to deal with poverty and the reasons that some households are able to escape poverty over time and why others fall into poverty."}]},{"head":"Poverty movements of households","index":12,"paragraphs":[{"index":1,"size":111,"text":"The poverty dynamics differ somewhat in these two different regions of Peru (Table 3). Puno households have been more successful in lifting themselves out of poverty in the last decade (25% of households), compared to Cajamarca (13% of households). More households slid into poverty in Cajamarca (11%) than in Puno (5%) in the last 10 years as well, based on our sample of communities. Based on the communities own perceptions of the percentage of households that were poor, Puno went from a poverty incidence of 40% to 21% (Categories A + C) in the last decade, whereas Cajamarca's percentage of poor households declined from 36% to 34% during the same period."},{"index":2,"size":122,"text":"The reasons for Puno's apparent relative success at reducing poverty compared to Cajamarca over the last 10 years were not readily apparent to the study teams and are likely to be quite complex. Further research is needed in order to be able to address some of the pertinent issues. For example, a closer look at the relevant social programmes in Puno versus Cajamarca, their coverage and timing would be very useful. Although we do not have all the necessary information to address the reasons behind aggregate regional poverty trends, what we can do with the Stages-of-Progress approach is to gain a better understanding of the reasons that households within and across the different regions give for helping explain their own poverty movements."}]},{"head":"Interpretation of binary logistic regression results","index":13,"paragraphs":[{"index":1,"size":116,"text":"The results of the logit models are given in Tables 4  and 5 for the households that escaped poverty and those that fell into poverty, respectively. When households were being probed regarding the events, factors and reasons behind their particular poverty trajectory, they gave both positive and negative influencing factors. In Table 4, for those households that escaped poverty, the positive factors outweighed the negative ones mentioned, and they were able to progress upwards. In Table 5, for those that fell into poverty, the 'positive factors' associated with falling should in fact be interpreted as factors that increase the probability of falling into poverty, whereas the 'negative factors' were reasons associated with keeping them from falling."},{"index":2,"size":380,"text":"Measures of goodness of fit of our logit model include the log pseudolikelihood and Wald v 2 statistics, shown in Tables 4 and 5, which show that the models are all significantly different from the null or intercept-only (i.e. knownothing) model. How well the models correctly predict where households are classified (those that stayed poor versus those that escaped poverty in Table 4, and those that stayed non-poor versus those that fell into poverty in Table 5) is another indication of goodness of fit. These measures are presented in Tables 4 and 5 and all suggest good predictive power. The parameter estimates of the variables that are significant differ across regions. The meaning of logistic regression coefficients is not straightforward. While the b is convenient for testing the significance of the predictors, exp(b) is easier to interpret. The exp(b) represents the odds ratio, or the ratio-change in the odds of the event of interest, in our case of either escaping or falling into poverty, for a one unit change in the predictor (it is calculated as Exp(B)). For variables that are significant, an odds ratio greater than one indicates that the relevant factor tends to accelerate escape (Table 4) while an odds ratio lower than one indicates that factor tends to deter ascents. In Table 5, for variables that are significant, an odds ratio Note: Factors that were mentioned by fewer than 10% of households in a given region were dropped due to large standard errors. To correct for possible problems of heteroscedasticity in our model above, we used a robust standard errors option; we then tested for the possibility of omitted variables/specification errors using the linktest option (both in STATA), which showed that this was not a problem. * Significant at 0.1 probability level. Note: Factors that were mentioned by fewer than 10% of households in a given region were dropped due to large standard errors. To correct for possible problems of heteroscedasticity in our model above, we used a robust standard errors option; we then tested for the possibility of omitted variables/specification errors using the linktest option (both in STATA), here the addition of 2 interaction variables corrected the problem. * Significant at 0.1 probability level. ** Significant at 0.05 probability level. *** Significant at 0.01 probability level."},{"index":3,"size":28,"text":"greater than one indicates that the relevant factor tends to accelerate descent, while an odds ratio lower than one implies the factor tends to avert descents into poverty."}]},{"head":"Reasons for escaping poverty","index":14,"paragraphs":[{"index":1,"size":98,"text":"The major factors contributing to household escapes in the two regions have very few commonalities, suggesting targeted intervention and policy responses are needed. Gains from business showed up as an important contributing factor in household escapes in both Cajamarca and Puno. The odds of escaping poverty are 13 and 16 times greater than for staying poor in Puno and Cajamarca, respectively, for households that have gained from starting up their own businesses. As may be expected, size of landholdings also show up as highly significant, thus those with more land are more likely to escape poverty over time."},{"index":2,"size":144,"text":"Additional factors significant in Cajamarca (but not in Puno) include improved market access -the odds of escaping poverty are 70 times greater than for staying poor for households that have seen their market access improvefollowed by diversification of income through crops and off-farm sources. Fifty-nine percent of Cajamarca households that had escaped poverty cited gains from non-farm diversification as an important factor, while 43% mentioned crop diversification strategies. Help from relatives and friends and a higher proportion of children in school are other factors helping to explain ascents out of poverty in Cajamarca. Somewhat non-intuitively, having relatives working outside of the community appears to deter ascents from poverty (with an odds ratio less than one), although this variable is only significant at the .1 probability level. Perhaps the loss of labour outweighs the transfer payments from these relatives working away from their home communities."},{"index":3,"size":75,"text":"Other circumstances important for explaining poverty escapes in Puno include the ability to improve the quality of livestock (e.g. through breed upgrading) -the odds of escaping poverty are 17 times greater for households that had improved the quality of their livestock herd. Diversification of income through livestock-related activities was also significant in Puno, with an odds ratio of 2.5. The percentage of households in Puno that had escaped poverty mentioning livestock-related diversification strategies was 57%."},{"index":4,"size":27,"text":"Assistance from community organizations and someone in the household with a private sector job were other important contributing factors for families that had escaped poverty in Puno."}]},{"head":"Cargo net strategies for helping household escapes","index":15,"paragraphs":[{"index":1,"size":106,"text":"In terms of development strategies, what do these findings imply? Barrett (2003) refers to policies and strategies that help households climb out of poverty as 'cargo net' policies. For communities at lower altitude, with relatively good access to services, with some cropping poten-tial and less reliance on livestock as the primary livelihood option, strategies for helping to lift rural households out of poverty should focus on: income diversification strategies, including crops, livestock and nonfarm options (e.g. small businesses). Community-level organizations are currently not playing an important role, so looking at the challenges to improved collective action, particularly in market and income-generating projects may be in order."},{"index":2,"size":71,"text":"For areas of higher altitude (over 4000 m) on the other hand, with more reliance on community rangelands and livestock as the primary livelihood strategy and fewer crop-related options, investment strategies aimed at improving market access, livestock production and marketing may help more households escape poverty. An entry point here may be through the community organizations that successful households have mentioned as being important to their upward movements out of poverty."}]},{"head":"Reasons for poverty descents","index":16,"paragraphs":[{"index":1,"size":55,"text":"The major factor affecting families that had descended into poverty over the last 25 years common to both areas is health and health-related problems and expenses. The odds of falling into poverty were 14 times greater for households with major health issues in Puno and 3 times greater for households facing health-related challenges in Cajamarca."},{"index":2,"size":80,"text":"Age and gender of household head were additional reasons showing up as important in Puno but not in Cajamarca, implying that households headed by men and older people are much more likely to fall into poverty than female-headed households (a somewhat surprising finding) and younger families. Another interesting finding in Puno is that households involved in multiple income-generating activities are less likely to fall into poverty, suggesting that many households have been successful in their pursuit of additional income sources."},{"index":3,"size":135,"text":"Unique to Cajamarca are marriage-related expenses that contribute greatly to the probability of households' falling into poverty. The likelihood of falling into poverty increases, with an odds ratio of 5, for households where expenses related to marriages were considered an important contributing reason to their descent. Large family size and crop-related losses also show up only in Cajamarca as significant contributing factors to household descents into poverty. Larger households, and those that have suffered crop-related losses, are 7 and 3 times, respectively, more likely to fall into poverty (mean family size for those that had fallen was 5.2 compared to 4.4 for those that stayed non-poor). Size of landholdings and proportion of children in school are negative and significant, as may be expected, suggesting the likelihood of descent is greater with less land and education."},{"index":4,"size":37,"text":"Mitigating factors helping households from falling into poverty are seen in Table 5 for those variables with a negative b coefficient. In Puno, diversification of income through livestock shows up as significant, and in Cajamarca, inheritance does."}]},{"head":"Safety net strategies for keeping households from descents into poverty","index":17,"paragraphs":[{"index":1,"size":87,"text":"In addition to cargo nets, which help carry households out of poverty, these regionally differentiated findings suggest that stronger 'safety net' strategies and investments will also be required that can prevent or slow down descents into poverty (Barrett, 2001;Devereaux, 2002). Perhaps the biggest message is that investment and attention to increasing access to health care and reducing its costs to poor households is universally needed. Assisting new households seems to be another safety net strategy that cuts across regions that could help households from descents into poverty."},{"index":2,"size":89,"text":"For our sampled households, our results suggest that safety net strategies for lower altitude, higher potential crop areas could focus on reducing crop-and livestockrelated losses, e.g. through increased investment in research and development and promotion of sustainable crop-livestock systems. Issues surrounding land division arise in the higher altitude regions where households are more dependent on livestock for their livelihoods, so exploring possible collective action approaches (since these are also areas where community organizations and practices such as collective grazing are stronger) may have potentially high payoffs in these areas."}]},{"head":"Livestock findings","index":18,"paragraphs":[{"index":1,"size":38,"text":"The livestock survey component was applied to 1041 households. Information was gathered on livestock holdings by species and indigenous (Criollo) versus improved breeds, now and 10 years ago, and livestock production and sales, now and 10 years ago."},{"index":2,"size":225,"text":"Following up on the stages-of-progress approach with a fairly detailed livestock questionnaire allowed us to examine the differences in livestock holdings and recent changes in those holdings for households that had escaped versus those that had fallen into poverty. Given the inherent limitations of recall data over such a long period, the objective was to look for broad trends regarding intensification (shift to improved breeds) versus extensification (larger herds), and diversification strategies (shifts to new species, products) being pursued by these different categories of households. This allows us a rather unique opportunity to directly address the issue of the role that livestock may play in poverty alleviation; a complex question that is challenging to answer, particularly in a quantitative manner, and one that few livestock studies address (Kristjanson et al., 2004). It should be noted that this relatively brief livestock survey does not allow us to address issues of productivity or returns to the various livestock-related activities. It would therefore be useful to revisit these communities and supplement this informa-tion with such data, plus take a more in-depth look at marketing issues. Table 6 summarizes the findings regarding livestock holdings in Puno and Cajamarca, 10 years ago and now. It shows the importance of cattle, sheep, chickens, alpacas and llamas for households in Puno, and beef, dairy, sheep, guinea pigs, chickens and pigs in Cajamarca."}]},{"head":"Role of intensification strategies in poverty escapes","index":19,"paragraphs":[{"index":1,"size":47,"text":"Focusing in on households that had escaped from poverty, we examined evidence of intensification by looking at shifts from indigenous (Criollo) breeds of cattle and sheep to improved breeds. These detailed tables are not presented here for space reasons, but are available upon request from the authors."},{"index":2,"size":41,"text":"In Puno, we found evidence of such a strategy playing a role for households that had escaped poverty: more than twice as many of these successful households now own improved dairy and beef cattle breeds in comparison to 10 years ago."},{"index":3,"size":50,"text":"Similarly, we found declining livestock assets for households that have fallen into poverty. Fewer of these unsuccessful households own indigenous breeds of sheep, dairy and beef cattle, and they have smaller herd sizes. In addition, ownership of improved breeds has actually declined for these households compared to 10 years ago."},{"index":4,"size":69,"text":"In Cajamarca, for households that have escaped poverty, ownership of improved breeds of cattle (beef and dairy), however, is insignificant and has not increased over the last decade. More of these successful households now own indigenous dairy cows (an increase from 58% to 70%) and indigenous beef cattle than did 10 years ago (an increase from 36% to 44%). Small animal ownership has declined for this category of households."},{"index":5,"size":96,"text":"It is not totally clear why such a shift towards improved breeds can be seen in Puno and not in Cajamarca for successful households and it likely relates to past and current development projects that focused on beef development in Puno, whereas dairy has been the focus in Cajamarca, and in particular areas of Cajamarca that this study did not cover. It does raise some interesting questions that further research should address, however, to see if there are some lessons from livestock development efforts ongoing in Puno that may be transferable to Cajamarca, or vice versa."}]},{"head":"Role of extensification strategies/increasing herd size in movements out of poverty","index":20,"paragraphs":[{"index":1,"size":85,"text":"In Puno, for households that escaped poverty,we see evidence of larger herds of improved dairy cows (which increased from an average herd size of 6.4-10.4 per household compared to 10 years ago), but average alpaca herd sizes have not increased. However, the number of llamas increased from an average of 9.7-13.8 per household (Table 7). Alpaca is generally more important for these households than llamas (used mainly for meat), and in the drier Mazo Cruz, alpacas are more important than cattle and sheep as well."},{"index":2,"size":103,"text":"In Cajamarca, on the other hand, households that had escaped poverty did not accumulate larger herds of cattle or sheep, and they own fewer chickens and guinea pigs than they did 10 years ago (Table 7). So, it does not appear that increasing the number of livestock assets has been a pathway out of poverty for these communities in Cajamarca. Given the frequency of non-farm diversification and crop diversification as important reasons for escaping poverty in this region, this supports the argument that these factors have played a much more important role than has livestock in terms of a pathway out of poverty."},{"index":3,"size":50,"text":"Thus is appears that policies and strategies aimed at helping households increase their herd size could be a critical poverty strategy in higher altitude, livestock-reliant areas, and not just by providing a safety net, but also in the sense of helping households climb out of poverty (a cargo net strategy)."}]},{"head":"Role of marketing and diversification strategies in movements out of poverty","index":21,"paragraphs":[{"index":1,"size":116,"text":"We looked at how households were diversifying their livestock activities in comparison to 10 years ago (as was reported as being an important reason for households' poverty escapes). In Puno, for households that escaped poverty, we found that production and sales of milk, wool and alpaca fiber have increased significantly over the last 10 years; milk production has doubled, with four times as many households selling milk (over twice as much) than was the case 10 yrs ago; a large number of these successful households were new at producing fiber, cheese, eggs, milk and mutton (i.e. they had diversified into new livestock products); and significantly more of these successful households own alpacas than 10 years ago."},{"index":2,"size":59,"text":"In Cajamarca, for these relatively successful households, the percentage of sampled households that produce milk increased from 47% to 73% over the last 10 years. The data also show significantly increased milk production and sales for these households. There were no significant changes in the percentage of households that had escaped poverty with respect to producing other livestock-related products."},{"index":3,"size":72,"text":"Another indicator of diversification strategies is evidence of a large number of households that were not engaged in particular livestock activities 10 years ago, but are undertaking them now (Table 8). We see such evidence in Puno for alpaca fiber production, camelid hides and meat, eggs and milk. In Cajamarca, a significant number of households are now engaging in production of eggs, guinea pigs, milk and wool compared to 10 years ago."},{"index":4,"size":80,"text":"Unfortunately, while we asked what households were doing now compared to 10 years ago, we were not able to pursue exactly how it was that these households were able to successfully diversify (another area for follow-up research to pursue, i.e. what policies and interventions led to this successful diversification). However, it is quite striking how dairy enterprises have been an important option in both regions, suggesting that it has been an important pathway out of poverty for many rural Peruvians."}]},{"head":"Conclusions","index":22,"paragraphs":[{"index":1,"size":66,"text":"Linking the Stages-of-Progress approach with a targeted livestock survey turned out to be a useful way in which to address some complex issues surrounding the role that livestock and other factors play in poverty pathways, and we see opportunities for applying it more broadly in very different regions (and in fact, have received several queries already for doing so) where rural poverty remains a huge challenge."},{"index":2,"size":114,"text":"In each of the forty Peruvian communities investigated here, while some households are coming out of poverty, others are falling into poverty. New poverty is being created even as old poverty is being destroyed. The reasons why people are becoming poor are different from the reasons why people are coming out of poverty. The implications of this finding are that the policies that are needed to stop people from falling must deal with the reasons for falling. The policies that are needed to help people escape poverty must address the reasons households escape. Because these reasons are different, two different sets of policies are needed -one to halt descents and one to promote escapes."},{"index":3,"size":53,"text":"These policies are region-specific and may often even be community-specific. We found that some reasons for fall-ing into poverty, or for escaping poverty, are similar in both places, but some are different. National policies are important, but our study shows that there are very good reasons for having regional and local pro-poor policies."},{"index":4,"size":81,"text":"Four hundred and eighty households in these Puno communities and 253 Cajamarca households have escaped from poverty, and for them, escaping poverty has in large part been due to successful diversification of income sources. This finding is supported for rural Peruvian households in Swinton and Quiroz (2001) and Escobal (2001). We found that diversification of income sources through livestock and off-farm activities was particularly important for helping households to escape poverty in Puno and Cajamarca, and also through crops in Cajamarca."},{"index":5,"size":123,"text":"Improvements in livestock quality are also related to movements out of poverty. Households that were able to improve the quality of their livestock were much more likely to escape from poverty as those that were unable to invest in this strategy. While beyond the scope of this paper, a reviewer suggests that evidence of a shift towards non-indigenous breeds for families that move out of poverty and a decline in indigenous breed numbers for households falling into poverty, has implications for programmes aimed at the conservation and sustainable use of indigenous breeds/livestock diversity, and that attention to programme design needs to be paid in order to ensure that in situ efforts to conserve/sustainably use indigenous breeds do not end up ''conserving'' poverty too."},{"index":6,"size":30,"text":"Employment in the private sector, gains from small businesses, improved market access, community organizations and inheritance from parents were also found to be positively and significantly associated with escaping poverty."},{"index":7,"size":100,"text":"Our data show quite a bit of evidence supporting the notion that livestock (via intensification strategies or increasing productivity and marketing, rather than through increased herd sizes) have helped Puno households get out of poverty; but little evidence that this has been the case in Cajamarca. The number of households that escaped poverty and are producing milk in Puno not only doubled in the last 10 years, but these families are also selling more than twice as much milk as they were previously. A significantly larger number of these successful households are also selling more cheese, wool and alpaca fiber."},{"index":8,"size":65,"text":"Thus intensification of livestock strategies (i.e. moving to improved breeds) seems to be happening for households that have escaped poverty in Puno, but not in Cajamarca. Livestock production and marketing has appeared to suffer in Cajamarca over the last 10 years, in fact, according to our household survey evidence, although there is some evidence of livestock diversification happening for households that have escaped poverty there."},{"index":9,"size":44,"text":"Helping prevent households from falling into poverty will require improvements in access to affordable health care, improvements in access to appropriate crop and livestock technologies and perhaps access to insurance to limit catastrophic crop/livestock-related losses, and improved safety nets for the disabled and elderly."},{"index":10,"size":52,"text":"Improved rural roads are one way to help households diversify (Escobal and Ponce, 2002). Helping households escape poverty will also be aided by investments in improved market access to support income diversification efforts, and collective action efforts (e.g. strong community groups) in the areas of crop and livestock production and marketing activities."},{"index":11,"size":214,"text":"The above approach has allowed us to provide information on how rural people define and deal with poverty and an opportunity for them to share their situation with policy makers. By linking the stages-of-progress method with a targeted livestock survey, we have been able to address some interesting questions about the role that livestock play in pathways into and out of poverty in areas that have varying market access, altitude, and degree of reliance on livestock. Follow-up action-oriented research is needed, however, to examine in more detail what programs and specific policies help households diversify their income sources, for example, and escape poverty. Exploring ways in which to better incorporate intra-household differences, particularly those based on gender, is an area for further research, perhaps through adapting a method such as the one used by Ravnborg et al. (2004). What we have obtained from these community and individual interviews are only the 'proximate' reasons for escape and descent, i.e. the reasons as they were experienced by individuals within communities. More remote and macro-level reasons, operating at national and international levels, are also important to tackle within any overall strategy for dealing comprehensively with poverty and its causes. Different methods will help to identify important macro-level causes, complementing what has been learned through the stages-of-progress methodology."}]}],"figures":[{"text":"Fig. 1 . Fig. 1. Location of study sites. "},{"text":"Table 4 Results of the binary logistic regression for poverty escape (households that were poor 25 years ago and escaped poverty in comparison to those that stayed poor) in Puno and Cajamarca Table 2  Table 2 Stages of progress  Stages of progress 1 Food  1 Food 2 Clothing  2 Clothing 3 Basic housing/house repairs  3 Basic housing/house repairs 4 Small animals (chickens, guinea pigs)  4 Small animals (chickens, guinea pigs) 5 Basic education for children  5 Basic education for children 6 Purchase small plot of land  6 Purchase small plot of land 7 Indigenous breeds of livestock (sheep, cattle, alpacas, Poverty 7 Indigenous breeds of livestock (sheep, cattle, alpacas,Poverty llamas) cut-off llamas)cut-off 8 Purchase larger plot  8 Purchase larger plot 9 Improve/expand house  9 Improve/expand house 10 Improved large breeds of larger animals  10 Improved large breeds of larger animals 11 Secondary/tertiary education  11 Secondary/tertiary education 12 Small business  12 Small business 13 Buy plot/ house in city  13 Buy plot/ house in city  "},{"text":"Table 5 Results of the binary logistic regression for falling into poverty (households that were non-poor 25 yrs ago and stayed non-poor compared to those that fell into poverty) in Puno and Cajamarca P. Kristjanson et al. / Agricultural Systems 94 (2007) 294-308 P. Kristjanson et al. / Agricultural Systems 94 (2007) 294-308  "},{"text":"Table 7 Mean herd size (number of animals) for households that escaped poverty, Puno and Cajamarca, 10 years ago and now Valid n -households raising this type of livestock. Livestock species Puno (n = 125)    Cajamarca (n = 73)    Livestock speciesPuno (n = 125)Cajamarca (n = 73)  10 years ago  Now  10 years ago  Now  10 years agoNow10 years agoNow  Mean herd size Valid n * Mean herd size Valid n Mean herd size Valid n Mean herd size Valid n Mean herd sizeValid n *Mean herd sizeValid nMean herd sizeValid nMean herd sizeValid n Beef, indigenous 3.1 58 4.5 55 2.2 26 2.1 32 Beef, indigenous3.1584.5552.2262.132 Beef, improved 4.3 15 3.7 34 - - 1.0 1 Beef, improved4.3153.734--1.01 Dairy, indigenous 3.4 77 4.0 78 2.4 42 2.5 51 Dairy, indigenous3.4774.0782.4422.551 Dairy, improved 6.4 18 10.4 47 2.5 2 3.5 2 Dairy, improved6.41810.4472.523.52 Sheep, indigenous 18.0 95 14.7 85 4.5 43 3.4 39 Sheep, indigenous18.09514.7854.5433.439 Sheep, improved 49.6 15 17.1 45 5.0 1 7.0 3 Sheep, improved49.61517.1455.017.03 Alpacas 22.0 34 20.4 45 - - - - Alpacas22.03420.445---- Llamas 9.7 29 13.8 35 - - - - Llamas9.72913.835---- Chickens 5.3 70 3.3 81 6.9 58 5.4 56 Chickens5.3703.3816.9585.456 Guinea pigs 13.6 12 7.6 7 14.7 61 9.8 62 Guinea pigs13.6127.6714.7619.862 Pigs 3.4 41 1.7 47 1.6 48 1.4 43 Pigs3.4411.7471.6481.443  "}],"sieverID":"810d2854-9d28-400e-bdc2-d718255684c6","abstract":"Livestock play an important role for poor rural households in regions such as the Peruvian Andes. Research methods leading to a better understanding of the role of livestock in household poverty dynamics, and what better targeted policies and interventions may enhance that role, however, are not readily available. We utilized multiple methods, including Stages-of-Progress and household surveys, which gave us a combination of qualitative and quantitative results. We examined how over the last 10 and 25 years households have moved into and out of poverty in 40 rural communities in two different highland regions of Peru. We also examined the role played in these movements by different livestock assets and strategies. We found a significant number of households had escaped poverty, while at the same time many households have fallen into poverty. The reasons for movements up versus down are not the same, with different strategies and policies needed to address escapes versus descents. Diversification of income through livestock and intensification of livestock activities through improved breeds has helped many households escape poverty and this method allowed us to explore what exactly this means in the diverse areas studied. These findings can contribute to better targeted livestock-related research and development strategies and policies, not only in Peru, but in other regions where similar livelihood strategies are being pursued."}

data/part_2/0214dedb4d8909f549bcbf23b8d7bbed.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0214dedb4d8909f549bcbf23b8d7bbed","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/28a453c3-e76d-49de-b4ee-b21783b072e9/retrieve"},"pageCount":6,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":12,"text":"As farmers experiment and learn, communities create a collective capacity for innovation."},{"index":2,"size":37,"text":"improving the management of soil and other natural resources. We hypothesise that increased income from markets, in addition to enhancing farmers' wellbeing, will provide them with stronger incentives to adopt new technologies and invest in better NRM."}]},{"head":"Basic Concepts","index":2,"paragraphs":[{"index":1,"size":9,"text":"The ERI approach is based on four key concepts:"},{"index":2,"size":55,"text":"1. A resource-to-consumption conceptual framework. As indicated in Figure 1, the framework features two-way linkages between community assets (natural, human, social, physical, and financial) and production-to-consumption aspects, which include post-harvest handling, processing, marketing, and household consumption. It thus extends the commodity chain to include NRM, specifically linking integrated soil and nutrient management to market opportunities."}]},{"head":"Balancing market risk and food security.","index":3,"paragraphs":[{"index":1,"size":38,"text":"In deciding what to produce, rural people face difficult decisions about allocating scarce household resources. ERI's approach helps them achieve an appropriate balance between activities that increase household food security and those that generate income through market-oriented production."}]},{"head":"A market orientation. A central challenge in combating rural poverty is to foment","index":4,"paragraphs":[]},{"head":"Resources","index":5,"paragraphs":[{"index":1,"size":5,"text":"Natural Social Human Physical Financial"}]},{"head":"Gender and Equity","index":6,"paragraphs":[]},{"head":"Production Consumption","index":7,"paragraphs":[{"index":1,"size":2,"text":"Food Income"}]},{"head":"Home consumption Marketing","index":8,"paragraphs":[{"index":1,"size":5,"text":"Figure 1. The resource-to-consumption framework."},{"index":2,"size":7,"text":"a market culture at the community level. "}]},{"head":"Key Steps for Enabling Rural Innovation","index":9,"paragraphs":[{"index":1,"size":15,"text":"The ERI approach involves taking the following steps with communities and partner organisations (Figure 2):"},{"index":2,"size":24,"text":"1. Engage appropriate R&D partners and reach agreements on methods, sites, and the roles and responsibilities of each partner and community in managing interventions."},{"index":3,"size":8,"text":"Figure 2: Key steps for enabling rural innovation."},{"index":4,"size":59,"text":"2. Conduct a participatory diagnosis of factors such as community assets, finances, current income opportunities, potential options, access to services, skills, degree of cooperation, access to new technologies, and organisational structures. The diagnosis also provides an opportunity to create a shared vision of the community's future, to explore development options, and to develop collectively an action plan for change."},{"index":5,"size":42,"text":"3. Form farmer and market research groups. These groups should participate actively in selecting, testing, and evaluating marketing strategies and technology options. They should also make decisions about experimentation and about the information needed to develop viable business options and improve NRM."},{"index":6,"size":18,"text":"4. Conduct participatory analysis to identify market opportunities for competitive products that will increase farm income and employment."},{"index":7,"size":15,"text":"5. Prioritise opportunities and select agroenterprise options based on social differences, including gender and wealth."},{"index":8,"size":18,"text":"6. With farmer research groups, plan and implement experiments on options for developing agro-enterprises and bolstering food security."},{"index":9,"size":18,"text":"7. Give the community and R&D organisations feedback on results and identify research questions related to rural innovation."},{"index":10,"size":46,"text":"8. Establish participatory monitoring and evaluation systems in communities and with service providers to strengthen learning and the capacity for self-reflection, and to encourage documentation of experiences. 9. Scale up the ERI experience through farmer organisations and R&D agencies at the local, national, and regional levels."},{"index":11,"size":21,"text":"10. Strengthen access to information for decisionmaking at every stage of the process, through formal facilitation mechanisms and diverse communications media."}]},{"head":"A Capacity Development Strategy: The Learning Alliance","index":10,"paragraphs":[{"index":1,"size":40,"text":"Developing a core of professionals, including scientists and development partners, is crucial for enabling rural innovation and achieving impact on a large scale. ERI applies a group mentoring approach to capacity development, which we refer to as a \"learning alliance.\""},{"index":2,"size":59,"text":"This approach uses experiential learning methods to form interdisciplinary, multi-institutional teams, build new skills and knowledge, develop action plans, and The approach was developed specifically to facilitate processes of institutional change and capacity building, and to accelerate the uptake of concepts, methods, and technologies aimed at making smallholder production more competitive. The approach is based on four key principles:"},{"index":3,"size":11,"text":"1. Training materials need to be adapted to different client groups."},{"index":4,"size":25,"text":"2. Different learning mechanisms should be used with diverse groups of partners. These include rural women, extension agents, NGO managers, and national and international researchers."},{"index":5,"size":1,"text":"3. "}]},{"head":"Critical Factors for Success","index":11,"paragraphs":[{"index":1,"size":6,"text":"Each situation and community is different."},{"index":2,"size":19,"text":"The ERI approach cannot, therefore, be used as a simple blueprint, although its principles can be applied across sites."},{"index":3,"size":20,"text":"Partners thus need to ensure that the main elements of ERI are in place to enhance the prospects of success."}]},{"head":"Developing and managing effective partnerships","index":12,"paragraphs":[{"index":1,"size":66,"text":"Successful innovations result from strong interactions and knowledge flows within networks of stakeholders. Effective local partnerships between researchers, extension workers, NGOs, and rural communities are central to the success of ERI. Partners are selected not only for their interest in the approach, but also on the basis of an institutional assessment that covers their working relationships with local communities, objectives, and potential to achieve large-scale impact."}]},{"head":"Promoting gender equity and women's empowerment","index":13,"paragraphs":[{"index":1,"size":87,"text":"Gender, equity, and women's empowerment are central concerns at all stages of the ERI approach. Proactive strategies and gendersensitive facilitation skills are used to build the capacity of both men and women to identify and evaluate a diverse range of market opportunities, and to experiment with a range of technologies for crop and soil fertility management. Our strategy is to encourage the active participation of men and women in project activities, while creating gender awareness at the community level through the use of interactive adult learning methods. "}]},{"head":"Building human and social capital to empower rural communities","index":14,"paragraphs":[]},{"head":"Participatory monitoring and evaluation","index":15,"paragraphs":[{"index":1,"size":57,"text":"With the ERI approach, participatory monitoring and evaluation (PM&E) tools are applied to support self-reflection and continuous learning in communities and projects. Community-based PM&E systems support and enhance group processes, improve local decision-making, and enhance participation. These systems also enable communities to develop indicators Women's empowerment is a central concern at all stages of the ERI approach."},{"index":2,"size":39,"text":"The Nyabyumba Farmers' Group of Kabale District, Uganda, was formed in 1998, with 40 members. The Group, supported by Africare (an international NGO), focused on producing improved potatoes from clean seed provided by the National Agricultural Research Organisation (NARO)."},{"index":3,"size":64,"text":"In 2000, the Nyabyumba Group formed a farmer field school to improve their technical skills in potato production and increase yields. In 2003, equipped with the necessary skills for producing highquality potatoes in large quantities, the group decided to increase their commercial sale and requested support from Africare, NARO, the Regional Potato and Sweetpotato Improvement Network in Eastern and Central Africa (PRAPACE), and CIAT."}]},{"head":"The Nyabyumba Farmers' Group","index":16,"paragraphs":[{"index":1,"size":47,"text":"Through this consortium of partners, the Nyabyumba Group received training in identifying and analysing market opportunities and developing a viable business plan for the potato enterprise. From the market study, the group identified Nandos, a fast-food restaurant based in Kampala, and local wholesale markets, also in Kampala."},{"index":2,"size":85,"text":"The Group set up a series of committees to manage, plan, and execute their production and marketing processes. To provide a constant supply, the farmers set up a staggered planting system to ensure that as much as 5-10 tonnes of potatoes were available each month, from which they then selected the best quality tubers to send to the Kampala markets. To date, the Group has supplied more than 76 tonnes of potatoes to Nandos and a similar amount of lesser quality tubers to wholesale markets."},{"index":3,"size":66,"text":"The Group has been receiving a steady income and now has savings of nearly 1 million Ugandan shillings (US$600). These funds are being used to build a store and buy irrigation equipment to expand the business. The Group's success is based on (1) long-term support from a consortium of research and development partners, (2) increased technical skills in potato production and marketing, and (3) collective marketing."},{"index":4,"size":13,"text":"for measuring change, collect and analyse data, and decide how to use results."},{"index":5,"size":49,"text":"Communities can use PM&E systems to hold R&D institutions accountable through communication, feedback, and community involvement in project monitoring. Within projects PM&E has been applied to strengthen institutional learning and to enhance stakeholder participation. Building effective PM&E systems in communities and projects ensures that lessons are documented and shared."}]},{"head":"Developing a scaling-up strategy","index":17,"paragraphs":[{"index":1,"size":66,"text":"Pilot learning sites are needed to test and adjust methods, and to develop skills and confidence. To reach larger numbers of people, however, a scaling-up strategy must be mapped out from the start with carefully selected partners. This involves (1) encouraging lateral movement of the approach and lessons learned from pilot sites to other farmer groups and communities in the area, for example, through farmer visits;"},{"index":2,"size":35,"text":"(2) institutionalising the ERI approach within initial partner organisations, and building the capacity of new partners to apply the approach; and (3) influencing policy makers within the government, NARES, and NGOs to support ERI initiatives."}]},{"head":"Principles and Guidelines","index":18,"paragraphs":[{"index":1,"size":42,"text":"To create knowledge and approaches that are applicable across national boundaries, the ERI Programme conducts research on the innovation process. Through this research we extract lessons learned from experiences across pilot sites, and we gain a clearer understanding of principles and guidelines "}]},{"head":"Training Materials","index":19,"paragraphs":[{"index":1,"size":41,"text":"As an aid to scaling-up the ERI approach, a set of training materials are being developed that includes manuals, guides, supporting documentation, and case studies. As these materials are completed, they will be made available on the ERI Web site (www.ciat.cgiar.org/africa/eri)."}]},{"head":"Solutions That Cross Frontiers Solutions That Cross Frontiers Solutions That Cross Frontiers Solutions That Cross Frontiers Solutions That Cross Frontiers","index":20,"paragraphs":[{"index":1,"size":31,"text":"The International Centre for Tropical Agriculture (CIAT) is a not-for-profit organisation that conducts socially and environmentally progressive research aimed at reducing hunger and poverty and preserving natural resources in developing countries."},{"index":2,"size":50,"text":"CIAT is one of 15 food and environmental research centres working towards these goals around the world in partnership with farmers, scientists and policy makers. The centres are funded mainly by the 58 countries, private foundations and international organisations that make up the Consultative Group on International Agricultural Research (CGIAR)."},{"index":3,"size":1,"text":"www.ciat.cgiar.org"}]}],"figures":[{"text":"Facilitation evaluation Feedback to R&D partners Scaling up and sacling out provide follow-up and mentoring in the field. "}],"sieverID":"e840090f-dee3-4053-b026-52e67fbbb1e4","abstract":"An urgent challenge for Africa is to enhance the capacity of the rural poor to innovate in the face of rapidly changing conditions. The new paradigm of integrated agricultural research for development (IAR4D) is an effective mode for accomplishing this end. It features a broad research agenda that addresses a chain of interactions, from natural resource management (NRM) to production systems, markets, and policies. Using this approach, a programme called Enabling Rural Innovation (ERI) is helping communities in eastern and southern Africa bolster food security and raise incomes through more competitive agriculture. ERI is a partnership of national agricultural research and extension systems (NARES), nongovernmental organisations (NGOs) and CIAT, working together with rural communities. ERI aims to strengthen social organisation and entrepreneurial skills in rural communities, encouraging farmers to produce what they can market rather than market what they produce. The programme works toward this goal by enhancing the ability of rural communities to conduct research that links technology development to market opportunities and to improved management of soils and other natural resources. In their research communities draw on scientific expertise as well as farmers' own knowledge."}

data/part_2/026f9215b921637172ea88142c2c0df6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"026f9215b921637172ea88142c2c0df6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f7c58ec6-e047-4745-93ea-7549f4fe6773/retrieve"},"pageCount":5,"title":"Study #2633 Contributing Projects: • P57 -Mainstreaming CSA practices in mixed tree/food crop systems among smallholder farmers in W Africa","keywords":[],"chapters":[{"head":"Outcome story for communications use:","index":1,"paragraphs":[{"index":1,"size":71,"text":"UTZ has traditionally focused on certification as a means to drive change on key sustainability topics. In 2015 UTZ looked beyond certification and introduced the Sector Partnerships Program with the goal to strengthen partnerships in promoting sustainable farming practices and supporting the development of a thriving Civil Society that can drive change. Promoting gender equality and addressing the challenges of climate change are integral parts of UTZ? concept of sustainable farming."},{"index":2,"size":197,"text":"Based on the success the CSVC project had in Ghana, the UTZ/RA SP project decided to replicate the approach and methodology applied for Cote d?Ivoire. The CCAFS CSVC project had already identified different impact zones for Ghana and Cote d?Ivoire and corresponding hazards, this SP funded project is aimed at developing recommendations for climate smart strategies for different stakeholders based on the different impact zones in CdI, taking in consideration the constrains and needs of different household groups. The recommendations feed into a curriculum for CSA that will be developed in a follow-up project. Similar to the process in Ghana, cocoa farmers and other stakeholders are involved in the process in order to ensure the recommendations are endorsed by relevant stakeholders. As most cocoa farmers in Cote d?Ivoire live below the extreme poverty line, there is a reduced interest (or ability) of some groups of farmers, particularly youth, to invest in cocoa production. Dealing with these complexities requires a shift from focusing only at the technical level and the farm scale, to an approach that emphasizes social change and addresses the (socio-economic) root causes of household vulnerability as well as different stakeholders to create an enabling environment."},{"index":3,"size":98,"text":"In this project, regions, roles, opportunities and responsibilities of different stakeholders are being elaborated for each of the actors and differentiating between regions, in order to create the incentives necessary for the different stakeholders along the value chain to change in a sustainable way. The stakeholders are being involved during the whole process to create buy-in of the recommendations eventually. Uptake and impact of the research findings will be facilitated through the involvement of UTZ/RA?s certification system and the WCF and so builds directly on the processes and thinking developed and implemented under the CSVC project in Ghana."},{"index":4,"size":230,"text":"In addition, WCF has committed to translate the existing Cocoalink app which includes CCAFS outputs from this project into French for use in Cote d'Ivoire and potentially Cameroon with support from private sector. Based on the success the CSVC project had in Ghana, the UTZ/RA SP project decided to replicate the approach and methodology applied for Cote d?Ivoire. The CCAFS CSVC project had already identified different impact zones for Ghana and Cote d?Ivoire and corresponding hazards, this SP funded project is aimed at developing recommendations for climate smart strategies for different stakeholders based on the different impact zones in CdI, taking in consideration the constrains and needs of different household groups. The recommendations feed into a curriculum for CSA that will be developed in a follow-up project. Similar to the process in Ghana, cocoa farmers and other stakeholders are involved in the process in order to ensure the recommendations are endorsed by relevant stakeholders. As most cocoa farmers in Cote d?Ivoire live below the extreme poverty line, there is a reduced interest (or ability) of some groups of farmers, particularly youth, to invest in cocoa production. Dealing with these complexities requires a shift from focusing only at the technical level and the farm scale, to an approach that emphasizes social change and addresses the (socio-economic) root causes of household vulnerability as well as different stakeholders to create an enabling environment."}]},{"head":"Links to any communications materials","index":2,"paragraphs":[{"index":1,"size":97,"text":"In this project, regions, roles, opportunities and responsibilities of different stakeholders are being elaborated for each of the actors and differentiating between regions, in order to create the incentives necessary for the different stakeholders along the value chain to change in a sustainable way. The stakeholders are involved during the whole process to create buy-in of the recommendations. Uptake and impact of the research findings will be facilitated through the involvement of Rainforest Alliance's certification system and the WCF and so builds directly on the processes and thinking developed and implemented under the CSVC project in Ghana."},{"index":2,"size":33,"text":"In addition, WCF has committed to translate the existing Cocoalink app which includes CCAFS outputs from this project into French for use in Cote d'Ivoire and potentially Cameroon with support from private sector."}]}],"figures":[{"text":" environment for climate resilience • Conducive agricultural policy environment Is this OICR linked to some SRF 2022/2030 target?: Too early to say Description of activity / study: <Not Defined> Elaboration of Outcome/Impact Statement: UTZ has traditionally focused on certification as a means to drive change on key sustainability topics. In 2015 UTZ looked beyond certification and introduced the Sector Partnerships Program with the goal to strengthen partnerships in promoting sustainable farming practices and supporting the development of a thriving Civil Society that can drive change. Promoting gender equality and addressing the challenges of climate change are integral parts of UTZ? concept of sustainable farming. "}],"sieverID":"03dfb600-ba25-4ddd-9185-7177ad062d90","abstract":"Based on project work in Ghana, Rainforest Alliance has expanded this work into Ivory Coast through connections with ICRAF and the World Cocoa Foundation. The goal is to provide exposure maps and specific CSA practice guidance to Ivorian farmers similar to what is available in Ghana in the form of training materials, training of company extension officers and farmers and the translation of the Cocoalink app into French."}

data/part_2/02f458a222c7611d8f017052de7d18f3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02f458a222c7611d8f017052de7d18f3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/4869ec40-7141-43a0-af49-9f7d03f74564/retrieve"},"pageCount":10,"title":"Association of Root Hair Length and Density with Yield-Related Traits and Expression Patterns of TaRSL4 Underpinning Root Hair Length in Spring Wheat","keywords":["root hair length","root hair density","wheat","TaRSL4 gene"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":91,"text":"Root hairs are tip-growing tubular projections that emerge from epidermis or periderm [1]. They can make up to 50% of the surface area of the root and extend the absorptive surface of the root into the surrounding soil, allowing for the absorption of water and the nutrients especially those with limited mobility such as phosphate. They also act as a site of interaction with soil microbes [2,3], and strongly determine the size of rhizosheath important for protection from various biotic and abiotic stresses ultimately aiding in crop productivity in challenging environments."},{"index":2,"size":149,"text":"The root hair formation involves three stages including epidermal cell specification, initiation of outgrowth and elongation via tip growth. The morphology, length, and density of root hairs are influenced by various endogenous and external environmental cues [4]. Phosphate is the best characterized external factor, availability of which strongly determines the root hair length [5,6]. In most species, roots developed in low-phosphate environments have longer root hairs than those formed in replete phosphate environment. This phenotypic plasticity of root hairs is characteristic of plant development and is often under strict transcriptional control [7]. In wheat, a stronger correlation between root hair length (RHL) and rhizosheath weight was observed [8]. In barley, RHL was positively correlated with biomass [9]; however, for grain yield only the presence of root hairs, and not the RHL, was critical [10]. A huge knowledge gap exists about correlation of RHL and other morphological traits in wheat."},{"index":3,"size":160,"text":"Omics-based techniques have paved the way for a system-oriented understanding of root hair biology by creating inventory of transcripts and proteins that preferentially accumulate in root hairs [11]. Studies have identified many genes regulating root hair initiation and elongation. For instance, the class I basic helix-loop-helix (bHLH) transcription factors ROOT HAIR DEFECTIVE SIX-LIKE (RSL) positively regulate the growth of root hairs in angiosperms and rhizoids in liverworts and mosses [12]. RSL class I genes of Arabidopsis thaliana function by directly regulating the expression of a closely related bHLH transcription factor, RSL4. RSL4 is important for root hair elongation as few short root hairs develop on rsl4 mutants. Additionally, it is sufficient for root hair formation as its constitutive expression results in constitutive growth of root hairs [13]. Vijayakumar et al. [14] reported that RSL4 regulates the transcription of genes involved in cell growth. These genes encode for proteins involved in vesicle trafficking, cell signaling, lipid signaling, and cell wall modification."},{"index":4,"size":99,"text":"In wheat, the expression of TaRSL4 gene was positively correlated with increased root hair length in diploid and allotetraploid wheats. Additionally, in natural allopolyploid wheat, TaRSL4 homoeologue from genome A (TaRSL4-A) transcript abundance was much greater than that of other genomes. Notably, under nutrient-poor circumstances, higher shoot fresh biomass was caused by increased root hair length caused by overexpression of the TaRSL4-A [15]. Here, we deployed the RNA-seq approach to investigate the differential expression of TaRSL4 in roots and leaves of spring wheat cultivars and impact of its varying transcripts on phenotypic variability of root hairs and yield traits."}]},{"head":"Results","index":2,"paragraphs":[]},{"head":"Phenotypic Variability, Pearson Correlation Coefficient (PCC) and Principal Component Analysis (PCA)","index":3,"paragraphs":[{"index":1,"size":219,"text":"The RHL and RHD of spring wheat cultivars representing 105 years of century wide selection was measured under a Dino-lite edge digital microscope (AnMo, Taiwan) using a cigar roll method. ANOVA indicated that all genotypes significantly differed (p < 0.01) in RHL and RHD as shown in Table 1. The average RHL was 1.39 mm with 1.58-fold variation whereas average RHD was 19.6 mm −2 with 0.54-fold variation. The highest RHL and RHD were recorded in cultivars Pasban-90 (1.81 mm) and Rawal-87 (23.4 mm −2 ), respectively. The coefficient of variation was higher for RHL (17.35%), while lower for RHD (5.63%). The broad sense heritability was 0.69 and 0.76, respectively for RHL and RHD. The Pearson's coefficient of correlation (Figure 1) indicated a strong positive correlation between RHL and RHD (r = 0.45). RHL was positively correlated with RWC (r = 0.14 to 0.49) four out of five environments and their BLUPs. In BLUPs calculated across five environments, RHL had negative correlation with TGW (r = −0.66) and highest positive correlation with RWC (r = 0.49). For RHD, the highest negative correlation was with GY (r = −0.48) followed by grains per spike (r = −0.40) and highest positive correlation was observed with RWC (r = 0.3) followed by distance from the node to flag leaf (r = 0.19)."},{"index":2,"size":197,"text":"The Pearson's coefficient of correlation (Figure 1) indicated a strong positive correlation between RHL and RHD (r = 0.45). RHL was positively correlated with RWC (r = 0.14 to 0.49) four out of five environments and their BLUPs. In BLUPs calculated across five environments, RHL had negative correlation with TGW (r = −0.66) and highest positive correlation with RWC (r = 0.49). For RHD, the highest negative correlation was with GY (r = −0.48) followed by grains per spike (r = −0.40) and highest positive correlation was observed with RWC (r = 0.3) followed by distance from the node to flag leaf (r = 0.19). The PCA plots showing the distribution of RHL, RHD along with other phenotypes and cultivars are represented in Figure 2. The first two components explained 26% and 23.4% of the total variance. The angle of RHL and RHD vectors showed a strong correlation among the traits. The PCA plots showing the distribution of RHL, RHD along with other phenotypes and cultivars are represented in Figure 2. The first two components explained 26% and 23.4% of the total variance. The angle of RHL and RHD vectors showed a strong correlation among the traits."}]},{"head":"Differential Expression Analysis of TaRSL4 in Roots and Leaves","index":4,"paragraphs":[{"index":1,"size":49,"text":"RNA-seq based expression analysis of TaRSL4 in roots and leaves of 24 wheat cultivars revealed highest expression in D-homoeologue. The order of expression in roots was TaRSL4-2D>TaRSL4-2A>TaRSL4-2B. Whereas the expression in leaves was only observed in B-homoeologue. We found no expression of TaRSL4-2A and TaRSL4-2D in leaves (Figure 3)."},{"index":2,"size":86,"text":"All three homoeologues were expressed in roots of all cultivars. However, Seher-2006 and C-518 exhibited highest expression of all homoeologues in roots. The lowest expression was found in roots of NARC-2011 in an order of TaRSL4-2B> TaRSL4-2D> TaRSL4-2A with 0.04, 0.08, and 0.09 tpm values, respectively (Figure 3). The cultivars Barani and Pakistan-13 showed highest expression of TaRSL4-2B in leaves with 0.81 and 0.78 tpm values, respectively. Among all 24 cultivars, three cultivars Dharabi, Parwaz-94, and Pothowar-70 showed no expression of any TaRSL4 homoeologue in leaves."}]},{"head":"qRT-PCR Validation of TaRSL4 Expression","index":5,"paragraphs":[{"index":1,"size":115,"text":"A subset of 12 wheat cultivars was subjected to qRT-PCR validation of RNA-seq data of TaRSL4. The expression was analyzed under control and water-limited conditions. Differential expression patterns were observed among cultivars under control and stress conditions (Figure 4). Of the 12 cultivars tested, seven (T-9, Punjab-11, Chakwal-50, Margallah-99, Maxipak-65, Pasban-90, Rawal-87) showed higher expression of TaRSL4 under stress as compared to control. Whereas Zincol-16, AAS-11, Dharabi, Pak-81, GA-2002 showed higher expression of TaRSL4 under control conditions. Under control conditions, highest expression was recorded in AAS-11 (0.41 ± 0.02) followed by GA-2002 (0.36 ± 0.17). The highest expression under stress condition was also observed in AAS-11 (0.27 ± 0.11) followed by Rawal-87 (0.25 ± 0.06). "}]},{"head":"Differential Expression Analysis of TaRSL4 in Roots and Leaves","index":6,"paragraphs":[{"index":1,"size":135,"text":"RNA-seq based expression analysis of TaRSL4 in roots and leaves of 24 wheat cultivars revealed highest expression in D-homoeologue. The order of expression in roots was TaRSL4-2D>TaRSL4-2A>TaRSL4-2B. Whereas the expression in leaves was only observed in B-homoeologue. We found no expression of TaRSL4-2A and TaRSL4-2D in leaves (Figure 3). All three homoeologues were expressed in roots of all cultivars. However, Seher-2006 and C-518 exhibited highest expression of all homoeologues in roots. The lowest expression was found in roots of NARC-2011 in an order of TaRSL4-2B> TaRSL4-2D> TaRSL4-2A with 0.04, 0.08, and 0.09 tpm values, respectively (Figure 3). The cultivars Barani and Pakistan-13 showed highest expression of TaRSL4-2B in leaves with 0.81 and 0.78 tpm values, respectively. Among all 24 cultivars, three cultivars Dharabi, Parwaz-94, and Pothowar-70 showed no expression of any TaRSL4 homoeologue in leaves.  "}]},{"head":"qRT-PCR Validation of TaRSL4 Expression","index":7,"paragraphs":[]},{"head":"Differential Expression Analysis of TaRSL4 in Roots and Leaves","index":8,"paragraphs":[{"index":1,"size":135,"text":"RNA-seq based expression analysis of TaRSL4 in roots and leaves of 24 wheat cultivars revealed highest expression in D-homoeologue. The order of expression in roots was TaRSL4-2D>TaRSL4-2A>TaRSL4-2B. Whereas the expression in leaves was only observed in B-homoeologue. We found no expression of TaRSL4-2A and TaRSL4-2D in leaves (Figure 3). All three homoeologues were expressed in roots of all cultivars. However, Seher-2006 and C-518 exhibited highest expression of all homoeologues in roots. The lowest expression was found in roots of NARC-2011 in an order of TaRSL4-2B> TaRSL4-2D> TaRSL4-2A with 0.04, 0.08, and 0.09 tpm values, respectively (Figure 3). The cultivars Barani and Pakistan-13 showed highest expression of TaRSL4-2B in leaves with 0.81 and 0.78 tpm values, respectively. Among all 24 cultivars, three cultivars Dharabi, Parwaz-94, and Pothowar-70 showed no expression of any TaRSL4 homoeologue in leaves."}]},{"head":"qRT-PCR Validation of TaRSL4 Expression","index":9,"paragraphs":[{"index":1,"size":36,"text":"A subset of 12 wheat cultivars was subjected to qRT-PCR validation of RNA-seq data of TaRSL4. The expression was analyzed under control and water-limited conditions. Differential expression patterns were observed among cultivars under control and stress "}]},{"head":"Gene Structure and Co-Expression Network Analyses","index":10,"paragraphs":[{"index":1,"size":49,"text":"Three homoeologues vary in gene length as shown in Figure 5. Gene structure analysis of TaRSL4 by gene display server indicated that gene consisted of five exons and four introns. A total of seven SNPs has been identified within TaRSL4, the details of which are given in Table 2."},{"index":2,"size":194,"text":"A total of 81 genes were co-expressed with TaRSL4 as analyzed under global RNA-seq network (Figure S1). The location of the co-expressed genes on each of wheat chromosome is depicted in Figure S2. Of these genes, three were found in negative co-expression relationship with target protein. The expression profile of co-expressed genes in global network of Chinese Spring indicated that most of the genes are highly expressed in roots as compared to other parts (Figure S3). The GSEA showed 34 gene sets with various cellular, molecular, and biological functions that are given in Table S2. The tissue-specific RNA-seq network also revealed 81 genes co-expressed with TaRSL4 of which 5 had negative co-expression relationship with TaRSL4 as shown in Figure S4. The expression and location of this co-expression network genes is given in Figures S5 and S6 respectively. The GSEA indicated 9 gene sets of which 4 were involved in molecular function and 5 were related to various biological process (Table S3). In contrast to other networks, stress-specific RNA-seq network indicated few (13) co-expressed genes along with TaRSL4 (Figure S7) distributed over chr1B, chr2A, chr2B, chr3A, chr3D, chr4B, chr4D, chr6B, chr6D, and chr7A (Figure S8)."},{"index":3,"size":69,"text":"Plants 2022, 11, x FOR PEER REVIEW 5 of 10 conditions (Figure 4). Of the 12 cultivars tested, seven (T-9, Punjab-11, Chakwal-50, Margallah-99, Maxipak-65, Pasban-90, Rawal-87) showed higher expression of TaRSL4 under stress as compared to control. Whereas Zincol-16, AAS-11, Dharabi, Pak-81, GA-2002 showed higher expression of TaRSL4 under control conditions. Under control conditions, highest expression was recorded in AAS-11 (0.41 ± 0.02) followed by GA-2002 (0.36 ± 0.17)."},{"index":4,"size":20,"text":"The highest expression under stress condition was also observed in AAS-11 (0.27 ± 0.11) followed by Rawal-87 (0.25 ± 0.06). "}]},{"head":"Gene Structure and Co-Expression Network Analyses","index":11,"paragraphs":[{"index":1,"size":108,"text":"Three homoeologues vary in gene length as shown in Figure 5. Gene structure analysis of TaRSL4 by gene display server indicated that gene consisted of five exons and four introns. A total of seven SNPs has been identified within TaRSL4, the details of which are given in Table 2.  conditions (Figure 4). Of the 12 cultivars tested, seven (T-9, Punjab-11, Chakwal-50, Margallah-99, Maxipak-65, Pasban-90, Rawal-87) showed higher expression of TaRSL4 under stress as compared to control. Whereas Zincol-16, AAS-11, Dharabi, Pak-81, GA-2002 showed higher expression of TaRSL4 under control conditions. Under control conditions, highest expression was recorded in AAS-11 (0.41 ± 0.02) followed by GA-2002 (0.36 ± 0.17)."},{"index":2,"size":20,"text":"The highest expression under stress condition was also observed in AAS-11 (0.27 ± 0.11) followed by Rawal-87 (0.25 ± 0.06). "}]},{"head":"Gene Structure and Co-Expression Network Analyses","index":12,"paragraphs":[{"index":1,"size":49,"text":"Three homoeologues vary in gene length as shown in Figure 5. Gene structure analysis of TaRSL4 by gene display server indicated that gene consisted of five exons and four introns. A total of seven SNPs has been identified within TaRSL4, the details of which are given in Table 2.   "}]},{"head":"Discussion","index":13,"paragraphs":[{"index":1,"size":289,"text":"We phenotyped a collection of 24 century wide wheat cultivars using cigar roll method and imaged with Dinolite microscope that offered a simple and fast screening of root hairs with minimum damage. All cultivars differed significantly for RHL and RHD with greater variation for both traits. It was interesting to note that wheat root hairs vary in length and density, and cultivars with longer root hairs may also have more hair [16]. The results from Marin et al. [17] demonstrated that presence of root hairs improved the plant water and prevented grain yields from declining in barley. In our experiment, positive correlation between RHL and RWC was seen. Gahoonia and Nielson [18] showed that barley cultivars with longer root hairs had improved grain yield in a P-deficient soil where root hairs are believed to contribute to P uptake by increasing the root surface area involved in P acquisition. Cai and Ahmed [19] discussed that contradictory evidence are reported about RHL and its shrinkage in response to soil drying. Root hairs in rice and maize are shorter and vulnerable and made little contribution to root water uptake. In contrast, barley have relatively longer root hairs and had a clear influence on root water uptake, transpiration, and hence plant response to soil drying. It was concluded that the role of root hairs in water uptake is species (and probably soil) specific. We propose that a holistic understanding of the efficacy of root hairs in water uptake will require detailed studies of root hair length, turnover, and shrinkage in different species and contrasting soil textures. In this scenario, our results clearly showed significant correlation of RWC with RHL and need to be further tested by developing mutants with different root hair phenotypes."},{"index":2,"size":145,"text":"A wide range of genetic variation for RHL was observed in spelt wheat and landraces compared to modern bread wheat [20]. Furthermore, a QTL QRhl.obu-2A was identified in spelt wheat for RHL and it was co-located with TaRSL-2A which is a key regulator of root hair elongation. Our results were in agreement with Han et al. [15] that A-homoeologue has highest and variable expression of TaRSL4 in a century wide collection of spring bread wheats and differentially expressed in root compared to leaf tissues. We further validated the expression of TaRSL4 in wheat cultivars under two water treatments, and expression was higher in rainfed cultivars such as GA-2002, Dharabi, Aas-2011, and Rawal-87. While under water-limited conditions, expression of TaRSL4 was higher compared to control conditions in Chakwal-50, Margallah-99, and Rawal-87. This indicated the role of TaRSL4 is crucial in root hair development under water-limited conditions."},{"index":3,"size":96,"text":"We further surveyed the presence of SNP markers within TaRSL4 homoeologues and identified that 4 SNP markers were present, out of which RAC875_c6677_1094 SNP from 90K SNP array caused a missense mutation. The frequency analysis of this SNP in a wider collection of 727 Pakistani and Chinese wheat cultivars and landraces indicated that this SNP is completely fixed, and no alternate alleles are present in these collections. It is likely that gene has been fixed during wheat domestication; however variable gene expression indicated the role of its transcription factor to further fine-tune the control of phenotype. "}]},{"head":"Materials and Methods","index":14,"paragraphs":[]},{"head":"Plant Material","index":15,"paragraphs":[{"index":1,"size":61,"text":"A set of 24 spring wheat cultivars of Pakistan were characterized for root hair length (RHL), density (RHD), and the morphological traits (Table S1). These cultivars were released in Pakistan between 1911 and 2016 and include old and modern wheat cultivars. The details of the morphological and physiological traits for this panel have been previously published except RHL and RHD [21]."}]},{"head":"Development of Root Hair Phenotyping Platform","index":16,"paragraphs":[{"index":1,"size":138,"text":"Seeds were surface sterilized with 2% sodium hypochlorite (NaOCl) solution by soaking them in the solution for two minutes and subsequently rinsed three times with distilled water. The seeds with radicals pointing downwards were placed equally spaced in a row at a distance of 2 cm from the top on a germination paper. Another germination paper was laid on top of it and sprayed with the solution. The germination papers were labelled and rolled in a cigar configuration and placed in 1 L glass beakers filled with distilled water supplied with 0.5 L of 0.5 mM CaSO 4 solution. The experiment was executed in three replications. The beaker and the rolls were covered with a large plastic bag and kept in growth chamber at 22 • C for 18 hours and 6 hours day and night cycle respectively."},{"index":2,"size":89,"text":"After six days, the cigar rolls containing seedlings were removed from beakers and placed in an oven at 72 • C until fully dried. Then roots were harvested, and images of dried root hairs were captured using a Dino-lite edge digital microscope (AM7115MZTW; Taiwan) under 40x magnification. The images were processed with DinoCapture 2.0 software. At least six longest root hairs were selected from each replication for measuring root hair length and their mean values were recorded. Density was calculated per mm 2 of the randomly selected root zone."}]},{"head":"Field Experiments","index":17,"paragraphs":[{"index":1,"size":105,"text":"The cultivars were evaluated in five environments (location-year combinations) in fields at in the field of National Agriculture Research Centre (NARC), Islamabad, Pakistan located at 33 • 43 N 73 • 04 E, and Barani Agriculture Research Institute (BARI), Chakwal, Pakistan located at 32 • 43 N 72 • 08 E. The field trials were conducted using a randomized complete block design (RCBD) with three replications. The five environments were named as NARC_2017 (NA17), BARI_2017 (BA17), BARI_D2017 (BD17), NARC_2018 (NA18), and BARI_D2018 (BD18). Among these, BD17 and BD18 were especially chosen for having moisture stress conditions. The details are provided in Hanif et al. [21]."}]},{"head":"Expression Profiling of TaRSL4 Using RNA-seq Data","index":18,"paragraphs":[{"index":1,"size":174,"text":"For identification of genotypic variations in gene expression, RNA-seq data on 24 wheat cultivars were used (NCBI BioProject ID: PRJNA863398). Briefly, RNA from leaf and roots of 14 days old seedlings was used to construct single-end libraries. The samples were sent to Beijing Genomics Institute (BGI), China for sequencing. The resulting data were subjected to quality control and differentially expressed genes (DEGs) were identified using DeSEQ2 in R software. The threshold for filtering DEGs was kept 0.1. The heat maps were constructed using TBtools with Java Runtime Environment 1.6. [22]. Surface sterilized seeds of 12 wheat cultivars were grown in germination papers configured to roll-ups under well-watered and water-limited conditions. Two weeks after sowing, seedings were removed and total RNA was extracted using EasyPure Plant RNA Kit (ER301-01; TransGen Biotech, Beijing, China) following manufacturer instructions. Integrity of RNA samples was checked on 1% Agarose gel. RNA quantification was performed in a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and samples with A260/A280 in a range of 1.9-2.1 were considered for cDNA synthesis."},{"index":2,"size":105,"text":"The cDNA was synthesized using ABClonal ABScript III RT Master Mix supplemented with gDNA remover. The reverse transcription reaction components included a 4 µL 5X ABScript III RT Mix, 1 µL 20X gDNA remover mix, 1 µg total RNA, and 13 µL nuclease-free water making a final volume up to 20 µL. The reaction conditions for the reaction were 37 • C for 2 minutes, 55 • C for 15 minutes, 85 • C for 5 minutes, and 4 • C to hold. The products were quantified using Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) and stored at −20 • C for subsequent qRT-PCR reaction."}]},{"head":"qRT-PCR","index":19,"paragraphs":[{"index":1,"size":166,"text":"The coding sequence of TaRSL4 retrieved from NCBI was used to design common primers for all three homoeologues using Primer-BLAST (https://www.ncbi.nlm.nih.gov/ tools/primer-blast (5 January 2021, date last accessed)). Actin was used as housekeeping gene for which a previously designed primer pair was used. The primer sequences for TaRSL4 were as follows: qRT_TaMOR_F: CTACTTCTGCCACGAGCAGG, qRT_TaMOR_R: CCAGGAGCTTGGAGACGTTG. The transcripts of TaRSL4 were quantified using Livak method in a CFX384 Real-Time detection system (Bio-Rad, Hercules, CA, USA). The reaction components included a 10 µL 2X Universal SYBR Green Fast qPCR, 1 µL cDNA product (40 ng/µL), 0.4 µL forward primer (10 µM), 0.4 µL reverse primer (10 µM) and a final volume of 20 µL was made by adding 8.2 µL nuclease-free water. A two-step reaction consisted of 1 cycle at 95 • C for 3 min and 39 cycles at 95 • C for 5 s, 60 • C for 30 s. For the amplification product specificity, a melt curve was generated at the end of the reaction."}]},{"head":"Gene Structure and Co-Expression Network Analysis","index":20,"paragraphs":[{"index":1,"size":117,"text":"The CDS and gene sequences of TaRSL4 homoeologues were obtained from IWGSC RefSeq v2.0 and gene structure was constructed using GSDS v2.0 at http://gsds.gao-lab. org/ (4 July 2022, date last accessed) [23]. Co-expression network analysis of TaRSL4 in allohexaploid wheat was performed using WheatCEnet database (http://bioinformatics. cpolar.cn/WheatCENet) (4 July 2022, date last accessed) [24]. The global and conditional (tissue-specific and stress-treated) networks were constructed using the calculated FPKM (fragments per kilobase of transcript per million mapped fragments) values extracted from publicly available RNA-seq datasets for Chinese Spring. The networks were based on Pearson correlation coefficient (PCC) and mutual rank (MR) algorithm. The gene set enrichment analysis was performed using the Plant GSEA database at FDR < 0.05."}]},{"head":"Statistical Analysis","index":21,"paragraphs":[{"index":1,"size":62,"text":"Phenotypic data of root hair length and density were analyzed for ANOVA and means were computed for descriptive statistics in Jamovi 2.0.0. Correlation was calculated using Pearson's correlation coefficient using \"ggpairs\" in R. Standard error of gene expression data was calculated by dividing the standard deviation by the square root of the sample size in Microsoft Excel for Microsoft 365 version 2207."}]},{"head":"Conclusions","index":22,"paragraphs":[{"index":1,"size":100,"text":"Root system architecture (RSA) in cereals is a promising research discipline with huge potential to translate its output in productivity and resilience to climate extremes [25]. Likewise, RHL and RHD have long been neglected phenotypes in wheat and should be focused to bridge the literature gap. We identified significant positive correlation of RHL and RHD with relative-water contents which indicated potential role of root hairs in mediating resilience under water shortages. The altered expression of TaRSL4 among wheat cultivars is not due to the nucleotide variations, perhaps an epigenetic variation is likely the reason of variable genotypic and homoeologue-specific expression."}]}],"figures":[{"text":"Figure 1 . Figure 1. Pearson's coefficient of correlation between morpho-physiological traits and root hair length (RHL) and root hair density in five different environments including NARC2017 (a), NARC2018 (b), BARI2017 (c), BARI2017D (d) BARI2018D (e), and their bi linear unbiased predictions (BLUPs) (f). Trait abbreviations can be read as: RWC: relative water contents, W: waxiness, RCC: relative chlorophyll content, DTH: days to heading, LR: leaf rolling, PH: plant height, DNTL: distance from top node to flag leaf, DTM: days to maturity, FLA: flag leaf area, NTPP: number of tillers per plant, SL: spike length, GPS: grains per spike, GY: grain yield, BM: biomass, HI: harvest index, NSPP: number of spikes per plot, CT: canopy temperature, TGW: thousand grains weight. The legend indicates the value of Pearson's correlation coefficient (r). "},{"text":"Figure 1 . Figure 1. Pearson's coefficient of correlation between morpho-physiological traits and root hair length (RHL) and root hair density in five different environments including NARC2017 (a), NARC2018 (b), BARI2017 (c), BARI2017D (d) BARI2018D (e), and their bi linear unbiased predictions (BLUPs) (f). Trait abbreviations can be read as: RWC: relative water contents, W: waxiness, RCC: relative chlorophyll content, DTH: days to heading, LR: leaf rolling, PH: plant height, DNTL: distance from top node to flag leaf, DTM: days to maturity, FLA: flag leaf area, NTPP: number of tillers per plant, SL: spike length, GPS: grains per spike, GY: grain yield, BM: biomass, HI: harvest index, NSPP: number of spikes per plot, CT: canopy temperature, TGW: thousand grains weight. The legend indicates the value of Pearson's correlation coefficient (r). "},{"text":"Figure 2 . Figure 2. The PCA plot showing the loading of variables (root hair length and root hair density on left) and the scores of each variety (right). Points closer together correspond to cultivars having similar scores on the PCA components. "},{"text":"Figure 3 . Figure 3. Differential expression patterns of TaRSL4 homoeologues in roots and leaf of twenty-four wheat cultivars as analyzed through RNA-seq. "},{"text":"Figure 2 . Figure 2. The PCA plot showing the loading of variables (root hair length and root hair density on left) and the scores of each variety (right). Points closer together correspond to cultivars having similar scores on the PCA components. "},{"text":"Figure 2 . Figure 2. The PCA plot showing the loading of variables (root hair length and root hair density on left) and the scores of each variety (right). Points closer together correspond to cultivars having similar scores on the PCA components. "},{"text":"Figure 3 . Figure 3. Differential expression patterns of TaRSL4 homoeologues in roots and leaf of twenty-four wheat cultivars as analyzed through RNA-seq. "},{"text":"Figure 3 . Figure 3. Differential expression patterns of TaRSL4 homoeologues in roots and leaf of twenty-four wheat cultivars as analyzed through RNA-seq. "},{"text":"Figure 4 . Figure 4. qRT-PCR based relative expression of TaRSL4 in twelve wheat cultivars under control and water-limited conditions. "},{"text":"Figure 5 . Figure 5. Gene structure of TaRSL4 homoeologues showing position of their respective SNPs. "},{"text":"Figure 4 . Figure 4. qRT-PCR based relative expression of TaRSL4 in twelve wheat cultivars under control and water-limited conditions. "},{"text":"Figure 4 . Figure 4. qRT-PCR based relative expression of TaRSL4 in twelve wheat cultivars under control and water-limited conditions. "},{"text":"Figure 5 . Figure 5. Gene structure of TaRSL4 homoeologues showing position of their respective SNPs. "},{"text":"Figure 5 . Figure 5. Gene structure of TaRSL4 homoeologues showing position of their respective SNPs. "},{"text":"4. 5 . Quantitative RT-PCR (qRT-PCR) Based Analysis of TaRSL4 4.5.1. RNA Isolation and cDNA Synthesis "},{"text":"Table 1 . Descriptive statistics and analysis of variance of root hair length (RHL) and root hair density (RHD) of twenty-four spring wheat cultivars. Parameters RHL RHD ParametersRHLRHD Minimum 1.01 17.08 Minimum1.0117.08 Mean 1.39 19.60 Mean1.3919.60 Maximum 1.81 23.37 Maximum1.8123.37 CV% 17.35 5.63 CV%17.355.63 σ 2 g 0.39 *** 6.13 *** σ 2 g0.39 ***6.13 *** H-bs 0.69 0.76 H-bs0.690.76  "},{"text":"Table 2 . Description of SNPs within TaRSL4. Gene ID SNP SNV Position SNP Effect Amino Acid Change Gene IDSNPSNVPositionSNP EffectAmino Acid Change TraesCS2A02G194200 AX-109021403 C->A Chr2A: 162291329 upstream gene variant  TraesCS2A02G194200AX-109021403C->AChr2A: 162291329upstream gene variant  RAC875_c6677_1094 C->T Chr2A:162291489 missense variant p.Thr15Met RAC875_c6677_1094C->TChr2A:162291489missense variantp.Thr15Met TraesCS2B02G212700 AX-95243069 C->A Chr2B: 197211395 downstream gene variant  TraesCS2B02G212700AX-95243069C->AChr2B: 197211395downstream gene variant  RAC875_c6677_1094 A->G Chr2B:197212370 missense variant p.Met15Thr RAC875_c6677_1094A->GChr2B:197212370missense variantp.Met15Thr  AX-94776746 A->G Chr2B:197212249 synonymous variant  AX-94776746A->GChr2B:197212249synonymous variant TraesCS2D02G193700 RAC875_c6677_1094 A->G Chr2D 138755902 missense variant p.Met15Thr TraesCS2D02G193700RAC875_c6677_1094A->GChr2D 138755902missense variantp.Met15Thr  AX-94776746 G->A Chr2D 138755781 synonymous variant  AX-94776746G->AChr2D 138755781synonymous variant  SNP: Single Nucleotide Polymorphism; SNV: Single Nucleotide Variation.  SNP: Single Nucleotide Polymorphism; SNV: Single Nucleotide Variation.  "}],"sieverID":"18a12a14-7f83-4867-b0cd-309c5e3efeed","abstract":"Patterns of TaRSL4 Underpinning Root Hair Length in Spring Wheat."}

data/part_2/031388e9cc67777562b2e4f8434c53e0.json

@@ -0,0 +1 @@
+{"metadata":{"id":"031388e9cc67777562b2e4f8434c53e0","source":"gardian_index","url":"https://www.iwmi.cgiar.org/iwmi-tata_html/PartnersMeet/pdf/016%20-%20Nagar.pdf"},"pageCount":24,"title":"","keywords":[],"chapters":[{"head":"The Groundwater Recharge Movement in Gujarat","index":1,"paragraphs":[{"index":1,"size":18,"text":"A Quantitative Idea of the Groundwater Recharge in Saurastra & North Gujarat  Regions: What Energized the Popular Movement?"}]},{"head":"R K Nagar","index":2,"paragraphs":[]},{"head":"Preamble","index":3,"paragraphs":[{"index":1,"size":275,"text":"Saurastra and North Gujarat are the two most draught prone regions of Gujarat state in Western India. In the decade of 80's, most part of these regions experienced 6-7 years of draught of varying intensity. In the regions that are almost fully dependent on rainfed or groundwater irrigation, sufficiency of ground water is basic to sustainable agriculture for water availability has deep socio-economic and political consequences. Though Saurastra has over 100 river basins; barring four-Bhadar, Aji, Shatrunji and Machchhu-all the rivers are highly seasonal, shallow and, rapid flowing with limited potential for surface water based irrigation projects. The regions' agriculture is therefore going to remain heavily dependent on Groundwater. The high frequency of draughts and its consequent impact on the economy of the region in the absence of any significant surface water based irrigation system led to the emergence of a popular movement that aimed at conserving the rainwater and recharging the ground water resources/ table as a more dependable measure of draught proofing. Over the last 3-4 years the movement has grown in both intensity and reach. Its impact can be more clearly seen in years of draught in places where the movement has resulted in building an infrastructure large enough in size/ number to effectively address the localized problem of water shortage. The popular movement has adopted two basic approaches. First-recharge of open wells by directing the surface runoff through a percolation-cum-filter pit directly in to the wells and the second-collecting the surface runoff at points convenient through a series of check dams build on streams either natural or artificial and allow the collected runoff to sep in to recharge the groundwater table."},{"index":2,"size":124,"text":"This study aims to address three basic questions. First, 'What energized the popular movement to build recharge structures on open wells or check dams as a means of draught proofing in Saurastra'; Second, does large scale build up of check dams in the basin of an existing surface water irrigation system result in any significant reallocation of available runoff taking Aji basin as a case, and finally, how effective the CD's have been in draught proofing in a localized situation to answer water problem in face of serious draught situation and are the experiences rich enough to warrant a support for the movement now spearheaded by the Saurastra Jaldhara Trust and supported by the Government of Gujarat as Sardar Participatory Water Conservation Project (SPPWCP)."},{"index":3,"size":181,"text":"This study has been carried out in three parts. In the first part, an attempt was made to develop a \"quantitative idea of the scale of groundwater recharge work in Saurastra and North Gujarat through private wells, through check dams, ponds, hidden dams across streams, and other means\" through extensive field work and discussion with Swadhyay Pariwar members, with local activists, with farmers and Government officials. In the second part Aji river basin has been studied to ascertain if the \"check dams built so far result in any significant reallocation of the water available during the years of severe draught and, at the current levels of infrastructure build-up do the check dams have any impact on draught proofing the basin\". The third part of the study aims at carrying out case studies in a couple of villages where there has been a sufficiently large number of check dams built in the last couple of years to study the experience and see if it is reasonable enough to prove the \"efficacy of the Check dams as an effective way of draught proofing\"."}]},{"head":"Water and Draughts in Gujarat; A brief review","index":4,"paragraphs":[{"index":1,"size":157,"text":"The western Indian state of Gujarat has three distinct regions. The western most Saurastra region comprising the districts of Bhavnagar, Amreli, Junagarh, Rajkot, Surendranagar, Jamnagar and Kutch is the most rainfall scares region and receives annually between 380 mm (in the northern part of the region) to 680 mm (in the southern part) of rain. It receives, less than normal rains in three out of four years. The development of irrigation in the region is mainly open-well / shallow tube-well based 1 , that often dry out within couple of months of the end of monsoon season and, in case the rainfall is insufficient, as is normally the case, the wells do not have enough water even to protect the main kharif crop of Groundnut and coarse cereals-Bajra and Jowar. Failure of Groundnut crop in Saurastra and consequent rise in the price of Groundnut oil in Gujarat has often lead to serious political battles in the past."},{"index":2,"size":353,"text":"During the decade of 80's, the region experienced draught and crop failure in almost all the districts atleast for 5-6 years, when more than half the villages in each district were severely hit by water scarcity. 2 Insufficient rainfall also causes a major drinking water/ domestic use scarcity in the villages and towns. Draught relief measures are most frequently required to be taken by the Government often requiring transport of  604) 904(1035) Note the sharp variations in the area irrigated in two years under reference. Also the wells emerge as the principal source of irrigation for over 95 % of the net area irrigated except for Bhavnagar, where the wells irrigated area id about 84% of net irrigated area. Sufficiency of Groundwater is therefore basic to sustainable agriculture in the region.  (1991)  large volumes of water to villages and towns at a considerable cost to the exchequer. Further the region is arid, the topography, barring parts of Junagarh around Girnar hills and parts of Rajkot, is flat; the soils are shallow with depths of barely a feet or so covered with black clayey loam in Rajkot, Junagarh and Jamnagar and, a stony substrata with permeable levels between 50 to 100 feet followed by the hard rock strata. While parts of Bhavnagar and most part of Surendranagar have yellowish-white china clay that has extremely poor percolation capacity. The region therefore suffers from faster surface run-off of rainwater and extremely slow recharge. The growing number of open wells and tube wells has created a situation where the wells often run dry within few days after the end of the monsoon season. Attempts to explore ground water at depths of about a 1000 feet often results in saline, brackish, and hot water (at 40-45 degrees Celsius) that is neither suitable for irrigation nor the domestic use. The entire region does not have aquifers and water seeps in mainly through open lineaments, dykes into fractures and fissures in the sub-strata that is capable of retaining water to meet the irrigation and domestic use needs for most part of the year, depending upon the localized water use pattern."}]},{"head":"Water recharge in the wells","index":5,"paragraphs":[{"index":1,"size":158,"text":"The peculiarity of the geo-hydrology of the region, and absence of a major river basin, (the four seasonal rivers in Saurastra fed by seasonal streams/tributaries that become active with arrival of rains and run dry soon thereafter) leaves no scope for an elaborate canal system for irrigation. Frequent occurrence of draughts and crop failures made some farmers to experiment with well recharge in 1988 in Dhoraji taluka of Rajkot. Their logic was simple. Why allow all the water to run -off into the sea? Why not collect it back into the well, and use it for irrigating the crops. This can well be said to be the first conscious effort by farmers themselves to find answer to a perpetual problem of water shortage that later grew into a popular movement. The movement gained further momentum following severe draught of 1999 monsoon when rains failed all over Gujarat state including south Gujarat that normally receives around 1800 mm rainfall."},{"index":2,"size":415,"text":"Direct recharge of open wells and bore wells by collecting the surface runoff in collection tanks, lined with sand, gravel and stone filters, and then diverting it straight into the wells through a pipe opening directly into the well (in case of open wells) or diverting the water into the casing of the bore well. The method has been popularized in Saurastra region by Saurastra Lok Manch (SLM), a non profit making public trust, set up on 24 th April 1989 by Shamjibhai Antala, a veteran journalist and social activist, with the sole purpose of creating awareness among the farmers about the well recharge technique and urging them to find their own solutions to the recurring water problem. The technique has been widely used by the farmers of Rajkot and Junagarh districts. The movement was supported by voluntary donations from Surat based businessmen originally hailing from Saurastra to mass produce literature on well recharge techniques and it's free distribution. Well recharge as a method was first reluctantly adopted by a few farmers, some of them belonging to the Swadhyay movement and drew the attention of other Swadhyayis. Later as the Swadhyay pariwar got convinced about the efficacy of the technique, it took initiative to popularize the method mainly in Rajkot and Junagarh where soil conditions permitted direct recharge without the fear of mud clogging the fractures in the wells. 3 The other important organization, that took to direct well recharge in Saurastra is the Swaminarayan Gurukul, Rajkot. It however, gave up on it after two years and took to Check dam activity aimed at recharging the water table. Many NGO's and other charitable trusts that are now engaged in rainwater conservation movement in Saurastra are still apprehensive about direct well recharge. Moreover, Saurastra Lok Manch, that initiated popularization of the technique on a wide scale, is now inactive for the last three years as Mr. Antala, the founder of the trust feels that they have achieved the objective of popularizing the technique and there is not much left for the trust to do. 4 The third important organization that has worked on direct well recharge is the NGO-Agha Khan Rural Support Program, India (AKRSP). The NGO is active in the coastal Mangrol-Maliya Talukas of Junagarh district. In this part the farmers have been doing intensive irrigation through DTW's. Over extraction of groundwater has resulted in a large number of coastal shallow open wells and STW's turning saline, affecting both-drinking water supply, crop output and quality."}]},{"head":"Recharging the Ground water table","index":6,"paragraphs":[{"index":1,"size":265,"text":"There have been two principal examples as inspiration for ground water recharge movement in Saurastra. One: village Raj Samadhiyala in Rajkot taluka of Rajkot district. Located at 20 km from Rajkot city on Bhavnagar road, this village has, over a period of nearly 20 years built an infrastructure that enables all the village wells to recharge even when the annual rainfall is just about one third of normal. Water recharging through check dams started in 1978. To date they have build 45 Check dams / causeways and 13 percolation tanks/ earthen dams. Last year the rainfall was just about 8 inches, yet all the 240 wells in the command of the watershed were fully recharged and the water lasted for one full year for irrigation, apart from permanently solving the drinking water problem. RS has thus set a very fine example of coping with draught and is today seen as a model for replication all over Saurastra. 5 Another example to emulate has been that of the work carried out by Tarun Bharat Sangh (TBS) in Alwar district of Rajasthan. Through a series of Check dams, the TBS has been able to raise water table in the wells of 660 villages, has revived a dead river-Arwari into a perennial river and has provided a low cost permanent solution to the problem of water scarcity and environmental degradation. Many private and public trusts from Gujarat have studied the work of TBS in Alwar, found it replicable in Saurastra and have taken technical assistance of the TBS to start the activities in their own area of operation."}]},{"head":"Organizations in Groundwater recharge","index":7,"paragraphs":[]},{"head":"1.Saurastra Jaldhara Trust, Surat (SJT)","index":8,"paragraphs":[{"index":1,"size":206,"text":"Notable among the organizations who have done considerable work on Groundwater recharge, through building a series of check dams on the streams of the four seasonal rivers of Saurastra along with building a deep canal system with check dams to stop the rain water from quickly flowing away is the Saurastra JalDhara Trust, Surat. Promoted by the diamond merchants hailing from Amreli and Bhavnagar districts and based in Surat, drawing inspiration from TBS and RS, the trust built 200 check dams and 20 percolation tanks in village Khopada of Bhavnagar district in just one year-1998. With the first rain of 1999 monsoon season, all the CD's and PT's got completely filled and the water table in the village wells rose by an astounding 20 to 50 feet. This one recharge enabled the farmers to take irrigated rabi crop and the agricultural production in the village, according to the trust, doubled in one year. What is noteworthy here is that 1999 was a year of severe draught all over Saurastra including Bhavnagar. Moreover, Bhavnagar district had suffered from draught for 9 out of 10 years of varying intensity during the decade of 80's-of which the last 5 years were particularly severe affecting 100% of the inhabited villages."},{"index":2,"size":321,"text":"During the current year the trust replicated the process after seeing the results of Khopada experiment in many other villages. In Dudhada village of Lathi taluka in Amreli district, all cart tracks measuring 42 km in length were converted into canals and 104 check dams were built at an average distance of 500 meters. Overflow from fields and the last check dam is collected in a drain built to carry the overflow towards Lathi, and the surplus of Lathi flows into Shutranji River. Entire work was completed this year in just 8 months. Peoples' contribution has been in form of: one, surrendering land to allow for widening of the cart tracks into canal and dumping of excavated earth on the other side to form as elevated road and two, as wage free labor. The village has 100 families, all own land including about 20 harijan families ( a socially backward class) who are as much part of the program as others and are also to benefit from irrigation water. First rain of the current monsoon season-about 4-5 inches has just filled up the canals and the recharge has begun. Within 24 hours after the rain the collected water level in newly dug canals dropped by 2 feet. Expectation of the farmers is that, for the first time, all the 65-70 wells (Operational + defunct) will have recharged water to irrigate entire 4500 Bigha of cultivated land. The village had earlier tried direct well recharge. It worked better than normal recharge in a year of normal monsoon when barely 5-6 wells got fully recharged, but was still not very satisfactory. They now hope that all the wells will get recharged fully once the rainfall of about 8-10 inches is received. During the year similar structures were built by the SJT in Jharakhia, Kerada, both villages contiguous to Dudhada, Trust activities now extend to 220 villages of Gadhra, Botad, Vallabhipur and Mahuva talukas."}]},{"head":"2.Sardar Patel Jalsanchay Abhiyan Trust, Paanch Tobra, Lathi Taluka, Damnagar-Garidhar Road.","index":9,"paragraphs":[{"index":1,"size":230,"text":"This trust, again promoted by Surat based diamond traders from the village, also drew inspiration from the achievements of RS and Alwar. In order to find a permanent solution to the acute water scarcity, the village decided to use it's own resources to build a canal-check dam structure to conserve rain water similar to what had been done in RS. The peoples' contribution was, by consensus fixed at Rs. 200-300 per bigha and wage free labor. The trust provides cement for construction of check dams. Before starting the work, the trust held a village meeting in which a resolution was taken that no one from the village would incur any expenditure on religious and social ceremonies and instead use the saved funds for water recharging infrastructure. . Another major decision taken and promptly implemented was to fill up all bore wells deeper than 200 feet, and the resolution was promptly implemented. Since the diamond traders who normally help the villagers at the time of need with funds were the motivators, the village placed their entire trust in their judgment, thus there was no difficulty in getting the above resolution unanimously accepted and promptly implemented. The villagers understood that they have everything to gain from the leadership of the diamond merchants. The trust activities now cover 222 villages in Gariadhar, Sihor and palitana Taluks with Check dams and water conservation activities."}]},{"head":"3.Agha Khan Rural Support Program, India (AKRSP)","index":10,"paragraphs":[{"index":1,"size":291,"text":"In Saurastra region, the AKRSP is active in Mangrol-Maliya taluka of Junagarh district covering 427 villages. The focus of the program is to check salinity ingress, which has been affecting the entire coastal belt. Due to intensive irrigation with DTW in the coastal region and cultivation of water intensive crops like sugarcane, wheat, coconut etc, the salinity ingress has been increasing at an annual rate of 500 meters turning all the shallow wells and drinking water sources saline. The increased salinity in soils is resulting in a steady decline in the yield of Ground Nut and Sorghum, the size of coconuts is reducing and the water in the nuts is turning saline. In other parts of the district, bore wells up to a depth of 400 feet fail to yield water for more than a season. AKRSP initiated its activities in the area of water in 1995-96 and has till date (1999) three types of activities related with water: -• Drinking water, underground storage tanks: For domestic water use, the activity involves construction of underground tanks at household level to collect rainwater. Each household gets a tank of 20000 liters capacity. To date 460 tanks have been constructed with GOG funding @ Rs.18000 per family and family contribution of Rs. 2000. • Construction of 129 check dams to recharge ground water levels and surrounding wells. This activity is financed jointly on cost sharing basis by the GOG-75%, AKRSP-25%, and a 5% voluntary contribution of the beneficiaries (farmers' whose wells fall within the command of the dam and feel that they would benefit from recharge of wells) • Direct well recharge: 150 numbers (Out of some 6000 wells with recharge structure in the area. Others have been done by the Swadhyay pariwar.)"}]},{"head":"Shri Swaminarayan Gurukul, Rajkot","index":11,"paragraphs":[{"index":1,"size":253,"text":"The Gurukul, a religious and educational body has under taken recharge activity under the name-Dharmjeevan Jal Sanchay Abhiyan. Motivation for starting the activity came from the Chief of the Gurukul, Swami Madhavpriyadasji, who himself visited number of villages to motivate people. The Swami has earlier traveled to a number of villages and held village meetings with Shamji Antala and other social activists to motivate villagers to adopt direct well recharge. The Gurukul had two years ago started with direct well recharge and recharge structure was built for 269 wells in 9 villages of Rajkot Taluka. 1080 sections of poly-pipe measuring 4331 feet were distributed among the farmers who wanted to build the recharge structure. The beneficiaries, with recharged wells were able to take winter crop, but as the concept did not go too well with a larger number of farmers, this activity has now been totally replaced by promotion of check dams. Bulk of the work done so far is in Amreli district followed by Rajkot and Junagarh. To date 175 CD's have been completed and 234 are planned to be build soon after the monsoon of 2000. The Gurukul's assistance to beneficiaries-village communities-is mainly in kind, i.e as cement. The total storage capacity created, when all 175+234 CD's are ready will be 80.5 MC Feet (5511 cubic meter per check dam). The activity of the Gurukul also extends to constructing/ deepening ponds, wherever feasible like in Keria-Na-Gaas (a village 5 km from Amreli town) after removing prosopis sp. locally called Ganda Baval."},{"index":2,"size":30,"text":"(prosopis initially promoted to solve the fuel wood problem of the villages, is a water guzzler, spreads very fast and is now perceived as a major problem for water recharge.)"},{"index":3,"size":55,"text":"On a much smaller scale, a number of organizations have undertaken the task of recharging the groundwater table at local levels. Some of them have done exemplary work in terms of achieving a high degree of peoples' participation. Much of this work has been done in just two years-1998 -2000. Some of these organizations are:"},{"index":4,"size":76,"text":"• Village Panchayat, Gadvadar: The village panchayat built 51 Check dams in one strokes in the 51 st year of India's independence and an obvious reaction to lack of Government effort to solve the problem even after 50 years. Village saw water collect to recharge their wells for the first time in 50 years. People's contribution was fixed at Rs. 200 per Bigha owned. Key person who motivated and spearheaded the movement is Mr. Mansukhbhai Patel."},{"index":5,"size":137,"text":"• Jambudi village 12 km from Virpur, Jetpur Taluka, presents a different kind of participation. The Government built a village pond on its own in the village in mid 80's. In 1988, the embankment of the village pond breached following heavy rains, villagers saw the embankment slowly give in but made no efforts whatsoever to save it simply because they did not identify the pond as their own. The Breach resulted in the embankment give way flooding the entire village causing extensive damage to houses and property. Last year, in a similar situation following the cyclone, the villagers saved the pond from breach working in heavy rain throughout the night facing the cyclonic storm by widening the weir to let off excess water. This was after the management of the pond was transferred to the village community."}]},{"head":"Government of Gujarat in Water Conservation through Check Dams","index":12,"paragraphs":[]},{"head":"Sardar Patel Participatory Water Conservation Project, (SPPWCP) in Saurastra:","index":13,"paragraphs":[{"index":1,"size":236,"text":"It was in response to this popular public perception that the government of Gujarat responded by launching the SPPWCP on 17 th January 2000. It also became apparent, in wake of the draught of 1999, (when out of the total storage capacity of 2200 MCM in 113 dams in Saurastra region, only 140 MCM of water was received) that a quicker solution to the recurring problem lies in adopting a participatory approach to rain water harvesting and ground water recharge. The accumulated water in the dams in 1999 was not adequate even for drinking, leave alone irrigation. This was perceived as the worst ever situation in the last 10 years. Emigration of livestock and humans appeared a certainty. The Government had to respond on a war footing with organizing water movement to villages and towns for drinking purposes by road tankers and rail. What however saved the day in places that suffered the most in the past was the infrastructure built by the people on their own during the last two years. More than 1000 people had visited Khopada, RS and other places, seen for themselves what their own collective effort can do-and do it better and faster and in their own small way had initiated a process that was soon to culminate, with government support under the SPPWCP, into the most notable sustainable development effort undertaken with people's participation in such a short time anywhere."},{"index":2,"size":203,"text":"The Government, after having failed in the last two years to attract the attention of public institutions/NGO's to avail of the 90% subsidy for building check dams (only 200 were build over a two year period), decided to reduce the subsidy to 60%. It simplified the procedures for approval and release of funds, empowered the engineers down the line to approve the projects, organize survey of completed projects by private survey agencies, and recommend release of 60% government contribution. In the process, the average cost of the CD came down from 5 lakhs to 2 lakhs, as the contribution of the village very often in terms of locally available materials and labor resulted in considerable savings 6 . Gauging the public response to the scheme, cement companies reduced the price of cement from Rs 125 per bag and fixed it at Rs. 105/per bag delivered at site. It all happened after Mathurbhai Sevani, Chairman of SJT successfully negotiated a delivered at site price of Rs 105 per bag with Ambuja cement and purchased 300,000 bags for the purpose. Other companies like L&T soon followed suit. Now all the cement companies have decided to support the popular movement by supplying cement at this price."},{"index":3,"size":50,"text":"So strong was the public response to the simplified scheme-despite its lower subsidy that in a short span of seven months (17.August 2000). 9875 check dams were built, while another 1224 were in progress in Saurastra. Most of these projects have been implemented through NGO's, Voluntary organizations, religious/ spiritual bodies/"},{"index":4,"size":155,"text":"6 The Secretary, Irrigation department to the Government of Gujarat, in a personal interview explained that, the cost of labor, overheads, and the contractor's profit, in a normal procedure cost as much as 30%. When the communities execute the projects directly, they use locally available materials like sand and stone and that further brings down the cost. Reduction of GOG contribution therefore was well planned and since the village communities had to contribute no more than locally available free materials and labor, the program received such a massive response, than the earlier 90:10 scheme, where the villagers had nothing much to contribute. The earlier scheme therefore did not give them a sense of ownership. That seemed to be a major reason for the failure of the earlier scheme, despite a higher proportion of subsidy. It makes one thing very clear. The villagers are looking for ownership of the resources, and not cheap funds or subsidies."},{"index":5,"size":27,"text":"local leaders etc. The beneficiaries have contributed 40 % of the cost either as labor, cash contribution (Lok Phada) or locally available materials like sand, and stone."},{"index":6,"size":71,"text":"At many places private initiative of farmers, to get advantage of the GOG's 60:40 scheme has also resulted in CD's getting built. E.g. at GalKotdi village in Babra Taluka of Amreli, 2 brothers who own land on either side of the road have build a small CD. Such structures, after survey by an approved agency, are reimbursed 60 % of the construction cost by the government as per the approved formula/scheme."},{"index":7,"size":71,"text":"To sum up, the popular movement for groundwater recharge, as a coping mechanism to draught, and to meet the needs of drinking water and irrigation have gained unstoppable momentum. It now seems probable that in the coming couple of years, the popular movement will result in dotting the entire Saurastra region with over 35000 check dams, percolation tanks, recharge wells, renovated and deepened existing tanks, and other structures for water recharge."}]},{"head":"Measuring the extent of ground water recharge","index":14,"paragraphs":[{"index":1,"size":288,"text":"As for many of the structures built it is the first ever experience to receive the rainwater; actual extent of recharge cannot be precisely arrived at. However based on the estimated recharge, the estimated number of wells that will get recharged due to the structures built to date is as given in table below: * According to Shamji Antala, an estimated 350000 wells (out of 700000 in Saurastra) now have recharge structures. Swadhyay partiwar on the other hand places the exact number at 98470-where they have been directly involved. No agency other than the SP has worked on a scale so large to build the recharge structures. Antala's estimate is not supported by hard data yet he believes that there is a fairly large number outside the SP ambit that has on its own build structures for rainwater harvest and recharge. Assuming that the 'others' have build some where close to 20 % of SP's numbers and includes the work of NGO's, Swaminarayan etc, the total structures work out to 118164, say 118200. I treat this numbers as safe for calculating the water recharge potential. ** Estimated number of all the trusts / voluntary organizations, built outside the SPPWPC. # Saurastra Jaldhara Trust and Sardar Patel Jal Sanchay Abhiyan Trust are mainly in motivating the villagers to take advantage of the Government's participatory scheme. They are not able to segregate the number they have fully funded through supply of cement out of their own funds. This is an estimate based on figures provided by various agencies on phone. *** Includes only CD's built in collaboration with NGO's, religious and charitable trusts after the launch of the scheme. These figures are from the official progress report as on 17.8.2000."}]},{"head":"Parameters to estimate the well recharge","index":15,"paragraphs":[{"index":1,"size":191,"text":"• In case of direct well recharge structures, with 20\"of rain and four fillings in a season, an estimated 300,000 liters of water goes in the well or 300 cubic meters equivalent. • Each check dam recharges 8-10 wells, depending upon the spread of wells in the command and the command under each check dam. Normally a check dam recharges water table and wells within 2.25 Square km around it, However, wherever the check dams have been built in a series barely 500 meters apart, which has been the pattern in most cases where seasonal streams and recently dug new trenches/ canals have been used to build a series of check dams, the command gets reduced to 1.5 Sq. km. The advantage, however is that even with a rainfall as low as 100 mm, the surface run off gets collected in the CD's and recharge starts almost immediately thereafter. The average storage of a check dam is taken at 5500 cubic meters, based on the figures provided by the Swaminarayan gurukul for the Check Dams they have built. • A recharged well stores enough water to irrigate 8 acres of land."},{"index":2,"size":72,"text":"Based on the above parameters, it is estimated that the work done so far has created potential to recharge, either directly or through water table recharge, 270190 wells. This is approximately 40% of all open wells. The irrigation potential created is for 2.43 million acres. Even if the rainfall between 8-10 inches takes place to cause adequate surface runoff. This water shall be in addition to the normal recharge from natural percolation."}]},{"head":"Groundwater Recharge Movement in North Gujarat","index":16,"paragraphs":[{"index":1,"size":130,"text":"Popular response to water recharge movement in North Gujarat has however not been on the scale as large as Saurastra. North Gujarat region comprising the districts of Banaskantha, Sabarkantha and Mehsana also receives around 700 mm rainfall and is water scarce. Banaskantha and Sabarkantha, as the name implies are the basin area of the Banas and Sabar rivers whose catchments extend to the neighboring state of Rajasthan. Dams built on these two rivers brought canal irrigation to some parts these two districts. Mehsana on the other hand does not have a perennial river. Sabar and Banas rivers however flow through the eastern and western boundaries of the district, so the northeastern and northwestern parts of the district are irrigated on a limited scale by the dams built on these rivers."},{"index":2,"size":111,"text":"Mehsana is an intensively cropped district. There has been a steady increase in the use of ground water for irrigation in north Gujarat in general and in Mehsana in particular. In most villages of the district, not serviced by canal network, there are on an average 100 to 150 Deep tube wells. The water table is receding at an alarming rate of 2 columns or 20 feet annually and the farmers have to lower column pipe in the bore wells by that much depth each year. It is estimated that 10 to 15% of the tube wells that were 300-500 feet deep, have become dysfunctional on account of receding water table."},{"index":3,"size":273,"text":"For the entire north Gujarat well irrigation 7 continues to be the most vital accounting for over 95% of the net irrigated area. Though at present, ground water depletion by DTW's is not as serious a problem in Banas and Sabar, intensive irrigated agriculture in these areas with ground water (farmers cultivating rice in kharif and wheat in winter) may soon create a situation similar to that of Mehsana. Failed Monsoons in North Gujarat resulted in all the three districts suffering from severe draught in the last decade for four out of last 5 years when over 85% of villages (in the three districts) were affected. 8 Ground water recharge activity through popular participation is relatively new in North Gujarat. Its scale is also limited due to the geo-hydrological features of the area. Most part of the region is a flat terrain with sandy loam soil. The hard rock strata are very deep-and is not reached even when DTW's are bored at a depth of over 1000 feet. There are however three aquifers at a depth of 70-150 feet, 200-300 feet and 400-600 feet. All the three-aquifer layers have been over exploited and the newer bores are being done at a depth exceeding 1000 feet. Farmers also drill new bores close to the existing failed bores, if they are unable to lower the column pipe any further. Gradually the diameter of the casing and the column pipes currently in use has increased to 10\" and 5\" respectively. The idea of the farmers is to use 48-52 HP motors and draw as much water as they can from as deep a strata as possible. "}]},{"head":"Organizations in water recharge","index":17,"paragraphs":[]},{"head":"1.Swadhyay Pariwar","index":18,"paragraphs":[{"index":1,"size":141,"text":"The realization following this massive over exploitation and the knowledge of the work done in Saurastra prompted some Swadhyay Pariwar 9 members to try and popularize direct well recharge. This has been attempted on a limited scale through village meetings and other normal awareness activities of the SP. The beginning made by building collection cum filter pits, on open community wells as a demonstration for others to follow has not met with a popular public response for large-scale replication. Individual farmers feel that since the underground strata is sandy, there is no guarantee that the benefit of their effort will accrue to them. Moreover the geohydrology of the region and the location of wells/ Bores on the farms at an elevation seems to have created doubts in the minds of the farmers about the economy and efficacy of the method. 10"},{"index":2,"size":87,"text":"The focus of SP's work in north Gujarat has been more on drinking water and water for domestic use. They believe that 80% of the water used for domestic purposes is recharged, and if it can be collected near the use point in what is termed as the \" Sokh Khada\" or Soak pit lined with stone, gravel and sand filter, it will allow only the clean water to get into the aquifers. This practice is being promoted on bigger villages having approximately 500 or more households."}]},{"head":"2.The MotiBhai R Chaudhary Foundation, (MRCF)","index":19,"paragraphs":[{"index":1,"size":57,"text":"MRCF is perhaps the only organization that has taken up water recharge activity, to begin with, in Mehsana district of north Gujarat on any appreciable scale. The trust registered on 10 February 1997, as a public trust under the Bombay Public trust act of 1950, has among other things water conservation as one of the main objectives."},{"index":2,"size":56,"text":"Regarding water its objectives state, \" to collect and conserve rain water, recharge groundwater resources by deepening ponds, using dysfunctional wells/bore wells to recharge the ground water table with rain water, to make recharge bores in ponds and, to promote judicious use of ground water, to improve water quality and to improve the irrigation methods etc\""},{"index":3,"size":66,"text":"9 The Swadhyay movement, better known as Yogeshwar pariwar in North Gujarat has a well-organized set up. For example, in Mehsana, there are 16 sub areas with a person responsible to organize the activities. They organize village meetings of all SP members and others from the village to discuss the common problems and find solutions. More important on their agenda is the problem of drinking water."},{"index":4,"size":225,"text":"That is how their work on well recharge is more on common wells and is not as visible as that in Saurastra. Moreover, all the water that gets into a recharge well gets promptly soaked into the earth due to sandy nature of the soil. This may be one strong reason for not many individuals' farmers responding enthusiastically to direct well recharge. Whereas Saurastra farmers are sure of getting back almost all the water that gets into the well for self use, farmers of north Gujarat feel that the benefit of their effort may not be available to them at all. Moreover all the wells and bores that can potentially be recharged are situated at a higher spot on the farm to take advantage of gravity flow. Using them for recharge would mean reversing the slope of the land, and creating gravel filled column outside casing pipe for the recharge. This probably, being an expensive proposition does not appeal to a large majority. 10 Ashwin Patel, a farmer from Jagudan village of Mehsana taluka, also an employee of the Mehsana oil union (MDTS) who works in the farmer's organization division feels that there is tremendous scope to recharge the defunct bores by removing the column pipes and using the casing for recharge. The location of the bores however has to be suitable for the purpose."},{"index":5,"size":45,"text":"The Trust 11 has used its corpus to acquire earth-moving equipment to undertake mainly two activities. One, de-silting of existing ponds/ making new ponds wherever feasible; two, strengthening the embankments of existing ponds. At present they have 5-bucket excavators (JCB) and 11 tractors with trolleys."}]},{"head":"Ponds deepening:","index":20,"paragraphs":[{"index":1,"size":110,"text":"The MR Foundation has, since inception repaired and de-silted 40 village ponds. Since this work can be done only after the monsoon season, work in another 15 villages -equivalent to about one year's work with the resources currently available is yet to be undertaken. The modus operandi is that the village wanting to deepen the well has to contribute 20% of the estimated cost of the work (at Foundation rates) with the foundation. In many cases the 10% fund is contributed by the constituency's Member of Legislative Assembly (MLA) from his constituency development fund or by the MRCF. The balance is borne by the Gujarat Water Resources Development Corporation (GWRDC)."}]},{"head":"Well recharge:","index":21,"paragraphs":[{"index":1,"size":88,"text":"The MRF has drilled 13, 200 feet deep recharge bores in tanks with collection pits measuring 20' x 20' x 20' to collect rainwater. The foundation also supplies, free of charge to the individual farmers willing to build a recharge structure with collection filter pit of dimensions 5' x 5' x 5' at their own cost, pipes to recharge failed bores, provided they are no deeper than 300 feet. The cost of doing the filter pit and laying the pipe is required to be borne by the farmer."},{"index":2,"size":39,"text":"The work done by the MRCF has attracted the attention of many other charitable organizations both National and International. Though they themselves are not directly involved in water recharge movement, they have offered support to the MRF. These are:"},{"index":3,"size":54,"text":"1. L.D Jhaveri Foundation, Kobe, Japan. This foundation comprising mainly of Jain community based in Japan has supported the MRF with funds @ Rs. 100 per hour of work executed by them for water recharge in Gujarat and Rajasthan. Their support has been for 15 village ponds so far and more support is promised."},{"index":4,"size":25,"text":"2. Sachhidanand Samaj Seva Trust, Unjha (Banskantha district): This trust too is involved in pond deepening and de-silting. They have I JVB and 6 Tractors."},{"index":5,"size":20,"text":"They have so far deepened 7 ponds and charge Rs, 500 per hour. The SSST has offered equipment to MRF."},{"index":6,"size":204,"text":"11 Motibhai Chaudhry, Chairman of the Mehsana District Cooperative Milk Producer's Union Ltd. since October 1970 was presented a purse of Rs. 11.0 million (equal to one days milk payment) by 1055 Village milk producer's cooperative societies (VDC) that are member of MDCMPU Ltd On his 75 th birth day. Another Rs 8 million was collected as advertisement fund from VDC for the souvenir published on the occasion. The entire fund has been used to purchase two sets of earth moving equipment -1 JCB and 6 tractors with trolleys. The set is rented out to the villages that want to use it to deepen the village pond, build a new pond or strengthen the embankment at Rs 350/-per hour. The hiring party has to deposit Rs 35000 for 100 hours, the minimum time it takes to complete the work. The trust usually hires out the set for a maximum of 200 hrs. The effective rate of excavation works out to Rs 6.20 per CM, against the minimum rate of Rs 26.35 charged by the public sector Gujarat Water Resources Development Corporation. (GWRDC). The objective of the trust is to cover only the cost of fuel and lubricants etc. as contribution from the beneficiaries-the village."},{"index":7,"size":49,"text":"In short, in north Gujarat, between MRCF and the SSST 48 ponds have either been de-silted/ deepened/ embankment strengthened. And only about 20 recharge bores made by all the agencies put together. The topography and geo-hydrology is more suited for working on ponds as water collection and recharge structures."}]},{"head":"The SPPWPC in North Gujarat","index":22,"paragraphs":[{"index":1,"size":112,"text":"The response to the scheme in North Gujarat has been very limited 12 . Only in Sabarkantha district, upto 17 August 2000, 70 Check dams were completed and other 40 were in progress. None were undertaken in Banaskantha and Mehsana, even though, the examples of Khopada and Dudhada, (where on a flat topography water harvesting structures have been built by converting the cart tracks into canals) are well known all over Gujarat. The poor response to the scheme may be for a variety of reasons including the geo-hydrology and the feeling among the individual farmers that the water can be endlessly drawn from the depths, which is not the case in Saurastra."}]},{"head":"Analysis and Conclusions","index":23,"paragraphs":[]},{"head":"People's participation: Saurastra Vs. North Gujarat:","index":24,"paragraphs":[{"index":1,"size":169,"text":"On direct well recharge, the response from north Gujarat has not been as strong as that from Saurastra. The geo-hydrology appears to be a major reason for non-adoption of direct well recharge as a means to augment natural recharge. The inherent fear of the recharged water benefiting someone else (ones own efforts not paying off) due to sandy nature of the soil can be one of the strong reasons for poor response. There cannot be any doubt with regard to the effort put in on promoting direct well recharge by the Swadhyay Pariwar in north Gujarat-they are known for their dedication and commitment to the cause-yet the momentum gained is nowhere near that in Saurastra. Whereas the north Gujarat regions has continuous aquifers that farmers have exploited to the hilt, especially in Mehsana, the saurastra region has only broken fractures. Thus the water that gets into these fractures through a well remains available to the well owner for eventual use. This however is not a surety in North Gujarat."},{"index":2,"size":158,"text":"Saurastra also has a number of voluntary agencies, religious and spiritual organizations that have come forward to lead the people in their quest fir water. By contrast, in north Gujarat, the only organization that has made a significant contribution is the MRCF. The approach for water recharge in Saurastra has relied more on the labor input from the potential beneficiaries for building the check dams and other structures. They have relied less on the funding from the Government. On the other hand, North Gujarat organizations have relied more on capital investment on heavy earth moving equipment and government funding (GWRDC) to deepen the ponds and strengthening the embankments. The time taken to complete the procedures to get funds from a government agency has slowed down the recharge movement, at the same time kept individual farmers at a distance. Moreover the resources available with organizations like the MRCF in itself is a constraint in rapidly expanding the recharge activity."}]},{"head":"Response to past experience","index":25,"paragraphs":[{"index":1,"size":128,"text":"It is obvious that the people of Saurastra have suffered more often due to failure of rains. The fast and overwhelming response to the SPPWCP in Saurastra can be attributed to this phenomenon. In fact their own initiative-work done by the Saurastra Jal Dhara Trust and others in building check dams triggered a response from the government in form of the SPPWCP. No such initiative is evident in north Gujarat. If the SJT could convert the cert tracks into canals in Khopada, Dudhada and other villages and demonstrate the efficacy of the water table recharge in Saurastra, similar work could have been tried in the flat terrain of North Gujarat as well. Yet no has one tried it. For most farmers there are no success stories to emulate."}]},{"head":"Well Recharge Vs. Water Table Recharge","index":26,"paragraphs":[{"index":1,"size":222,"text":"The two distinct approaches tried in Saurastra have had their supporters and critics. The critics of direct well recharge do not find the technique suitable for all the places, and even in places it has been tried, they express grave concern regarding the future economic life of the wells that have recharge structures. They favor water table recharge through a network of Check dams. Technical experts on the other hand do not see anything wrong in the direct well recharge, especially in areas of Rajkot and Junagarh where it has been widely accepted. The farmers have benefited, many of them have been using these wells for irrigation and protecting their crops for well over a decade. There can be no two questions regarding wider applicability of the Check dam approach, but in the initial years it was the direct well recharge that attracted the farmers attention the most. Raj Samadhiyala experiment was there as a demonstration, but it became replicable on a large scale only after the trusts promoted by the diamond merchants arrived on the scene. Obviously the whole movement is leadership driven. The leaders too drew their inspiration from TBS' work in Alwar, Rajasthan and not directly from RS. It is now clear that as the check dams increasingly become more popular, direct well recharge is taking a back seat."},{"index":2,"size":109,"text":"As yet another factor that seems to influence the choice of the technique is the speed of recharge. This season's rainfall to date provides some evidence to that. The first rains of about 4-5 inches had all the check dams in RS and other places full to the brim and the water level in the wells within the command of CDs had began to rise appreciably. On the other hand, in none of the wells with recharge structures, there had been any rise in the water level. The rainfall was not enough to saturate the topsoil and cause seepage/ surface run off good enough to permit direct well recharge."}]},{"head":"Conclusion","index":27,"paragraphs":[{"index":1,"size":81,"text":"To conclude, the most important aspect is that there is strong evidence of public consciousness towards water recharge movement in Saurastra, and over the coming years, as things are now, it should contribute significantly to coping with draught, provide answers for sustainable growth in agriculture and help solve the drinking water problem. North Gujarat on the other hand is yet to demonstrate this consciousness. MRCF in Mehsana, can possibly provide a strong basis to rapidly spread the movement in North Gujarat."}]},{"head":"Annex 1: Farmers' feedback on Well recharge","index":28,"paragraphs":[{"index":1,"size":70,"text":"This feedback is from farmers of Mandlikpur, a village near Dhoraji and the neighboring village. The village has a history of being one of the most water-starved villages. It has 150 wells; of these some 130 have now recharge structures. Now most farmers are able to cultivate 3-4 bighas (2.5 Bigha make a standard acre) of irrigated crop and claim that their average income has gone up by about 60%."},{"index":2,"size":24,"text":"Following is the feedback of some farmers in Mandlikpur and adjoining village, where the response to adoption of the technique has been very high."},{"index":3,"size":120,"text":"Gunwantbhai is a Swadhyayi and he build the recharge structure with the help of other swadhyayis 8 years ago. Cost incurred was only on the pipe as labor input from swadhyay pariwar is totally free. According to his knowledge, around Dhoraji alone 150 wells have recharge structure. He owns 25 Bighas (10 acres) of land. Last year when the rainfall in his village was only about 8-10 inches, the recharged water lasted him till end of January, enabling him harvest good crops of cotton, castor and groundnut with protective irrigation. In a year of normal rainfall-after the structure was built, he has been able to harvest wheat on half his land as the water lasts till end of March-early April."},{"index":4,"size":139,"text":"Wheat crop planted in late November needs 10-12 irrigations. About the concern of muddy water getting into the fractures and thus reducing the economic life of the well, Gunwantbhai says that, since most parts of Rajkot and Junagarh, where maximum direct well recharge work has been undertaken in the last 10 years or so, the soil is clayey. With the first showers, the loose clay particles get bound with the soil and generally the water from the first showers does not find way to the collection pit/well. Thereafter any surface runoff is usually very low on mud content. The pebble-sand filter and the gunny placed at the end of the pipe further reduce chances of any mud going into the well. He therefore does not see in such soil conditions, any danger to the economic life of the well."},{"index":5,"size":119,"text":"Chhaganbhai Bhutwad, his farm is located on Dhoraji-Jetpur road and he was one of the first adopters of the well recharging-did it 12 years ago, His well is 80' deep. He has been able to take Rabi crop from recharged well for all the years except last year. He went in for a bore well 2 years ago and last year saved his GN and Cotton crops partly with recharged water and partly with bore water. Cultivates Wheat, Onion, Garlic and other vegetables; uses drip irrigation for garlic; investment in drip Rs. 4000 per bigha (55% govt. subsidy). 2-3 hours of drip irrigation covers 15 bigha's of cotton, while flood irrigation in the same time covers only 3-4 bighas."},{"index":6,"size":41,"text":"Vithal bhai -Undala: well recharge structure built 5 years ago. Recharged water lasted till Holi (march) last season, was able to irrigate GN (2 irrigations) and wheat (12 irrigations); uses 6 Hp diesel pump-4\"D discharge, farm takes 12 hours to irrigate."},{"index":7,"size":102,"text":"Veljibhai jivrajbhai-undala has a open well, 70 feet deep, no recharge structure till last year, built one this season, water yet to come in the well as there have been no rains this season so far.. Bharatbhai Bhutwad; Bank Manager, 120 feet deep open well, did not believe in well recharging till now though his own brother built the structure 12 years ago and has benefited from it. Recently built rainwater collection pit near the roadside to collect water both from his farm and over flow from main road. However in the absence of rains, the well is yet to get recharged."}]},{"head":"Annex 2: RS as a Model for Replication","index":29,"paragraphs":[{"index":1,"size":394,"text":"Water recharging through check dams started in 1978. To date they have build 45 Check dams and causeways and 13 percolation tanks/ earthen Dams. When the first PT was built, the benefit was only to the extent of 2-3% in terms of additional water recharge over the normal. With the construction of all the 13 PT's the additional recharge increased to 10-15 % above normal. Check dams and causeways subsequently built increased the recharge to 50%. The society thereafter obtained a space imagery of the village from ISRO, identified lineaments and underground dykes with the help of ISRO scientists, which have been opened to speed up water recharge. The net result is that the water recharge has become faster in the last couple of years. Last year the rainfall was just about 8 inches, yet all the 240 wells in the command of the watershed were fully recharged and the water lasted for one full year. In the current monsoon season, with the first rain-just about 4 inches, the check dams and percolation tanks were full. Within a week the water level in the dams dropped by almost a meter-that is the extent of recharge that took place. The average recharge depth in the village is only 50 feet, and all the 240 wells have already water levels up from 25 feet-for the wells farthest from check dams and percolation tanks, and 40 feet for the wells closer to the structures. A farmer Mohanbhai Dershibhai Dabhi, who has his well located at one of the farthest points from a PT confirmed that after the first rain, the water level in his well increased by an average of 2 feet per day and after about 12 days now stands at 25 feet. His well was dry before the first rain. A dozen or so farmers contacted confirmed rise in the water level in the wells from 30-40 feet .In the village, the average dimensions of a typical well are 15' diameter and a depth of 70-80 feet. Since the recharge level is limited to 50 feet, rainfall in access of 8-10 inches does not add to further recharge of the wells within the village, but the recharge is seen in the nearby villages. They however are not able to give the number of wells that benefit from recharge outside RS due to efforts of RS."},{"index":2,"size":60,"text":"The Panchayat has not made an estimate of the area of command of each check dam. All the check dams/causeways are built to cover the entire length of 4.5 km of the stream. The stream has an average width of 30 feet and the average depth is only 2 feet (higher depth-about 2 meters at the point of check dam)."},{"index":3,"size":140,"text":"The village has experimented with a DTW-depth 1000 feet. The discharge of DTW after March is of hot water -temp 40 degrees Celsius. However in the post monsoon period, the DTW yields sweet water that the village uses for drinking purposes. RS realizes that DTWs are not a viable solution for the village, and do not want to experiment with new ones. Most villagers-after having seen the space imagery can now easily identify underground dykes-these spots remain 'hot' even during winterand lineaments, and share this knowledge and experience with other neighboring villages so that they can also open them and speed up the recharge process. People of RS are confident that even if the rains in the coming months fail, the recharge level is sufficient to see them through with the water needs of the entire village for one year."},{"index":4,"size":104,"text":"The impact of recharge on environment has been very positive. The panchayat has focused on making the entire village conscious towards environment. The eleven-member village panchayat, under the leadership of Hardev sinh Jadeja, has framed its own rules to govern the village. Heavy fines are imposed on person damaging a tree or polluting the environment. There were only 1600 trees in the village in 1978. At the end of 1999, there were 50000 trees. Most of the new plantation is that of fruit trees on the land of farmers. They plan to have 100,000 trees by 2002-turning RS into the greenest village of India."},{"index":5,"size":65,"text":"The seepage from the largest PT recharges one of the three drinking water wells of the village. The well with a diameter of 20 feet is 80 feet deep, and begins to get seepage soon after the first rain. There was about 65 feet of water in the well at the time of visit-a net rise of about 40 feet from the pre monsoon level."},{"index":6,"size":41,"text":"The total investment over 20 years has been 20.6 million. Of this 13.0 million has been on building the Percolation Tanks. Another 6 million have been invested in building the CD/Causeways, and 0.6 million on opening the lineaments and underground dykes."},{"index":7,"size":110,"text":"The total area of the village is 2000 acres. Private area to the tune of 250 acres got submerged due to construction of percolation tanks and C/D's. This is a willing contribution of the villagers since the increase in irrigation potential and, crop output more than compensated the loss in terms of land lost. Now they are able to cultivate irrigated Bajra, Jowar, GN and Cotton and vegetables. Jadeja himself sold Tomatoes worth 0.5 million last year. No sugarcane cultivation is permitted. Village income last year from irrigated agriculture was more than the neighboring village (Without irrigation) by 25million. Raj Samadhiyala has now helped 15 neighboring villages build 200 CD's."}]}],"figures":[{"text":"Table : Estimated Water recharge and irrigation potential created:   Estimated Number Water collection Wells to get Irrigation Potential in 000 Estimated NumberWater collectionWells to getIrrigation Potential in 000   Of structures potential MCM recharge acres @ 8 acres per well Of structurespotential MCMrechargeacres @ 8 acres per well Direct recharge * Check Dams well 118200 4100 35.46 22.55 118200 41000 # 945.60 598.19 Direct recharge * Check Dams well118200 410035.46 22.55118200 41000 #945.60 598.19 by trusts ** private    by trusts **private Check Dams 9875 +1224 (in 61.04 110990 887.92 Check Dams9875 +1224 (in61.04110990887.92 under SPPWCP *** progress)   under SPPWCP ***progress) Total   119.04 270190 2431.71 Total119.042701902431.71  "}],"sieverID":"7ebda149-b909-42e7-8da8-67a7e1a76859","abstract":""}

data/part_2/039e05f4d2f6f06dfd89ecc9f19c4b91.json

@@ -0,0 +1 @@
+{"metadata":{"id":"039e05f4d2f6f06dfd89ecc9f19c4b91","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8c243780-23f5-43e8-b64d-a0bf3593c26b/retrieve"},"pageCount":31,"title":"","keywords":[],"chapters":[{"head":"Summary","index":1,"paragraphs":[{"index":1,"size":80,"text":"In Vietnam, pork accounts for 75% of meat consumed, with its production delivering substantial benefits to the smallholders who supply 84% of the market. However, as previous research by the International Livestock Research Institute (ILRI) has found, pork in Vietnam is often contaminated with microbes or chemicals. This is an issue of growing concern among policymakers and the public: not only are the health impacts unknown but concern over food safety may also act as a constraint to smallholder production."},{"index":2,"size":97,"text":"In light of this, the Australian Centre for International Agricultural Research (ACIAR) is funding a new ILRI-led project on reducing risk in Vietnam's smallholder pig value chain. The project, Reducing pig diseases and improving food safety in smallholder pig value chains in Vietnam (abbreviated 'PigRisk' in this report) is led by ILRI in collaboration with the Hanoi School of Public Health (HSPH) and the Hanoi University of Agriculture (HUA). This new project builds on the findings of previous research by ILRI on improving competitiveness of pig producers in an adjusting market in Vietnam, also funded by ACIAR."},{"index":3,"size":71,"text":"The project inception meeting was held in Hanoi, Vietnam on 12-14 August 2012. It was an opportunity to present the project as well as the concepts of risk and risk management to a wide range of stakeholders in Vietnam including government ministry representatives, development practitioners, scientists, private-sector stakeholders and researchers from the areas of animal health, public health, economics and ecology. The project was introduced and discussed at length by participants."},{"index":4,"size":83,"text":"Facilitated by project team members from ILRI and primary project partners from HSPH and HUA, the workshop introduced participants to the key research areas of the project:  Assessing the human and economic costs of pork-borne diseases in smallholder pig value chains  The adoption of 'risk-based' approaches to food safety and pork-borne diseases as opposed to the currently applied 'hazard-based' approaches  Incentive-based innovation as a means of improving the management of human and animal health risks in smallholder pig value chains"},{"index":5,"size":44,"text":"Resulting participant discussion centralized upon the crucial distinction between 'risk' and 'hazards', and how this affects decision making, at both consumer and policy-making levels. Exploring the concept of incentive-based approaches in improving human and animal health management also elicited strong interest from workshop participants."},{"index":6,"size":77,"text":"Also in attendance at the workshop was the ILRI director general, Jimmy Smith, who highlighted the ongoing challenge of food scarcity and high food prices, and the importance of Southeast Asia in ILRI's research agenda. Smith also reiterated the significant role of livestock smallholders in responding to this challenge and how projects such as this are vital in providing the support smallholders require to adequately supply affordable and safe food to the market to meet consumer demand."},{"index":7,"size":185,"text":"Report by Delia Grace, Andrew Nguyen and the project team Editing and formatting by Tezira Lore and Rosekellen Njiru (ILRI) Jimmy Smith, director general, ILRI Smith began by highlighting the challenge we all face as a result of the food price crisis, noting that there is an ongoing concern about how the world will feed itself. Smallholders are an essential part of the food supply system and should not be forgotten as they can produce food that is both safe and wholesome. The general impression, however, is that the food sold by smallholders in informal markets is not as safe as that sold in conventional markets. This project aims to demonstrate that informal food markets are safe and that they can be safer. The project also aims, from an ILRI perspective, to provide research evidence to the notion that smallholders can contribute to the global and national food supply system. To achieve this, we need to help increase their productivity and make their products safer. As a relatively small institution, we are always looking to build and strengthen greater partnerships to achieve our common goals."}]},{"head":"Le Vu Anh (HSPH) and Tran Duc Vien (HUA)","index":2,"paragraphs":[{"index":1,"size":53,"text":"In Vietnam, pig production is the main livestock activity. Pig diseases in Vietnam are a big concern for not only consumers but also for the Vietnamese government. This project will contribute not only in terms of capacity building, but also by responding to the concerns of both the Vietnamese government and Vietnamese households."}]},{"head":"Geoff Morris, ACIAR Vietnam country representative","index":3,"paragraphs":[{"index":1,"size":67,"text":"The previous ACIAR-funded, ILRI-led project, Improving the competitiveness of pig producers in an adjusting Vietnam market, demonstrated that smallholders provide an important contribution to the market and will continue to do so in the foreseeable future. However, the project also highlighted the risks associated with their market position. This new project fits into two key ACIAR areas of focus for Vietnam: sustainable food production and smallholder sustainability."},{"index":2,"size":65,"text":"The project will also help ACIAR understand how to better target pro-poor projects. Industrialization in Vietnam is not a reality in the short to medium term, so it is important that we continue to look at how smallholders can continue to be supported. Morris stressed the importance of partnership and that it was not merely restricted to the three implementing institutes (ILRI, HSPH and HUA)."}]},{"head":"Overview of the PigRisk project","index":4,"paragraphs":[]},{"head":"Goal of PigRisk","index":5,"paragraphs":[{"index":1,"size":31,"text":"To improve the livelihoods of the rural and urban poor in Vietnam through improved opportunities and incomes from pig value chains as a result of reduced risks associated with pork-borne diseases."}]},{"head":"Objectives of PigRisk","index":6,"paragraphs":[{"index":1,"size":66,"text":" To assess impacts of pork-borne diseases on human health and the livestock sector and identify critical control points or opportunities for risk management.  To develop and test incentive-based innovations to improve management of human and animal health risks in smallholder pig value chains.  To sustainably improve capacity to assess and manage risks to smallholder pig value chains by engaging smallholders and co-generating evidence. "}]},{"head":"Framework of PigRisk","index":7,"paragraphs":[]},{"head":"Presentations on key learning from previous research","index":8,"paragraphs":[{"index":1,"size":8,"text":"What have we learned about smallholder systems? 1"},{"index":2,"size":4,"text":"Dr Tom Randolph, ILRI"},{"index":3,"size":13,"text":"The new challenge: how to ensure access to animal source food in 2050?"},{"index":4,"size":131,"text":" Nearly everyone consumes some animal-source food in their diet  Animal-source foods are dense sources of critical high-quality nutrients  Nearly a billion people rely on livestock and aquaculture in small-scale production and marketing systems for their livelihoods  Livestock development often viewed as an opportunity to reduce poverty and enhance food security  Industrial systems will provide a large part of the needed increase in supply to cities and the better-off in some places  But the poor will often continue to rely on small-scale production and marketing systems  For example, informal raw milk markets handle over 80% of milk sold in East Africa and India  Therefore, smallholder production could contribute, by both increasing supplies and reducing poverty, and better manage the transition for many smallholder households"}]},{"head":"Managing the transition of smallholders out of agriculture","index":9,"paragraphs":[{"index":1,"size":72,"text":"Various estimates for smallholders in Africa and Latin America (Dorward 2009; Wiggins 2012)  One third will 'step up' to become commercial farmers  One third will 'step out' and work for others or go to cities  One third could go either way Could two-thirds of smallholders be enabled to develop into commercial producers, accumulate capital and transition out of agriculture, and so drive stronger economic growth and avoid social disruption?"},{"index":2,"size":116,"text":"To enable agriculture we must fix productivity gaps In some cases these concerns are well justified, in others they are not  Only 4% of consumers in Vietnam reported gastro-intestinal illness in the previous 2 weeks (and there was no relation with pork or meat consumption)  More than double this number of consumers in Nigeria reported illness in the previous 2 weeks (and there was a strong relation with meat consumption)  As many as 23% of consumers in Nagaland reported illness (no relation with pork, meat or vegetable consumption but strongly related with hygiene)  A shocking 43% of Nigerian butchers reported illness (strongly related to group, gender, hygienic practice and eating own products)"},{"index":3,"size":43,"text":"And findings are often counter-intuitive  In Hanoi, supermarket pork had more faecal bacteria than wet-market pork  In India and Kenya, more formal sector milk failed to meet standards  In Uganda, farmers who were more visited by authorities had worse milk"}]},{"head":"HIGH LEVELS OF HAZARDS MAY NOT RESULT IN HIGH LEVELS OF RISK WE CANNOT ASSUME RISK; WE HAVE TO ASSESS IT","index":10,"paragraphs":[{"index":1,"size":89,"text":"Fortunately, improvements in food safety can be feasible, effective and affordable  Branding and certification of milk vendors in Kenya: led to improved milk safety and saved economy USD 33 million.  Peer training, branding, innovation for Nigerian butchers led to 20% more meat samples meeting standards and cost $9 per butcher but resulted in savings USD 780/per butcher per year from reduced COI.  Providing information on rational drug use to farmers, led to a four-fold increase in knowledge, two-fold increase in practice and 50% decrease in disease."}]},{"head":"What we have learned from previous research in Vietnam 3","index":11,"paragraphs":[{"index":1,"size":4,"text":"Dr Lucy Lapar, ILRI"},{"index":2,"size":10,"text":"Pork accounts for 40% of meat expenditure by Vietnamese households"},{"index":3,"size":53,"text":"The previous study found among consumers  A strong preference for fresh pork over chilled or frozen pork  Tendency towards preferring lean meat: 75% prefer lean meat whereas in the past, fat meat was preferred  Wet markets are strongly preferred: 97% purchase pork from permanent open markets or traditional temporary outlets"},{"index":4,"size":314,"text":"The previous study found for producers  Most (80%) pork comes from household farms  Household-based production can generate gross margins of USD 0.2-0.8 per kg live weight pig produced  Farms are getting bigger but 56% of farms keep two or fewer pigs  Small farmers can reduce costs by using own-produced feed The previous study found the following benefits for small-scale pig production  Pigs contribute 14% of rural household income or 24% of income from agriculture  Each 100 kg of live pig generates USD 62 in added value along the value chain  Producers receive 56-65% of the retail price of pork  Smallholder pig production generates employment estimated at about 4 million full-time workers along the pork supply chain, valued at about USD 3.3 billion or approximately 5.5% of Vietnam's GDP in 2007  Women's labour accounts for at least half of total labour days in household pig production Concerns about food safety  Nearly half the consumers (43%) had concerns about pork.  The most common concern was fear of disease from pork, followed by fear of chemical contamination, un-fresh pork and bad smell.  Only 1% expressed nutritional concerns. In response to a pig disease outbreak, 87% of consumers in Hanoi reduced consumption Economic models suggest large-scale producers will supply 5-12% of pork in 10 years Conclusions  Smallholder pig producers are competitive in producing pork that meets the demand requirements of Vietnam's fresh meat market.  Household pig producers are able to generate incomes from pig raising by exploiting areas where they have cost advantage.  Expanding options for own-produced feeds, in terms of choices and quality, can enhance smallholders' competitiveness, particularly in areas that are far from commercial feed sources, and complemented with improved access to extension.  Limitations in available land and household labour will be constraints to scaling up by household pig producers."}]},{"head":"Presentations on key aspects of the project","index":12,"paragraphs":[]},{"head":"Risk assessment in pork 4","index":13,"paragraphs":[{"index":1,"size":5,"text":"Dr Nguyen Viet Hung (HSPH)"}]},{"head":"Animal health assessment (including zoonoses) in smallholder pig value chains 5","index":14,"paragraphs":[{"index":1,"size":4,"text":"Dr Fred Unger (ILRI)"}]},{"head":"Economic assessment of disease risks in pig value chains 6","index":15,"paragraphs":[{"index":1,"size":5,"text":"Dr Pham Van Hung (HUA)"},{"index":2,"size":9,"text":"Testing innovative intervention with randomized control trial (RCT) 7"}]},{"head":"Dr Hoang Van Minh (Hanoi Medical University)","index":16,"paragraphs":[{"index":1,"size":11,"text":"From research outputs to outcome to impact: Mapping the impact pathway"}]},{"head":"Mapping the impact pathway 8","index":17,"paragraphs":[{"index":1,"size":3,"text":"Dr Steve Staal"}]},{"head":"Group exercise on Outcome Mapping","index":18,"paragraphs":[{"index":1,"size":28,"text":"Hung Nguyen-Viet (HSPH) posed the following question: How will evidence from this project be used by three important groups of stakeholders: development organizations, policymakers and the private sector?"},{"index":2,"size":50,"text":"Group 1: Development organizations Evidence would be used in communicating to stakeholders in order to influence changes in knowledge, attitude and behaviour. The communication process should involve all stakeholders, especially those along the value chain. This would lead to an increase in ownership, awareness, and a greater contribution to impacts."},{"index":3,"size":31,"text":"Intervention would also be decided using evidence generated by this research. Such an intervention was expected to minimize risk for human and animal health, as well as any other economic risks."},{"index":4,"size":43,"text":"Group 2: The private sector The group understood the evidence of this research as knowledge of risks along the value chain. The outputs would help in problem identification. Once communicated to the targeted stakeholder, this process would influence changes in attitude and behaviour."},{"index":5,"size":47,"text":"The evidence should be packaged appropriately for specific audiences. For stakeholders in the private sector, a communication strategy should be devised with a convincing incentive-based approach, with a clear cost-benefit analysis. This should be more likely to be adopted vis-á-vis affecting desirable changes in attitude and behaviour."},{"index":6,"size":57,"text":"Use of evidence in training for the stakeholders, especially regarding risks and hazards points in the value chain, was always a good basis for attitude and behaviour changes. The training should be provided without charge by development organizations or government bodies. Integrating knowledge from the research in university courses would be another effective way of knowledge transfer."},{"index":7,"size":26,"text":"Further strategies to utilize evidence for the benefit of the private sector might involve improved communication to boost trust among consumers on products from the smallholders."}]},{"head":"Group 3: Policymakers","index":19,"paragraphs":[{"index":1,"size":85,"text":"The group reflected upon the policymaking process: proposal making at district/provincial levels, pilot models in the area of concern and MARD or national level assessments of the piloted model. Impacts in terms of policy changes would not occur in a short term. However, evidence should be communicated through diverse and broad channels. Introducing the evidence in postgraduate courses would be beneficial since most of the students in such courses would eventually work in government units, and thus have a higher chance to communicate to policymakers."}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Presentations on key aspects of the project Dr Tom Randolph (ILRI), director of the CGIAR Research Program on Livestock and Fish  What we have learned about disease risks and food safety: Dr Delia Grace (ILRI), leader of the agriculture-associated diseases theme of the CGIAR Research Program on Agriculture for Nutrition and Health  What we have learned from previous research in Vietnam and the rationale and objectives of the new project: Dr Lucy Lapar, agricultural economist, ILRI Workshop agenda Workshop agenda Introductions Introductions  Representative from the Ministry of Agriculture and Rural Development  Representative from the Ministry of Agriculture and Rural Development  Dr Jimmy Smith, Director General, ILRI  Dr Jimmy Smith, Director General, ILRI  Mr Geoff Morris, Country Program Manager, ACIAR  Mr Geoff Morris, Country Program Manager, ACIAR  Dr Le Vu Anh, Dean, HSPH  Dr Le Vu Anh, Dean, HSPH  Dr Tran Duc Vien, Rector, HUA  Dr Tran Duc Vien, Rector, HUA Presentations on key learning from previous research Presentations on key learning from previous research  Risk assessment in pork: Dr Nguyen Viet Hung, HSPH  Risk assessment in pork: Dr Nguyen Viet Hung, HSPH  Animal health assessment (including zoonoses) in smallholder pig value chains: Dr Fred Unger,  Animal health assessment (including zoonoses) in smallholder pig value chains: Dr Fred Unger, veterinary epidemiologist, ILRI veterinary epidemiologist, ILRI  Economic assessment of disease risks in pig value chains: Dr Pham Van Hung, HUA  Economic assessment of disease risks in pig value chains: Dr Pham Van Hung, HUA  Testing innovative intervention with randomized controlled trial (RCT): Dr Hoang Van Minh, Hanoi  Testing innovative intervention with randomized controlled trial (RCT): Dr Hoang Van Minh, Hanoi Medical University Medical University  "},{"text":"From research outputs to outcome to impact: Mapping the impact pathway  Mapping the impact pathway: Dr Steve Staal, director of the Markets, Gender and Livelihoods Theme, ILRI  Expected impacts of the project: Dr Nguyen Viet Hung (HSPH) and Dr. Pham Van Hung (HUA)  Group exercise on Outcome Mapping: Facilitated by Korapin Tohtubtiang, monitoring and evaluation and operational support, EcoZD project (ILRI) and Rainer Assé, researcher, social sciences and natural resource management (ILRI) Feedback from ILRI partners and stakeholders Wrap up and closing remarks Opening remarks  Nguyen Viet Hai, deputy director general of the Ministry of Agriculture and Rural Development (MARD) Nguyen Viet Hai, deputy director general of the Ministry of Agriculture and Rural Development (MARD) Vietnam is still very much an agricultural country. The main challenges that the MARD identifies are Vietnam is still very much an agricultural country. The main challenges that the MARD identifies are low productivity from livestock rearing in terms of output per unit and quality of products across low productivity from livestock rearing in terms of output per unit and quality of products across the market. Stressing the importance of importance of research, he noted that USD1 of agricultural the market. Stressing the importance of importance of research, he noted that USD1 of agricultural research here can provide a return of USD 40. MARD is looking to increase the research budget by research here can provide a return of USD 40. MARD is looking to increase the research budget by 10-12% per year, up from the current level of approximately 800 billion Vietnamese Dong. 10-12% per year, up from the current level of approximately 800 billion Vietnamese Dong.  "},{"text":" opportunity = the Livestock Revolution  The accelerating demand in developing countries as urbanization and incomes rise -mainly in the developing countries (see table below)  Year Annual per capita Total annual consumption YearAnnual per capitaTotal annual consumption    consumption   consumption   Meat Milk Meat Milk MeatMilkMeatMilk   (kg) (kg) (MT) (MT) (kg)(kg)(MT)(MT) Developing 2002 28 44 137 222 Developing20022844137222 World 2050 44 78 326 585 World20504478326585 Developed 2002 78 202 102 265 Developed200278202102265 World 2050 94 216 126 295 World205094216126295 Source: Rosegrant et al. (2009)     Source: Rosegrant et al. (2009)  "},{"text":"we have learned about disease risks and food safety in the informal food sector 2 But there are increasing concerns over food safety in developing countries Across 7 studies in sub-Saharan Africa and Asia we found  Many/most consumers say they are concerned over food safety (40 to 97%)  Consumers are willing to pay a 5-10% premium for safety  Younger, wealthier, town, supermarket shoppers were willing to pay more for safety  Consumers showed their concern by buying 20-40% less during animal health scares Dr Delia Grace, ILRI  Dr Delia Grace, ILRI What is the informal food sector in developing countries? What is the informal food sector in developing countries?  Markets where many actors are not licensed and do not pay tax (e.g. street foods, backyard  Markets where many actors are not licensed and do not pay tax (e.g. street foods, backyard poultry, pastoralist systems);  poultry, pastoralist systems);  Markets where traditional processing, products and retail practices predominate (e.g. wet  Markets where traditional processing, products and retail practices predominate (e.g. wet markets, traditional food processing);  markets, traditional food processing);  Markets which escape effective health and safety regulation (most domestic food markets in  Markets which escape effective health and safety regulation (most domestic food markets in developing countries).  developing countries). How do we assess food safety in informal food sectors?  How do we assess food safety in informal food sectors?  Risk-based approach is the gold standard but poorly adapted for developing countries  Risk-based approach is the gold standard but poorly adapted for developing countries  Using participatory methods can increase stakeholder engagement and capacity while helping  Using participatory methods can increase stakeholder engagement and capacity while helping generate information in data-scarce environments generate information in data-scarce environments  We have developed a number of tools including participatory appraisals; focus group  We have developed a number of tools including participatory appraisals; focus group discussions; questionnaires; direct observation and biological sampling discussions; questionnaires; direct observation and biological sampling  Over the past decade, ILRI and partners have implemented the following:  Over the past decade, ILRI and partners have implemented the following: o 30 risk assessments in informal markets o 30 risk assessments in informal markets o 10 consumer preference studies o 10 consumer preference studies o 8 food safety policy analyses  o 8 food safety policy analyses o 4 risk management studies  o 4 risk management studies o Around 30 graduate students trained o Around 30 graduate students trained The informal food sector is very important  The informal food sector is very important  Across a range of foods and countries, typically 80-90% of animal-source food is produced  Across a range of foods and countries, typically 80-90% of animal-source food is produced by smallholders and sold in wet markets  by smallholders and sold in wet markets  Supermarkets are emerging but tend to stock staples and processed good rather than fresh  Supermarkets are emerging but tend to stock staples and processed good rather than fresh animal-source foods  animal-source foods Vietnam China VietnamChina 80% of pork comes from farmers with 48% of pork comes from farmers 80% of pork comes from farmers with48% of pork comes from farmers <100 pigs 97% of pork is sold in wet markets with <50 pigs Sheep and goats 80-90% of pork sold in wet markets <100 pigs 97% of pork is sold in wet marketswith <50 pigs Sheep and goats 80-90% of pork sold in wet markets The informal food sector delivers many benefits  The informal food sector delivers many benefits Livestock are an important asset for poor people  Livestock are an important asset for poor people  1 billion people earning less than USD 1.25/day depend on livestock  1 billion people earning less than USD 1.25/day depend on livestock  65% of Vietnamese households keep pigs   65% of Vietnamese households keep pigs Generates employment  100 litres of milk generates 5.6 jobs making milk sweets in Bangladesh and 10 jobs selling Aquaculture Generates employment  100 litres of milk generates 5.6 jobs making milk sweets in Bangladesh and 10 jobs selling Aquaculture milk snacks in Ghana  milk snacks in Ghana  Informal dairy sector in Kenya generates 735,000 jobs; the formal only 105,000  Informal dairy sector in Kenya generates 735,000 jobs; the formal only 105,000 Provides cheaper food  Provides cheaper food  China: supermarket meat 10% premium Pigs  China: supermarket meat 10% premiumPigs  Kenya: pasteurized milk 25-40% premium   Kenya: pasteurized milk 25-40% premium  "},{"text":"Average ranking of major concerns about meat safety  Food safety concern Hanoi Ho Chi Minh All Food safety concernHanoiHo Chi MinhAll   City  City Diseases of livestock 1.2 1.1 1.2 Diseases of livestock1.21.11.2 Hormone used in animals 2.8 3.0 2.9 Hormone used in animals2.83.02.9 Antibiotic use 3.0 2.9 3.0 Antibiotic use3.02.93.0 Hygiene in market outlet (including meat seller) 3.8 2.6 3.2 Hygiene in market outlet (including meat seller)3.82.63.2 Hygiene in slaughtering 3.9 2.8 3.4 Hygiene in slaughtering3.92.83.4 Concentrate feeding of animals 3.7 4.1 3.8 Concentrate feeding of animals3.74.13.8 Other 3.5 3.1 3.2 Other3.53.13.2  "}],"sieverID":"f880aa20-9ab9-4ebc-adae-0b4898d5968b","abstract":""}

data/part_2/03f8945bea1ca7c0439e99594efc4a8d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03f8945bea1ca7c0439e99594efc4a8d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/bc896032-4673-4cd7-9d92-c458d05121da/retrieve"},"pageCount":57,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":43,"text":"This paper hypothezises that Colombian I ivestock sector should grow at a higher rate than in the past, in ~rder to offset the current and forseen gaps between tonsumption and potential demando It is also argued that technólogical change is the best alternative."},{"index":2,"size":79,"text":"A historical analysis is made, and production projections are presented, using trigonometric functions which are proper tools in analyzing production cycles. Potential demand is projected by using observed consumption in a given year, ¡ncome elasticity of demand for beef, and growth rates of per capita and human population real income. It is observed that in time, the exlstent and projected gaps between consumpt ion and potent la,l demand ~Ill become•broad~r. objectives relatea to short ana long-term ¡ncomes (sales policy)."}]},{"head":"One of the maln problems","index":2,"paragraphs":[{"index":1,"size":65,"text":"It is cóncluded that given the importance of livestock products wlthin national consumption. Its influence on the cost of living. and that • low Immediate profitability does not allow production increases via area Increases (mainly in \"Iarge productive areas). a technica,l change is Imperative to Increase productivity and production in order to satisfy domestlc consumption and generate e~portable surplus at competitive prlces In foreign markets. "}]},{"head":"III","index":3,"paragraphs":[]},{"head":"RESUMEN","index":4,"paragraphs":[{"index":1,"size":39,"text":"La ganadería vacuna de Colombia cuenta con un apreciable volumen de recursos en términos de tierra y de ganado; no obstante, su desempeño histórico ha estado por debajo de s~s pos.lbi l ¡dades y de las necesidades del país."},{"index":2,"size":10,"text":"Los productos aportados por el sector ganadero. carne y leche."},{"index":3,"size":32,"text":"tienen gran importancia dentro del consumo nacional, representando cerca de un tercio del gasto total en alimentos y las variaciones de sus precios Influyen notoriamente sobre ej' nivel de costo de vida."},{"index":4,"size":44,"text":"En este trabajo se plantea la hipótesis que el sect~r ganadero de Colombia debe crecer a una tasa superior a la observada en el pasado, para cubrir la brecha existente y prevista entre consumo.y demanda potencial y que la alternativa es el cambio tecnológico."},{"index":5,"size":85,"text":"Se efectúa un análisis histórico y se elaborañ proyecciones de producción. éstas últimas usando funciones trigonométricas que son herramientas adecuadas para el anál isis de los ciclos de producción. la demanda se proyecta utilizando el consumo observado de un año dado, la elasticidad ingreso de la demanda por carne vacuna y las tasas de crecimiento del -ingreso real per cápita y de la población humana. Es notorio que la brecha existente y proyectada entre consumo y demanda potencial se amplía con el transcurso del tiempo."},{"index":6,"size":77,"text":"Uno de• los mayores problemas para el análisis de la ganadería del país, es la escasez de estadísticas básicas confiables y en ,especial de cifras relativas a inventarios. Se desarrolla un modelo de simulación que reconstruye las series históricas de existencias util izando los 'sacrificios observados y e i er tos parámetros técn icos que se asumen. El modelo genera un nivel de inventario de. 11.5 millones de cabezas en 1951 y de 27 millones en 1979."},{"index":7,"size":4,"text":"• ' '. '"}]},{"head":"• t","index":5,"paragraphs":[{"index":1,"size":130,"text":"Como se plantea que la alternativa es el cambio tecnológico y siendo • la reglón de los Llanos Orientales una de las áreas de frontera del país, ' que más posibilidades tiene de un desarrollo ganadero inmediato y que los esfuerzos de investigación de CIAT, en materia de ganadería a nivel de Colombia, se concentran en esa región. Se elaboran estimaciones de oferta para consumo bajo nueva tecnolog1a, simulando mediante el modelo HATSIM la productividad de la ganaderfa de los Llanos Orientales con tecnología tanto tradicional como mejorada y asumiendo diferentes patrones de adopción. Los resultado$ del cambio técnico dependerán en gran medida del patrón de adopción que sigan los productores de la región\"y de sus objet\"ivos en cuanto a ingresos a corto y a largo plazo (política de ventas)."},{"index":2,"size":164,"text":"Se concluye que dada la Importancia de los productos ganaderos en el consumo nacional y su influencia en el costo de vida y'que la baja rentabilidad inmediata de la actividad no permite aumentos en producción vía incrementos en el área utilizada, principalmente en las grandes zonas productoras, se hace imperativo un cambio técnico que aumente productividad y producción para satisfacer el consumo interno y generar excedentes exportables a precios competitivos en mercados externos.      Este trabajo es parte de un estudio conjunto desarrollado por FAO y CIAT para caracterizar en términos económicos y téc.nicos 1\" ganadería latinoamericana en base a estudios de caso. FAO desarrolla los estudios de Argentina, Chile y Uruguay, y CIAT lo's trabajos de Colombia y Brasil. Se considera .que estudiando la ganadería de los principales países productores, tanto de la región tropical como de la región templada, se puede llegar a una buena aproximación de la situación ganadéra de América Latina • La presentación del trabajo comprende cuatro partes a saber:"},{"index":3,"size":19,"text":"(1) Descripción general del sector ganadero de Colombia, con énfasis en su importancia dentro de la economía del país."},{"index":4,"size":17,"text":"(2) Anál isis histórico de los ciclos de producción ganadera y proyecciones de producción y demanda ."},{"index":5,"size":10,"text":". (3) Modelo de simulación para generación de existencias ganaderas."},{"index":6,"size":69,"text":"(4) Est imac ión de oferta para consumo en los Ll anos Ori enta I es dados di ferentes patrones de adopción de nueva tecnología. La hipótesis general que se plantea es que la ganadería de Colombia debe crecer á una tasa superior a la actual para cubrir la brecha prevista entre oferta'y demanda.• Dadas las actuales circunstancias, la alternativa para reducir la brecha es el cambio tecnológico •"}]},{"head":"Aspectos Generales","index":6,"paragraphs":[{"index":1,"size":56,"text":"En el transcurso del tiempo el área en pastos del país, se ha incrementado notoriamente. En 1950 el hectareaje en pastos era de 12 millones de hectáreas, pasando a 21 millones en 1978. La participación de los pastos en el total de tierra disponible se incrementó de 11 a 18% en el mismo período (Cuadro 1)."},{"index":2,"size":43,"text":"• la ganadería de Colombia se encuentra diseminada a través de toda la La ganadería vaéuna aporta aproximadamente un 9% del valor de la • producción total del país, permaneciendo esa participación mas o menos es-• table a través del ti,empo (Cuadro 3)."},{"index":3,"size":139,"text":"En términos de empleo generado por la ganader,ía, se aprecia que ésta contr.jbuye con cerca de un 18% del empleo generado po; el sector agropecuario y que si bien su participación en el empleo total ha dismlnuído. esta baja es minima en comparación con la baja observada en el subsector agríco-• la (Cuadro 4). Dent ro de la d ' i eta de I 'pa í s, ca rne vacuna tiene gran importanci a, representando un porcentaje que varía entre Iq y 25% del gasto total en alimentos. El estrato más pobre de la población gasta en carne vacuna aproximadamente una quinta parte del gasto total en alimentos, aumentando s~ar.tlcipación a medida que cr~e el nivel de ingreso (Cuadro,5). ~x t' ~ \"t-J. a;,:. f\",,\" d a c_ \\ N '\\ ,J ~ \\ . 1:1 . ,,~ .."}]},{"head":"\\ , \\","index":7,"paragraphs":[{"index":1,"size":1,"text":"\\."}]},{"head":"\" ,","index":8,"paragraphs":[{"index":1,"size":28,"text":"Conjuntamente los gastos en leche y. carne representan cerca de un tercio del gasto en alimentos, indépeñdientemente del nivel de Ingreso y de la ubicación geográfica (Figura 2)."},{"index":2,"size":118,"text":"las exportaciones bovinas han tenido relativamente poca importancia dentro del conjunto de las exportaciones totales del país, siendo muy variable su volumen, el cual depende en gran medida de la situación coyuntural de los mercados externos. En 1972 las'exportaciones bovinas constituían el 5% del valor de las exportaciones totales, bajando a 3% en, 1978; en contraste las exportaciones agrícolas durante los mismos años incrementan su participación de 6q a 75% (Figura 3). las exportaciones bovinas registradas constituyen un porcentaje muy bajo de la extrácción total, fluctuando ese porcentaje ent,e 2 y 8% (Cuadro 6). En resumen, las exportaciones bovinas no han tenido gran importancia, ni dentro del total de exportaciones de Colombia, ni dentro de la extracción total."},{"index":3,"size":114,"text":"Observando la serie histórl,,!<a de consumo aparente por habitante de carne vacuna, se aprecia una clara tendencia decreciente, de un consumo de O.lq cabezas por habitante en 1950, este declina hasta llegar en 1978 a 0.11 cabezas per cápita (Cuadro 7) • En los últimos años el país ha gastado significativas cantidades de divisas en Importaciones de leche, las proyecciones para las próximas décadas Indican que el déficit de leche. se Incrementará, de continuar las actuales tendencias de la producción. Segun estimaciones de FADEGAW 1 en 1980 el déficit equivalía a 33% de las necesidades del país y se estima que para 1/ FADEGAN, \"Segundo Foro Nacional Ganadero\", Medellín, Agosto 2 y 3, 1979."},{"index":4,"size":60,"text":"el año 2000 ese déficit estará en el orden del q3% de las necesidades (Cuadro 8). la rentabilidad de la ganadería ha sido uno de los temas de mayor controversia, en razón de la generalizada idea de que una de las principales causas para el bajo nivel de adopción de nuevas tecnologías es la baja rentabilidad de la actividad ganadera."},{"index":5,"size":92,"text":"Según estimaciones de Planeación Nacional y del ICA, la rentabilidad inmediata de la ganadería extensiva de doble propósito en áreas como el Magdalena Medio, la'Costa Atlántica y el Piedemonte llanero, fluctúa entre 1.7 y 2.2%. la ganadería de leche en regiones como la Sabana de Bogotá y Nariño, con climas apropiados para razas lecheras de alt~ rendimiento, está en el orden del 10 al 13%. la rentabi lldad inmediata de la ganadería comparada con la rentabilidad de activos financieros de poco riesgo y I iquidez inmediata es igualmente muy baja (Cuadro 10)."},{"index":6,"size":130,"text":"Caracterizando el sector ganadero del país en términos de sus Indicadores socio-económicos, se encuentra que en 1978 la ganadería aportó el 21% del valor de la producción del sector agropecuario, que constituye el 6% del valor de la producción nacional bruta, aportó el 23% del valor agregado del sector agropecuario, generó empleo para 410.000 personas, y el consumo observado por persona fue de 20 kg de carne y 81 kg de leche (Cuadro 11). 'Si bien el 'sector ganadero de Colombia cuenta con un volumen apreciable de recursos, en términos de tierra y ganado, su desempeño a través del tiempo ha\" estado por debajo de su potencial y de las necesidad~s del país, al observarse un consumo por habitante cada vez menor y un deterioro creciente del abastecimiento de leche."}]},{"head":"Análisis de Ciclos y Proyecciones de Producción y Demanda","index":9,"paragraphs":[{"index":1,"size":130,"text":"En la mayoría de los países productores de carne se observan ciclos de producción ganadera. la presencia de los ciclos de producción obedece a razones económicas y'técnicas. las razones económicas están relacionadas con los movimientos del precio real del ganado; cuando se produce un alza del precio y se espera que sea persistente durante un cierto lapso, los productores visualizan que la inversión en ganado se hace más rentable y deciden invertir, pero el ganado como bien económico tiene la doble caracterfstica de ser un bien de consumo final y un bien de inversión (máquina productora de carne). Lo cual implica que ante aumentos en precios del ganado, los productores retengan animales disminuyendo la disponibilidad para consumo, siendo más notoria la retención de hembras que la de machos (Figura \")."},{"index":2,"size":77,"text":"El aspecto técnico del ciclo se refiere a que el período de producción en ganadería es más o menos largo, existiendo un intertanto entre el momento en que se toma la decisión de producir y el momento en que se materializa dicha decisión. Por esta causa ante aumentos de precios, la respuesta de la oferta no es inmediata, pero una vez que .Ia prod~cción aumenta, los precios declinan y se entra en una nueva fase del ciclo."},{"index":3,"size":111,"text":"El ciclo ganadero puede esquematizarse como en la Figura 5, en donde el movimiento cíclico se produce a 10 largo de una línea de tendencia. El ciclo puede ser caracterizado por dos parámetros, período o longitud y amplitud. El período se define como la duración de una oscilación completa alrededor de la línea de tendencia. La amplitud es la distancia existente entre la línea de tendencia y los puntos críticos, por ésto en cada dclo se observan dos amplitudes, una positiva con respecto a la tendencia y otra negativa con respecto a la misma línea. Las formas matemáticas que describen las oscilaciones cíclicas corresponden a las funciones trigonométricas seno y coseno."},{"index":4,"size":35,"text":"En el caso de la ganadería de Colombia, el ciclo de hembras es mucho más marcado que el de machos, constituyendo el principal componente de las oscilaciones cíclicas de la producción total (Figura 6) ."},{"index":5,"size":99,"text":"En el período 1950/78 se observan tres ciclos completos en la producción de hembras, ellos' cubren los períodos 1956/62, 1962/69 Y 1969/75. La duración promedio del ciclo de hembras es de seis años y su amplitud media es de 139.000 cabezas (Cuadros 12 y 13). En el caso de los machos también se observan tres ciclos completos en los períodos 1956/61, 1961/67 Y 1967/78, con una duración media de siete años y una amplitud de 93.000 , cabezas. Una vez caracterizados los ciclos en términos de sus parámetros, se ajustan funciones trigonométricas a efectos de elaborar proyecciones de producción."},{"index":6,"size":169,"text":"En la figura 7 se muestran los valores observados y estimados, en .. base a una función trigonométrica, del sacrificio de hembras. En los pri-• meros años se nota una perfecta concordancia entre los puntos críticos de la función estimada y los puntos cr:íttcos obs~rvados; a medida que transcurre el tiempo se presenta un desfase entre los puntos críticos de las dos funciones; probablemente ésto ocurre porque en la función estimada Se utilizan valores,promedios tanto de amplitud como de período, el modelo es susceptible de ser mejorado utillzándo amplitudes y longitudes que sean JJviiones del tiempo; sin embargo, para efectos de proyecciones el R 2 de ~-para la función estimada indica que es una función aceptable. En el Cuadro 14 aparecen las proyecciones del sacrificio de hembras, las cuales tienen dos componentes, un componente de tendenc la Ilnea.1 y un componente cíclico, también aparecen los valores de los sacrificios observados. Igual metodología se util Iza para elaborar las proyecciones del sacrificio de machos que aparecen en el Cuadro 15."},{"index":7,"size":13,"text":"Para proyectar la demanda se parte de una relación funcional del ,siguiente tipo:"},{"index":8,"size":85,"text":"donde: DT a es demanda potencial total en el período t+l C t = consumo per cápita observado en el período t y = tasa de crecimiento del ingreso real per cápita N y = elasticidad ingreso de la demanda PH t + 1 • población humana en el período t+l Se trata de una demanda potencial porque en l'as estimaciones se asumen precios reales constantes. la demanda potencial nos indica cuál hubiese sido el nivel del consumo de haber permanecido los precios reales constantes."},{"index":9,"size":102,"text":"En la Figura 8 aparecen las estimaciones de demanda potencial, calculadas en base'al consumo de 1950, una tasa de crecimiento del Ingreso real per cápita de 1.6% y una elasticidad ingreso de la demanda de 0.7. En Colombia el principal determinante de la demanda global ha sido el crecimiento poblacional, unido ésto a una alta elasticidad ingreso de la demanda, aunque en los últimos anos se observa Una declinación en la tasa de crecimiento de la población. En la Figura-8 aparece tambrén el consumo observado, se nota claramente que la brecha entre demanda potencial y consumo observado se hace cada vez mayor."},{"index":10,"size":11,"text":"Para disminuir esta brecha, el camino es el incremento de producti~i-."},{"index":11,"size":149,"text":"dad via el cambio tecnológico que eleva la producción y el consumo. El cambio técnico debe ser de tal naturaleza que permita satisfacer el consumo Interno y generar excedentes de exportación a precios competitivos en los mercados internacionales. En el Cuadro 16 se presentan las proyecciones de sacrIfico para consumo interno, en base a las funciones trigonométricas anteriormente descritas, y las proyecciones de demanda bajo dos ~ipótes¡s de crecimiento del ingreso, una que asume un crecimiento del ingreso real per cáplta de 2% y otra de 2.6% por año, para estas proyecciones se util iza el consumo de 1979 como base. Del análisis de las cifras se infiere que ,con la hipótesis de ingreso bajo, el déficit del consumo con respecto a la demanda fue 10% en 1979 pasando a ~O% en el año 2000, ésto de continuar las actuales tendencias de la producción, vale decir sin cambio tecnológico."}]},{"head":"Modelo de Generación de Inventarios","index":10,"paragraphs":[{"index":1,"size":108,"text":"Uno de 10$ principales inconvenientes al anal izar el desempeRo histórico del sector ganadero de Colombia, es la falta de información estadística básica confiable. las cifras disponibles sobre inventarios ganaderos se refieren a diferentes períodos y fuentes, en muchos casos son inconsistentes internamente y comparadas con otras fuentes, en algunos casos no se define claramente la metodología de cálculo. El nivel y variaciones de los inventarios ganaderos son claves para el diseño de las pol•íticas dirigidas al sector, por ésto se decidió elaborar un modelo de simulación para estimar las series históricas de existencias ganaderas a partir de los sacrificios y de ciertos parámetros técnicos que se asumen."},{"index":2,"size":57,"text":"• . . la idea es que los animales que nacen en un per-íodo inicial t, van pasando anualmente de una categoría a otra, previos los descuentos por muertes y sacrificios, hasta llegar a una edad máxima de sacrificio en donde desaparecen los últimos de los animales nacidos durante t. la Figura 9 es Ilustrativa al respecto."},{"index":3,"size":122,"text":"En la Figura lO aparece la estructura general del modelo con sus diferentes categorías de vacunos; se asumen que los nacimientos ocurren en igual proporción, tanto de machos como de hembras y. a partir de ellos se generan todas las categorías del inventarlo ganadero. El inventario de machos comprende las categorías de 0-1 año, de 1-2 años, de 2-3 años, de 3-4 años y de 4-5 años. El inventario de hembras está constituido por las categorías de 0-1 año, de 1-2 años, de 2-3 años, de 3-4 años y las vacas de cría. El inventario de toros y toretes está conformado por animales de 0-1 año, de 1-2 años, de 2-3 años, de 3-4 años, de 4-5 años y los toros reproductores."},{"index":4,"size":82,"text":"Además de las series de sacrificios el modelo utiliza parámetros tales como: tasas de mortalidad a diferentes edade!i. (mil, relación toro: vaca (a), proporción de terneros machos que se apartan para reproducción (a). proporción de vaquillas de 2-3 años que se trasladan al hato de cría (a), proporción de vaquillas de 3-q años que pasan al hato de cría (p) y coeficientesde distribución de Jos sacrificios según edades. las Figuras 9 y 10 pueden expresarse en términos matemáticos de la siguiente forma:"},{"index":5,"size":15,"text":"[1] SM56(¡+5) = De la expresión [lJ se despejan los nacimientos que constituyen la .."},{"index":6,"size":54,"text":"la expresl6n [2J calcula' los nacimientos anuales en base a sacrificios en distintos períodos, tasas de mortal)dad a diferentes edades y proporción , de terneros machos que se apartan para r:eproducci6n. Una vez generados los nacimientos tanto de machos como de hembras se estiman todas. las categorías del Inventario mediante las siguientes relaciones contables:"},{"index":7,"size":4,"text":"Existencias Ganaderas : ."},{"index":8,"size":16,"text":"[,J M1(i+l) = NM(ilF -SMl O) Existencias de Hembras: las existencias de hembras se expresan como:"},{"index":9,"size":49,"text":"HI(I+1) e hembras de 0-1 año al comenza r i + 1 H2{i+2) = hembras de 1-2 años al comenzar i+2 H3 (¡+3) '\" hembras de 2-3 años al comenzar 1+3 Hld i+l¡) '\" hembras de 3-!¡ años al comenzar I+!¡ H5(1+5) '\" hembras de cría al comenzar 1+5"},{"index":10,"size":30,"text":"Para el cálculo del inventario de hembras de cría se requiere conocer el inventario de esta categoría un año antes \"del inicio de la recomposición del Inventario de la misma."},{"index":11,"size":19,"text":"Existencia de Toros y Toretes: El Inventario de toros y toretes se calcula mediante relaciones si\"mllares a las anteriores:"},{"index":12,"size":13,"text":"[14] T1 (i+1) '\" aNM (il (l-ml)   [15J T2(i+2) e TI 0+1) (l-m2)"},{"index":13,"size":1,"text":"[16]"},{"index":14,"size":102,"text":"donde: T1 (1+0 = toretes de 0-1 año al comenzar 1+1 T2(i+2) '\" toretes de 1-2 años al comenzar i+2 T3{i+3) '\" toretes de 2-3 años al comenzar i+3 TI¡ ( i +I¡) '\" toretes de 3-1¡ años al comenzar i+!¡ Para correr el modelo se usaron diferentes conjuntos de parámetros técnicos; los mejores resultados desde el punto de consistencia de las cifras, tasa de natalidad dentro de límites razonables y crecimie~to del inventario, se obtuvieron con los parámetros técnicos que aparecen en el Cuadro 17, los cuales están dentro de los rangos establecidos por varios estudios de la ganadería del país."},{"index":15,"size":140,"text":"Una dificultad para correr el modelo era que no se conocía la distribución de los sacrificios por edades; las cifras reportadas por el DANE los discriminan por sexo más no por edad; para conocer las edades de matanza había dos posibilidades, una era efectuar muestreos en los mataderos y mediante el conteo de Jos dientes de los animales sacrificados establecer sus edades. la otra posibilidad era asumir una distribución de las edades de sacrificio y usando ciertos parámetros conocidos definir dicha distribución. •Se optó por la segunda alternativa porque la primera a más de ser costosa requiere mucho tiempo. Partiendo del supuesto que la edad media de los machos sacrificados es de 48 meses y que el 99% de ellos está en edades -entre 2~ y •72 meses, se definió la distribución del sacrificio de machos (Cuadros 18 y 19)."},{"index":16,"size":43,"text":"En el caso de las hembras es difícil establecer una edad promedia de sacrificio, se supuso que el 90% de las hembras sacrificadas perteñece a la categoría de hembras de cría y que el 10% restante pertenece a las categorías de 2-4 años."},{"index":17,"size":67,"text":"Los resultados del modelo, bajo los supuestos anteriores aparecen en el Cuadro 20. De acuerdo con ellos en 1951 el inventario ganadero era de 11.5 millones de cabe~as, pasando en 1974 a 25 millones y en 1979 a 27 millones de cabezas. la tasa de crecimiento del inventario total en el período 1951/74 fue en promedio por año de 3.3% y en el período 1951/79 de 3.1%."},{"index":18,"size":77,"text":"Cabe acotar que el modelo sólo genera nacimientos hasta 1974, porque para calcularlos 'nacimientos de un determinado año, se requiere información sobre sacrificios del año en referencia y de los cinco años siguientes. Por ejemplo, para generar los nacimientos de 1975 se requiere información de sacrificios hasta 191:1' 0, la cual para ese último año aún no está disponible. las existencias de 1975 en adelante se calculan suponiendo una tasa de natalidad que corresponde al promedio 1970-74."},{"index":19,"size":194,"text":"La población 9anadera del país, según el modelo, se distribuye en 32% machos y 68% hembras y del total el 36% corresponde a animales menores de dos años y 64% a mayores de dos años, estos porcentajes no difieren sus tan-cial~ente de los estimativos de Planeación Nacional (Cuadro 21). la tasa de natal idad es. una variable endógena del modelo, ya que él determina tanto el número de nacimientos como el de hembras de cría; En el Cuadro 22 aparecen los valores de la tasa de natalidad, la cual tiene un va lar med io de 49% y un ran90 de var i ac i ón entre 37 y 56%. Nótes,e que en los últimos años la tasa de natalidad decae sensiblemente, es posible que exista algún problema en relación con las cifras de sacri'ficio usadas, puesto que si bien los datos sobre sacrificios oficiales son bastante con-.fiables, existe una extracción adicional que corresponde a sacrificios y 'exportaciones ilegales. Los sacrificios oficiales fueron ajustados en un 10% a,nual correspondiente a sacrificio Ilegal y se les adicionó los estimativos de ¡OEMA sobre exportaciones ilegales. Es posible que estos ajustes distorsionen un poco los resultados obtenidos."},{"index":20,"size":86,"text":"El modelo ha sido programado en FORTRAN IV para el Sistema 34 de IBM y puede ser utilizado para: determinar los niveles del inventario total por categorías de sexo y edad, ensayar diferentes conjuntos de parámetros técnicos para establecer cuál ha sido el conjunto de parámetros técnicos más probables que ha tenido la 9anadería en el curso de su desarrollo histórico, determinar con diferentes tecnologías, vale decir cón distintos conjuntos de parámetros técnicos, cuál sería el nivel de los inventarios y efectuar proyecciones de los mismos."},{"index":21,"size":11,"text":"En.la medida en que los sistemas de información estadísticas del país"},{"index":22,"size":71,"text":"mejoren y se genere información básica más precisa sobre parámetros técnicos y sacrificios, los resultados de un modelo de esta naturaleza se afinarán y tendrán un menor margen de error • 4. Estimación de Oferta de Carne Vacuna bajo Condiciones de Nueva Tecnología en los Llanos Orientales Se trata de un análisis ex-ante ~n virtud de que el proceso de adopción de nueva tecnología recién comienza en la región en referencia."},{"index":23,"size":100,"text":"En este contexto se define la tecnología tradicional como aquella que emplea exclusivamente pradera natural, el suministro de sal está por debajo del requerido, no hay rotación de potreros, ni selección de vacunos. En oposición, la tecnología mejorada se define como aquella que utiliza pasto mejorado, aproximadamente un 10% de la finca en mezcla de leguminosa y gramínea mejorada, el suministro de mezcla mineral es de unos 22 kgiaño/UA, se efectúa rotación de potreros y selección de vacunos. El• comp~nente principal del paquete tecnológico es el germoplasma producto de la investigación de CIAT y de las agencias nacionales colaboradoras ."},{"index":24,"size":72,"text":"La región de los Llanos Orientales, comprende el Oriente de .Cundinamarca, la Intendencia de Casanare y las Comisarías de Arauca y •Vichada, tienen una extensión de aproximadamente 20.5 millones de hectáreas discr.iminadas así: 2.5 millones en el Piedemonte, 12.5 millones al Sur del Río Meta y 5.5 al Norte de Casanare. El 15% de este terr.itor io corresponde a bosques y el resto está cubierto de pastos naturales en su mayor parte."},{"index":25,"size":69,"text":"El área total de los Llanos es aproximadamente una quinta parte del área del país. La mayor re.stricción .para la producción de carne en la región son los problemas nutricionales derivados de la baja productividad de las praderas naturales y por la escasez estacional de pastos. Los suelos de los Llanos se caracterizan por su baja fertil idad y por problemas de saturación de aluminio y deficiencias de fósforo."},{"index":26,"size":93,"text":"La nueva tecnología pretende levantar esta restricción nutricional mediante la introducción de variedades de gramíneas y leguminosas que se adapten a las condiciones del ecos.istema de la región y que genere incre-mentas en productividad por unidad animal y por hectárea.' Para la estimación de la oferta para consumo hay que enfrentar dos problemas, el primero se refiere a determinar la productividad tanto de la tecnología tradicional como de Ia tecnología mejorada, el segundo problema es ~stablecer cuál va a ser el posible patrón de adopción a través del 'tIempo de la nueva tecnología."},{"index":27,"size":33,"text":"Para resolver el primer problema se emplea el. Modelo HATSIM f que simula el desarrollo del hato y determina su productividad en términos de producción de carne para consumo por cabeza en Inventario."},{"index":28,"size":95,"text":"El HATS1M simula el desarrollo del hato a partir de los parámetros técnicos que aparecen en el Cuadro 23'y una política de ventas dada. La política de ventas se refleja en la proporción de animales que anualmente se extraen de las diferentes categorías para sacrificio. En virtud de que las hembras son el principal determinante del crecimiento del inventario, en este caso la política de ventas' se define como la proporción de hembras de cría 'que anualmente se extrae del hato para el consumo. Los resultados de la simulación se muestran en el Cuadro 2ij."},{"index":29,"size":88,"text":"En el caso de la tecnología tradicional cuando el porcentaje de hembras ,extraído es Igual a la tasa de desecho (14%), se tiene una tasa de • crecimiento promedio anual del inventario de 1.4% por año y una producción para consumo de 20 kg por cabeza\"\"en inventario; al aumentar la extracción de hembras a 21% la tasa de crecimiento del inventario resulta negativa, es decir se está liquidando la inversión en ganado, la producción para consumo alcanza los 27 kg por cabeza en inventario por año (Cuadro 24)."},{"index":30,"size":37,"text":"Cuando bajo condiciones de tecnología mejorada se extrae 'el 20% de las hembras de cría, se observa una tasa de crecimiento del hato de aproximadamente 8% anual y Una producción por cabeza en inventario de 39 kg."},{"index":31,"size":83,"text":"Existe una relación directa entre porcentaje de ventas y producción para consumo y una relación inversa entre porcentaje de ventas y tasa de crec i- Para cada una'de las hipótesis planteadas se determinan tres puntos los cuales definen el patrón de adopción; empleando el método estadístico de puntos elegidos se estiman los valores de K, a y e para las tres curvas de adopción hipotéticas. En el Cuadro 25 aparecen los puntos elegidos y en la ,igura 12 las curvas de adopción resultantes."},{"index":32,"size":49,"text":"Una vez definida la productividad de las tecnologías, los posibles patrones de adopción y la tasa de crecimiento del inventario dadas las poli~ ticas de venta, se estima el nivel de inventario ganadero, tanto bajo tecno-logía tradicional, como bajo-tecnología mejorada y los niveles de producción de carne para consumo."},{"index":33,"size":56,"text":"En los Cuadros 26 a 29 aparecen las estimaciones de oferta asumiendo la hlp6tesis más optimista y la más pesimista. la primera hipótesis se • refiere a una política moderada' de ventas tanto en el sector de tecnología , ,tradicional como en el sector de tecnología moderada y un patrón de adopción rápida de nueva tecnología."},{"index":34,"size":128,"text":"política agresiva de ventas lenta de nueva tecnología. la hipótesis más pesimista se refiere a una en los dos sectores y un patrón de adopción Si la difusión es baja y la política de ventas es agresiva, ello impl ica una tasa de crecimiento promedio anual de la producción para consumo, de 1%, en contraste con una tasa de cr~cimiento cinco veces mayor cuando la --difusión es alta y la política de ventas es moderada. El ,hato ganadero de la región permanece estable a nivel de 2.Q millones de cabezas bajo la hipótesis más pesimista; bajo la segunda hip6tesis el inventario pasa de un nivel de 2.4 millones de cabezas en 1980 a 3.6 millones en el año 2000, vale decir un incremento de~ 50% con respecto a1980."},{"index":35,"size":42,"text":"Es arriesgado elaborar proyecciones para todas las regiones ganaderas del país en base a la nueva tecnología, diseñada para los llanos Orientales, puesto que aún no se conoce su grado de adaptación y productividad en ecosistemas diferentes al' de los llanos .Orientales."}]},{"head":"• •","index":11,"paragraphs":[]},{"head":"•","index":12,"paragraphs":[]},{"head":"RESUMEN Y CONCLUSIONES","index":13,"paragraphs":[{"index":1,"size":22,"text":"Colombia cuenta con un importante volumen de recursos dentro del sector ganadero en términos de tierra en pastos e inventario de ganado."},{"index":2,"size":37,"text":"Dentro del consumo nacional carne y leche tienen alta participación, representando cerca de un terc~o del gasto total en alimentos e implicando qué alzas en estos productos tengan gran influencia sobre el nivel del costo de vida."},{"index":3,"size":123,"text":"Pese a su volumen considerable de recursos, el sector ha estado por debajo de su potencial productivo y de las necesidades del país, reflejándose en un deterioro creciente del consumo por habitante, en un gasto cada vez mayor de divisas en importaciones de leche y en una brecha en aumento entre consumo observado y demanda potencial. la rentabilidad real inmediata de la ganadería (sin incluir valorización de activos), es baja aún comparada con inversiones fáciles, de liquidez inmediata y eScaso riesgo. las posibilidades de incrementar producción vía incremento del área utilizada, especialmente en las grandes zonas productoras, son remotas debido a esa baja rentabilidad ya que la ganadería tiene que competir por tierra con la agricult~ra que es una actividad de alta rentabilidad."},{"index":4,"size":40,"text":"Dado 10 anterior\" la posibilidad planteada es el cambio técnico que eleve la productividad de los recursos del sector, aumentando,producción, consumo y generando excedentes exportables a un costo competitivo en los mercados internacionales .       -----------------'000 de personas ----------------- . '"},{"index":5,"size":2,"text":". ."}]},{"head":"• •","index":14,"paragraphs":[{"index":1,"size":12,"text":"• .         de la producción Tasa de crecimiento de la producción 1"},{"index":2,"size":13,"text":".--------------\"000 de cabezas ---------------------porcentaje ------- -----------------'000 de cabezas -----------------  ---------'000 de cabezas ----------."},{"index":3,"size":4,"text":"--------'000  • 'ti' .. "}]}],"figures":[{"text":" In analyzing Colombian livestock is the lack of rellable basic statistics, specially data on inventories. A simulation model is developed to reconstruct ••time series of stocks, using observed slaughter and other assumed technical parameters. The model produces an Inventory level of 11.5 and 27 milI ion heads In 1951 and 1979, respectively • Estimatlons of supply for consumption under new technology are made, slmulating livestock ~roductivity in the Llanos Orientales with the HATSIH model under both traditional and Improved technology, and assuming different adoptlon patterns. Technical change results wlll depend to a grest extent on the adoptlon patterns that producers of the area follow, and on their. "},{"text":" comprende los Departamentos de Atlántico, Bolivar, Cesar, Córdoba, Guajira, Magdalena, Sucre y el Norte de Antioquia (Figura 1). Valle del Rio Magdalena que incluye a los Departamentos de Bayaca. Norte de Santander, Santander, Cundinamarca, Caldas, Hulla, Tollma y el Sur de Antioqula. Zona 111: Valle del Rlo Cauca conformado por los Departamentos de Zona IV: Zona V: Valle, Cauca, Qulndío y Risaralda. Territorios del Sur constituidos por el Departamento de Nariño y las Intendencias de Putumayo, Caquetá y Vaupés. Llanos Orientales que incluyen el Oriente de Cundlnamarca, Meta, Arauca, Casanare y Vichada (Figura 1).la población ganadera del país se concentra principalmente en las Zonas I y 11 que en conjunto contabilizan aproximadamente el 80% del Inventario ganadero del país, equivalente a unos 20 millones de cabezas. Entre 1960 y 1978 la Zona 1\\ disminuyó su participación en el inventarlo ganadero total bajando de 41 a 35%; en contraste, la Zona V, triplicó su participación en el mismo período (Cuadro 2). "},{"text":" ) = macnos de 0-1 año al comenzar 1+1 M2 (1+2) \" machos de 1-2 años al comenzar 1+2 M30+3) .. machos de 2-3 años al comenzar 1+3 MI¡ (i +I¡) .. machos de 3-1¡ años al comenzar i+l¡ M5(1+5) = machos de 4-5 alios al comenzar 1+5 la última categoría M56(i+6) se anula porque loS supuestos del modelo implican que M5(i+5) (l-m6) .. 5M56(1+5). "},{"text":" ) -toretes de ~-5 años al• comenzar i+5 TT(I+6) = toros reproductores al comenzar 1+6 Se•asume que no hay sacrificio de toretes, solamente se extraen los reproductores de desecho. "},{"text":"1 / Patricia Juri et.al. \"Modelo de Simulación por Computador para Fincas Ganaderas\"., CIAT, Agosto de 1977. problema de adopción tecnológica se utilizan tres hipótesis con respecto al posible patrón de adopción, ellos son: adopción moderada, adopción lenta y adopción rápida. Se asume que el modelo matemático que reproduce los patrones de , .adopción tecnológico corresponde a una función logística denominada también sigmoideo Este tipo de función ha sido utilizado con éxito en estudios sobre adopción de tecnologías agrícolas en Estados Unidos y Uruguay. La función logística tiene la particul'aridad que en las etapas iniciales 'muestra un crecimiento lento, luego ese crecimiento se acelera hasta llegar a un punto de inflexión donde el crecimiento decrece y finalmente la función se estabiliza, Este es justamente el comportamiento observado en los procesos de difusión y adopción de nuevas tecnologías. En las etapas iniciales sólo 105 productores más progresistas adoptan las nuevas técnicas, luego el • proceso se hace masivo para finalmente llegar a un punto donde s'e agota el universo de potenciales adoptadores y el proceso termina. La forma matemática de la función logística corresponde a: donde: Y es la variable que mide el porcentaje del inventario ganadero que anualmente está bajo nueva tecnología y K, a y e son parámetros a estimar (Figura 11). "},{"text":" Figura 1.Colombia; zonificación ganadera "},{"text":" Figura 7. "},{"text":" Supuesto t. Se asume que la edad pr~ed¡o de matanza es de 48 meses • . : , • '. de cabezas ------.----69.$ 827 1101 -139.0 777 928 -69.5 868 711 69.5 1025 810 139.0 1118 1028 69.5 1070 1211 -6:3.5 951 1090 -139. O 902 1070 -69.5 992 69.5 i153 139.0 1243 69.5 1193 -69.5 1076 -139.0 1027 -69.5 1117 69.$ 1278 69.5 1319 -69.5 1200 -139.0 1152 el AT -1 nforme Anua 1 1978, Y Eugen I a de Rub i ns te in 139.0 619 657 1971 896 69.5 570 599 1972 916 -69.5 451 549 1973 937 -139.0 1;03 444 1974 956 -69.5 493 483 . 1975 979 69.5 653 586 1976 1000 139. O 71;3 648 1977 1020. 69.5 694 617 1978 1041 -69.5 577 544 1979 1062 -139.0 528 572 1980 1083 • -69.5 617 624 1981 1104 69~S 778 715 1982 1124 139.0 868 802 1983 1145 69.5 820 843 1984 1166 -69.5 702 868 1985 1187 -139.0 653 718 1986 1208 -69.5 743 647 1987 1228 69.5 903 693 1988 1249 139. O 993 781 1989 1270 69.5 . 944 954 1990 1291 DANE. Boletín Mensua I de Estadística años que pasan -al hato de cría (p) 479 500 521 542 ,63 584 604 625 646 667 687 708 729 750 771 792 812 833 854 875 Fuente: 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 . 1967 1968 1969 1970 i< 0.90 86-92 92-98 4.50 a 5.14 0.00 ).85 a 4.50 0.00 hembras por encima de la tasa normal de desecho. Proporción de vaquillas de 3 a q 0.10 ]2-80 2.57 a . 3.21 0.44 TT 80-86 3.21 a 3.85 0.06 Fuente: La cifra entre paréntesis indica el porcentaje de venta de + de 6 años que pasan al hato de cría (~) 139.0 1367 Cuadro 15. Colombia: proyecciones del sacrificio de machos. 1956-1990 Sacrificio estimado Sacriflc lo Sacrificio estimado Sacrl flc lo Año Tendencia Ciclo Total observado i , Año Tendencia Ciclo Total observado* Colombia: proyecciones de producción, 1979-2000 Demanda Déf ici t Producción Crecimiento del Crec i m•¡ ento de l Mo total In¡¡reso ingreso bajo alto bajo alto ganaderos -Parámetros técnicos Tasa de mortalidad animales: 0-1 año t -2 años 2~3 años 3-/¡ años 4-5 años Más de 5 años Relación toro/vaca (~l Proporción de terneros nacidos destinados a reproducción (al Proporción de vaquillas de 2 a 3 Porcentaje 4.5 4.0 3.5 3.5 3.5 3.5 0,04-0.02 • (I¡ años). Supuesto 2. sacrificados están en una edad entre 24 y 72 meses. En base a estos supuestos se establece que la edad de matanza y-u -=--c. .. Z .. 2.57 a IX )6-42 -1.28 a -0.64 16.08 EH4 3-4 42-48 48-54 0.00 a 0.64 EM5 4-5 54-60 0.64 a 1. z8 16.08 60-66 1.28 a 1.9) 7.35 EM6. 5-6 66-]2 1. 93 a 2.57 2.17 Peso (kgs): Vacas de desecho Toros de desecho Novillos (3-q años) ,Terneras (1-4' aRos) qOO 500 380 390 24 (10) -3.40 . 29.0 300 22 (8) -2.40 27.7 273 21(7) -1.90 26.6 450 17 (3) .00 22.9 300, 15 (1) 1.23 20.5 23.89 Vacas lq 14 (O) 1.40 20.0 20 -0.64 a 0.00 2).89 Relación toro:vaca Tasa de reemplazo (%): Toros 0.05 20 17' TECNOLOGIA TRAOICIONAL 0.07 de los vacunos (V) se distribuye normalmente: 12-18 -).85 a -3.21 0.06 [HZ 1-2 18-24 -).21 a ;-2.57 24-)0 -2.57 a -1.93 2.17 EH3 2-) 30-)6 -1.93 a -). 28 7.35 'Natal idad (%) Mortal ¡dad (%): ,Jóvenes Adultos 79 45 5 1 60 (40) -6.90 7(,.0 3 50 (30) -3.65 68.0 6 35 (15) 0.05 58.0 40 (20) 1. 95 53.6 0.44 Capacidad de carga (ha!UA) 1.5 32 (12) 3.00 50.7 7.0 30 (10) 3.68 42.6 Que el novente y nueve por ciento (99%) de los\"animales 0-6 -5.14 él -4.50 0:00-EHl 0-1 6-12 -4.50 a -3,85 0.00 Parámetros técnicos mejorada 20 7.70 38.7 (O) tradicional TECNOLOGIA MEJORADA Tecnologia nfecnologfa demanda y déficit de carne vacuna. Cuadro 17. Colombia: parámetros técnicos emplea~ dos para generación de inventarios • . -)1 • \\01 ~., 'ti • .' ' . • , . , Cuadro 18. DISTRlBOClOO DE EDADES DE SACRIFICIO DE MACHJS AStMIEN:lO UNA DISTRlBUCION ~ Cuadro 19. Colombia: distribución teórica por edades de la matanza Cuadro 24. Colombia -Llanos Orientales: comportamiento de vacunos machos Variable edad Area bajo del inventario y de la producción para consumo Cuadro 27. Colombia -Llanos Orientales: estimación de la bajo diferentes políticas de ventas oferta de carne vacuna para consumo asumiendo un patrón de alta difusión de nueva tecnología 1 • Categorías la curva del mode 10 Meses Standari zada normal de Edad y-¡¡ (y) z=-(%) inventario (ailos) (1 • . , , Cuadro 23. , Colombia -Llanos Orientales: para simulación del 'desarrollo diferentes tecnologías parámetros técnicos usados del hato en fincas bajo Tasa Produce ión para 1980-2000 Porcentaj e de venta de vacas de crecimiento del inventario Porcentaje consumo/cabeza en inventario kg/cabeza/año , Año Sector Sector Total trad le iooa I moderno N '\" .::-VI . .' , \" . . • •. : , • '.de cabezas ------.----69.$ 827 1101 -139.0 777 928 -69.5 868 711 69.5 1025 810 139.0 1118 1028 69.5 1070 1211 -6:3.5 951 1090 -139. O 902 1070 -69.5 992 69.5 i153 139.0 1243 69.5 1193 -69.5 1076 -139.0 1027 -69.5 1117 69.$ 1278 69.5 1319 -69.5 1200 -139.0 1152 el AT -1 nforme Anua 1 1978, Y Eugen I a de Rub i ns te in 139.0 619 657 1971 896 69.5 570 599 1972 916 -69.5 451 549 1973 937 -139.0 1;03 444 1974 956 -69.5 493 483 . 1975 979 69.5 653 586 1976 1000 139. O 71;3 648 1977 1020. 69.5 694 617 1978 1041 -69.5 577 544 1979 1062 -139.0 528 572 1980 1083 • -69.5 617 624 1981 1104 69~S 778 715 1982 1124 139.0 868 802 1983 1145 69.5 820 843 1984 1166 -69.5 702 868 1985 1187 -139.0 653 718 1986 1208 -69.5 743 647 1987 1228 69.5 903 693 1988 1249 139. O 993 781 1989 1270 69.5 . 944 954 1990 1291 DANE. Boletín Mensua I de Estadística años que pasan -al hato de cría (p) 479 500 521 542 ,63 584 604 625 646 667 687 708 729 750 771 792 812 833 854 875 Fuente: 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 . 1967 1968 1969 1970 i< 0.90 86-92 92-98 4.50 a 5.14 0.00 ).85 a 4.50 0.00 hembras por encima de la tasa normal de desecho. Proporción de vaquillas de 3 a q 0.10 ]2-80 2.57 a . 3.21 0.44 TT 80-86 3.21 a 3.85 0.06 Fuente: La cifra entre paréntesis indica el porcentaje de venta de + de 6 años que pasan al hato de cría (~) 139.0 1367 Cuadro 15. Colombia: proyecciones del sacrificio de machos. 1956-1990 Sacrificio estimado Sacriflc lo Sacrificio estimado Sacrl flc lo Año Tendencia Ciclo Total observado i , Año Tendencia Ciclo Total observado* Colombia: proyecciones de producción, 1979-2000 Demanda Déf ici t Producción Crecimiento del Crec i m•¡ ento de l Mo total In¡¡reso ingreso bajo alto bajo alto ganaderos -Parámetros técnicos Tasa de mortalidad animales: 0-1 año t -2 años 2~3 años 3-/¡ años 4-5 años Más de 5 años Relación toro/vaca (~l Proporción de terneros nacidos destinados a reproducción (al Proporción de vaquillas de 2 a 3 Porcentaje 4.5 4.0 3.5 3.5 3.5 3.5 0,04-0.02 • (I¡ años). Supuesto 2. sacrificados están en una edad entre 24 y 72 meses. En base a estos supuestos se establece que la edad de matanza y-u -=--c. .. Z .. 2.57 a IX )6-42 -1.28 a -0.64 16.08 EH4 3-4 42-48 48-54 0.00 a 0.64 EM5 4-5 54-60 0.64 a 1. z8 16.08 60-66 1.28 a 1.9) 7.35 EM6. 5-6 66-]2 1. 93 a 2.57 2.17 Peso (kgs): Vacas de desecho Toros de desecho Novillos (3-q años) ,Terneras (1-4' aRos) qOO 500 380 390 24 (10) -3.40 . 29.0 300 22 (8) -2.40 27.7 273 21(7) -1.90 26.6 450 17 (3) .00 22.9 300, 15 (1) 1.23 20.5 23.89 Vacas lq 14 (O) 1.40 20.0 20 -0.64 a 0.00 2).89 Relación toro:vaca Tasa de reemplazo (%): Toros 0.05 20 17' TECNOLOGIA TRAOICIONAL 0.07 de los vacunos (V) se distribuye normalmente: 12-18 -).85 a -3.21 0.06 [HZ 1-2 18-24 -).21 a ;-2.57 24-)0 -2.57 a -1.93 2.17 EH3 2-) 30-)6 -1.93 a -). 28 7.35 'Natal idad (%) Mortal ¡dad (%): ,Jóvenes Adultos 79 45 5 1 60 (40) -6.90 7(,.0 3 50 (30) -3.65 68.0 6 35 (15) 0.05 58.0 40 (20) 1. 95 53.6 0.44 Capacidad de carga (ha!UA) 1.5 32 (12) 3.00 50.7 7.0 30 (10) 3.68 42.6 Que el novente y nueve por ciento (99%) de los\"animales 0-6 -5.14 él -4.50 0:00-EHl 0-1 6-12 -4.50 a -3,85 0.00 Parámetros técnicos mejorada 20 7.70 38.7 (O) tradicional TECNOLOGIA MEJORADA Tecnologia nfecnologfa demanda y déficit de carne vacuna. Cuadro 17. Colombia: parámetros técnicos emplea~ dos para generación de inventarios • . -)1 • \\01 ~., 'ti • .' ' . • , . , Cuadro 18. DISTRlBOClOO DE EDADES DE SACRIFICIO DE MACHJS AStMIEN:lO UNA DISTRlBUCION ~ Cuadro 19. Colombia: distribución teórica por edades de la matanza Cuadro 24. Colombia -Llanos Orientales: comportamiento de vacunos machos Variable edad Area bajo del inventario y de la producción para consumo Cuadro 27. Colombia -Llanos Orientales: estimación de la bajo diferentes políticas de ventas oferta de carne vacuna para consumo asumiendo un patrón de alta difusión de nueva tecnología 1 • Categorías la curva del mode 10 Meses Standari zada normal de Edad y-¡¡ (y) z=-(%) inventario (ailos) (1 • . , , Cuadro 23. , Colombia -Llanos Orientales: para simulación del 'desarrollo diferentes tecnologías parámetros técnicos usados del hato en fincas bajo Tasa Produce ión para 1980-2000 Porcentaj e de venta de vacas de crecimiento del inventario Porcentaje consumo/cabeza en inventario kg/cabeza/año , Año Sector Sector Total trad le iooa I modernoN '\" .::-VI . .' , \" . . •   Cuadro 25. Colombia: puntos elegidos para la estimación de la curva de adopción .. Cuadro 25.Colombia: puntos elegidos para la estimación de la curva de adopción..   Colombia: distribución teórica de sacrificios de vacunos machos según Colombia: distribución teórica de sacrificios de vacunos machos según    edades Adopción  Adopción • Adopción edadesAdopciónAdopción•Adopción • •  y t Edad: 0-1 año alta Total 1-2 años 2-3 años 3-4 años .I¡-5 años reproductores 24 I 5-6 años 1 20 50 O 10 20 1 O moderada Porcentaje: 0.0 100.0 0.5 2.0 9.5 10 30 40.0 8.0 40.0 10 20 lenta 5 O 10 1 15 20 I 72 • , • •y tEdad: 0-1 año alta Total 1-2 años 2-3 años 3-4 años .I¡-5 años reproductores 24 I 5-6 años 1 20 50 O 10 201 Omoderada Porcentaje: 0.0 100.0 0.5 2.0 9.5 10 30 40.0 8.0 40.0 10 20lenta 5 O 10 115 20I 72• ,  •   2.57     2.57 •2.572.57  "}],"sieverID":"3284493e-c40a-45ed-8235-7bdd76d87bd3","abstract":""}

data/part_2/04021d8bda9307f36475921cf283a191.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04021d8bda9307f36475921cf283a191","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d3ef5ee8-4e85-4d43-ad7c-b489aef68698/retrieve"},"pageCount":2,"title":"Climate Change, Agriculture and Food Security","keywords":[],"chapters":[{"head":"Research Themes and Areas","index":1,"paragraphs":[{"index":1,"size":26,"text":"CCAFS is structured around four closely interlinked global themes, currently working in five regions West Africa, East Africa, Latin America, South Asia and South East Asia: "}]}],"figures":[{"text":" Theme 1: Adaptation to progressive climate change Theme 2: Adaptation through managing climate risk Theme 3: Pro-poor climate change mitigation Theme 4: Integration for decision making: CCAFS Coordinating Unit, University of Copenhagen, Faculty of Science, Department of Plant and Environmental Sciences, Rolighedsvej 21, DK-1958, Frederiksberg C, Denmark Phone: +45 35331046, Email: [email protected] "}],"sieverID":"b5150c6d-e775-41a1-ab36-498532ed14a1","abstract":"The CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS) seeks to promote a food-secure world through the provision of science-based efforts that support sustainable agriculture and enhance livelihoods while adapting to climate change and conserving natural resources and environmental services.The Challenge for Agriculture and Food Security Climate change is an unprecedented threat to the food security of hundreds of millions of people who depend on small-scale agriculture for their livelihoods. Climate change affects agriculture and food security, and likewise, agriculture and natural resource management affect the climate system. These complex and dynamic relationships are also shaped by economic policies, political conflict and other factors such as the spread of infectious diseases.The relationships between all these factors and how they interact are not currently well-understood, nor are the advantages and disadvantages of different responses to climate change. In order to develop practical solutions for agriculture in the face of climate change, we need to integrate knowledge about climate change, agriculture, and food security in a meaningful and innovative way."}

data/part_2/045e58d68f3ada8177e6f3fb3b477020.json

@@ -0,0 +1 @@
+{"metadata":{"id":"045e58d68f3ada8177e6f3fb3b477020","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5664bb63-aef2-4665-977f-d75d125a4c5a/retrieve"},"pageCount":30,"title":"","keywords":[],"chapters":[{"head":"Materials and Methods","index":1,"paragraphs":[{"index":1,"size":20,"text":"Key of demographic characteristic in slaughterhouse workers and sellers: Experiences   Some attitudes are not in accordance with their practices."},{"index":2,"size":39,"text":" Apart from training programs, there is a need to better understanding about cross contamination problem in pork production chain and government should realize the real problem and cooperate with stakeholders to find the techniques or solve problems together."}]}],"figures":[{"text":"Figure 1 . Figure 1. Sampling plan of markets in Chiang Mai province "},{"text":"Figure 3 .Figure 4 .Figure 6 . Figure 3. Demographic characteristics of respondents (experiences) "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 2 . Total viable counts and Enterobacteriaceae counts in different types of 18 Microbiological examination in slaughterhouses 18Microbiological examination in slaughterhouses  samples at slaughterhouses  Criteria: samples at slaughterhousesCriteria:  Slaughterhouse Samples Carcass Unit log cfu/cm 2 40 3.09±1.34 n Mean±SD Lab carcass (TVC) ≤5 log Accept >5 log Poor Lab pork (TVC): SlaughterhouseSamples CarcassUnit log cfu/cm 2 40 3.09±1.34 n Mean±SDLab carcass (TVC) ≤5 log Accept >5 log Poor Lab pork (TVC):  Total viable count Knife Cutting board log cfu/cm 2 log cfu/cm 2 8 2.69±0.90 4 3.13±1.59 ≤5x10 5 cfu/g >5x10 5 cfu/g Lab knife, cutting board Accept Poor Total viable countKnife Cutting board log cfu/cm 2 log cfu/cm 28 2.69±0.90 4 3.13±1.59≤5x10 5 cfu/g >5x10 5 cfu/g Lab knife, cutting board Accept Poor   Hand washing log cfu/100 ml 16 6.79±0.70 (TVC) ≤10/cm 2 Accept Hand washing log cfu/100 ml 16 6.79±0.70(TVC) ≤10/cm 2 Accept  Slaughterhouse Enterobacteriaceae count Carcass Knife log cfu/cm 2 40 0.03±1.08 logcfu/cm 2 8 -0.06±0.02 >10/cm 2 Poor Lab carcass (EC) <3log Accept >3log Poor Slaughterhouse Enterobacteriaceae countCarcass Knifelog cfu/cm 2 40 0.03±1.08 logcfu/cm 2 8 -0.06±0.02>10/cm 2 Poor Lab carcass (EC) <3log Accept >3log Poor   Cutting board log cfu/cm 2 Hand washing log cfu/100 ml 16 2.90±0.80 4 0.61±1.02 Lab pork (EC) 0-1/cm 2 Accept >1/cm 2 Poor Cutting board log cfu/cm 2 Hand washing log cfu/100 ml 16 2.90±0.80 4 0.61±1.02Lab pork (EC) 0-1/cm 2 Accept >1/cm 2 Poor  "},{"text":"Table 3 . Attitude versus practice of sellers 24 Microbiological examination in slaughterhouses 24Microbiological examination in slaughterhouses Table 2.Total viable counts and Enterobacteriaceae counts in different types of samples at slaughterhouses Table 2.Total viable counts and Enterobacteriaceae counts in different types of samples at slaughterhouses   Samples Unit n Mean±SD Criteria SamplesUnitn Mean±SDCriteria  Slaughterhouse Carcass log cfu/cm 2 40 3.09±1.34 Accept SlaughterhouseCarcasslog cfu/cm 2 40 3.09±1.34Accept  Total viable count Knife log cfu/cm 2 8 2.69±0.90 Accept Total viable countKnifelog cfu/cm 28 2.69±0.90Accept   Cutting board log cfu/cm 2 4 3.13±1.59 Accept Cutting board log cfu/cm 24 3.13±1.59Accept   Hand washing log cfu/100 ml 16 6.79±0.70 - Hand washing log cfu/100 ml 16 6.79±0.70-  Slaughterhouse Carcass log cfu/cm 2 40 0.03±1.08 Accept SlaughterhouseCarcasslog cfu/cm 2 40 0.03±1.08Accept  Enterobacteriaceae Knife logcfu/cm 2 8 - Accept EnterobacteriaceaeKnifelogcfu/cm 28-Accept  count    0.06±0.02 count0.06±0.02   Cutting board log cfu/cm 2 4 0.61±1.02 Accept Cutting board log cfu/cm 24 0.61±1.02Accept   Hand washing log cfu/100 ml 16 2.90±0.80 - Hand washing log cfu/100 ml 16 2.90±0.80-  "},{"text":"Table 3 . Total viable counts and Enterobacteriaceae counts in different types of samples at markets samples at markets  "}],"sieverID":"c3df0806-1395-495c-9831-19f19ee84dd1","abstract":" To assess the level of KAP of food handlers in slaughterhouses and markets To assess the level of microbiological findings that indicated the hygiene in slaughterhouses and markets  KAP 8 Key informant -Personal hygiene -Cross contamination -Food borne illness -Time & temperature control Data collection  Microbiological examination • Total viable count (ISO: 4833, 2003E) • Enterobacteriaceae count"}

data/part_2/0478037a1a6a8613f51e478bb58660d4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0478037a1a6a8613f51e478bb58660d4","source":"gardian_index","url":"https://www.iwmi.cgiar.org/Publications/Working_Papers/working/WOR61.pdf"},"pageCount":30,"title":"","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":54,"text":"In the mountainous part of Sri Lanka there are numerous run-of-river systems known as amunas (anicuts). As in all parts of the world, people have long discovered how to capture streams by constructing weirs or making notches in the riverbanks to divert water to lateral canals that feed field terraces or small alluvial plains."},{"index":2,"size":285,"text":"Sri Lanka is famous for its numerous and ancient small tanks. However, these tanks occupy only one part of the island. Anicuts also constitute a very prominent feature of water use in the island, as shown in figure 1. The map is drawn from a first inventory of tanks and anicuts in the island carried out by the Department of Agrarian Services (DAS), which identified 12,353 anicuts. 1  It shows the location of the Uda Walawe basin, which comprises approximately 750 anicuts that serve an area of around 6,550 hectares (13,000 acres) cultivated by 20,000 farmers. These numbers are sufficient to demonstrate the importance of anicuts in the irrigation sector of Sri Lanka, despite the limited attention they receive from analysts and researchers. This exploratory study was designed to capture the main features of agrarian change in the upper part of the basin that depends mostly on anicuts. These anicuts amount to 59 percent of the total basin anicuts in terms of numbers, but to only 43 percent in terms of irrigated area. They are generally very old (the history of some of them goes back to 2000 years; see below) and obviously, many changes have occurred during this time. The study does not allow the reconstitution of all past transformations but offers some insight on recent changes: changes in population pressure over resources and changes in hydrology, crop choice, livelihoods and collective action. The analysis is based on exploratory surveys carried out by the authors and by students of the University of Sabaragamuwa and is not a detailed or in-depth investigation of agricultural systems in the Upper Walawe basin. However, it provides a useful outline of the situation in this part of the basin."},{"index":3,"size":112,"text":"Altogether 25 streams, with 120 anicuts, have been investigated. For each stream, between two and five anicuts were examined in more detail by interviewing key informants (particularly, elderly people) and farmers in the fields. Therefore, it would be tedious to present here the findings of all these surveys separately. Rather, we have chosen to review a range of salient issues and, for each of these, attempted to draw a general picture from our observations, also providing examples of specific situations to illustrate both common trends and the diversity of situations. Figure 2 indicates the portions of the streams that have been surveyed (the numbers indicated will be used hereafter in the description). "}]},{"head":"The Walawe Basin and the Study Area","index":2,"paragraphs":[]},{"head":"Main Physical and Human Features","index":3,"paragraphs":[{"index":1,"size":157,"text":"The Walawe river basin is the largest basin in southern Sri Lanka and covers a total area of 2,442 km 2 . The basin spreads over the Ratnapura, Badulla, Moneragala and Hambantota administrative districts. The Walawe river originates in the southern edge of the central uplands of the country and flows southward, reaching the sea at Ambalantota. The upper Uda Walawe basin is a mountainous area with a maximum elevation of 2,395 m and, together with the western fringe of the basin, it constitutes the \"water tank\" of the basin. Indeed, annual rainfall varies from close to 4,000 mm in the higher parts of the basin to around 1,000 mm in the southernmost part. Threequarters of the basin lies in the dry and intermediate zones. Average daily evaporation is 6 mm in the dry seasons and 4 mm in the wet season. The average relative humidity is 70-82 percent and the average annual temperature is 27.5 °C."},{"index":2,"size":86,"text":"Figure 3 shows how the upper catchment topography is characterized by a steep terrain drained by north-south streams on which anicuts have been constructed. The three westernmost streams (Walawe ganga [river], Denagan oya [stream] and Belihul oya) feed into the Samanalaweva dam, which is used mostly for energy generation and regulation of the flow to downstream irrigated areas. The dam has been in operation since 1992 and its construction has resulted in the displacement of local populations, albeit in limited numbers.   4. Land use (1956 and1985)."},{"index":3,"size":107,"text":"The vegetation of the upper basin is quite varied and includes areas afforested with pines, secondary thick forests, tea estates, grasslands, bushlands, chena (shifting cultivation) lands, paddy fields irrigated by anicuts, etc. Figure 4 provides an idea of the land cover in both 1956 and 1985. Although the categories of land use and the basin boundaries do not fully correspond, it can be seen that tea plantations have shrunk, and that afforestation has spread. On the eastern part, rubber plantations have disappeared and a large area of paddy cultivation has emerged. A large part of the area between Kaltota and Samanalaweva has shifted from Savannah to forest."},{"index":4,"size":34,"text":"Anicuts, and their corresponding irrigated areas are, of course, located along the various streams coming down from the mountainous fringe towards the center of the basin. Figure 5 shows the location of the anicuts."},{"index":5,"size":95,"text":"The population in the upper basin tends to be concentrated along both waterways and roads, and villages are more of the ribbon type than of the cluster type. Population densities (175 persons per km 2 ) are lower than the basin average (244 persons per km 2 ) but this is because of the large portion of the land under state reservation or on too steep a slope to be cultivated. Table 1 indicates the area and population of the basin and its upper part.  Note: GNDs = Grama Niladhari Divisions (lowest government administrative divisions)."},{"index":6,"size":34,"text":"Figure 6 shows the density of population in the area. Unsurprisingly, both the Balangoda and the tea plantation areas stick out, with densities over 300 persons/km 2 . Figure 6. Population density (Census, 2001)."}]},{"head":"Historical Background","index":4,"paragraphs":[{"index":1,"size":121,"text":"The history of man's settlement in the Balangoda city, which straddles the western boundary of the Walawe river basin, and its surrounding valleys, goes back to 6,500 years (Deraniyagala, undated). The area now submerged by the Samanalawewa dam, for example, was a prehistoric campsite. Sri Lankan legends, as well as Valmiki's Ramayanaya, report that King Ravana, who lived in this area around 1500 BC and ruled part of Sri Lanka, resided in the Walawe basin before departing to India to capture Rama. He ended up by bringing back from his campaign Sita, wife of Rama, and hid her unmolested in some parts of the Walawe basin, which fact is attested to by much archaeological evidence and many locational names (Witharana 1992)."},{"index":2,"size":247,"text":"Historically, Sri Lanka was divided into three main parts: Ruhuna, Maya and Pihiti for convenience of rule. The Upper Walawe basin was located at the ill-defined boundary of ancient Ruhuna and Malaya (central highlands) (Juleff 1996). It was closely connected with Magama (now Mahagama), which was the capital of Ruhuna (Collins 1932). While King Dutugemunu (161-137 BC) was residing in Ruhuna and Malaya, and later in Anuradhapura, he developed paddy fields extensively in the southeastern part pf Sri Lanka, including anicut-based irrigation systems upstream of Walawe. At the time King Walagamba (104-76 BC) had taken refuge in Malaya he developed anicut systems also upstream of Walawe. (Ghanawimala 1942;Narada 1992). In the Kandyan period (1524-1815) there were also significant migration and settlement in the area (with the founding of several temples). Kaltota, located 14 km southeast of the Balangoda town, was an ancient kingdom, which developed in parallel to the Anuradhapura kingdom around the second century BC (Narada 1992). According to the Sabaragamuwe Parani Liyavili 2 (collection of old documents of Sabaragamuwa) Kaltota was the most developed city of Sabaragamuwa (Ghanawimala 1942). The area that lies between the Samanalawewa dam and the Kaltota irrigation scheme, a few kilometers downstream, has yielded many ancient artifacts. In particular, a unique wind-powered iron-smelting furnace was unearthed, which used the high-velocity winds during the southwest monsoon capable of producing high-quality steel that was supplied to the Islamic world for sword-making from the third century BC to the twelfth century AD (Juleff 1996)."},{"index":3,"size":295,"text":"One of the most significant irrigation works of the Upper Walawe basin was the depa bandi amuna (anicut that diverts water to two sides) on the western edge of Kaltota, constructed at the place where Belihul oya meets the water of the Doowili ella waterfall. The left bank canal, which had been excavated down to Hambegamuwa, provided water to several cascade networks, which consisted of 138 tanks and 18 anicuts (Narada 1992). 3 There is evidence to assume that the area from Kaltota to Magama from the east and Embilipitiya from the south was a single field and developed as one area. Handagiriya, or Sandagiriya, presently called Katupath oya gama and located in the north-western corner of Uda Walawe National Park, was the center of the ancient Kaltota kingdom. The ruins show evidence of many tanks that have functioned in this area, out of which only five are still in use (Medhananda 1992). It was a prosperous area from the second century BC to the fifteenth century AD and was later almost deserted. In 1622, in the reign of King Senarath, Kaltota was a storage village whose population had declined drastically, probably because of repeated attacks from enemies (Ghanawimala 1942(Ghanawimala , 1967;;Narada 1992). Despite some settlement and rehabilitation works in 1885, the population was still sparse in the middle of the nineteenth century when C.H. Collins, Government Agent of Sabaragamuwa, reported that Sandagiriya was a thick jungle area infested with malaria and populated with only 18 persons when he visited it (Abeyratna n.d.). Collins (1932) also noted that \"Ratnapura Bintenna colony [Kaltota] appears to have been as much advanced at the time as any other parts of the island… settlers had a full knowledge of irrigation engineering as practiced in the country at the time\"."},{"index":4,"size":144,"text":"All this historical evidence confirms that the beginning of the establishment of these settlements, tanks and anicuts, took place at least two centuries before the Christian era. Since it is not possible to identify the origin of most anicuts, the questionnaires that we used included the question of whether the construction of these anicuts was dated from the time of kings, from the time of the British rule, or during Post-Independence. The following table shows the distribution of our sample according to the period of construction. It shows that 66 percent of the anicuts were constructed during the time of kings and that this predominance of old anicuts is even higher when expressed in terms of irrigated area (85%). This suggests that the most easily accessible locations, including scattered wider alluvial plains, had been brought under cultivation first, much earlier than the British period. "}]},{"head":"Description of the Anicuts","index":5,"paragraphs":[]},{"head":"Construction","index":6,"paragraphs":[{"index":1,"size":214,"text":"It is hard to derive a clear sense of how anicuts are successively added to a given stream. Does construction tend to start in upstream parts and then proceed downstream? This would be consistent with the notion of water rights that give priority to the first established, since downstream appropriators do not impinge upon others' rights. But it may also be the case that since water is plentiful further upstream development does not affect existing ones, or that these new anicuts are constructed by the downstream settlers themselves, or their relatives. Evidence from the survey shows that anicuts constructed in the British period tend to be situated downstream of already existing ones, but there are a few counterexamples, particularly of small anicuts in smaller streams. In some cases, there is even transfer from on-stream to the neighboring ones. This is the case with the Belihul oya, from which a major anicut and a canal take water to the adjacent river, itself a tributary of the Belihul oya with a much less catchment area but with a better and larger potential irrigated area. In the Ranmudu oya, two anicuts bring water to the nearby Gurumati oya where two small anicuts are located. This diversion is used only when the Ranmudu oya has excess water (A3)."},{"index":2,"size":278,"text":"The anicuts supply the two banks of the river or a single bank, depending on the topography and the availability of water in the streams. The command area is generally located close to the anicut, further downstream but, in some cases, a flat topography and the lack of adequate land dictate that the diversion point be located a few hundred meters upstream of the irrigated area. In most cases, farmers themselves have built these anicuts. In some areas, these are made by just placing a few stones or logs across the stream to divert the water. In the recent past, most of these anicuts were rehabilitated under various programs launched by NGOs as well as by the government, including the Samurdhi Program and two major projects in the 1980s: the Integrated Rural Development Project (IRDP) and the Village Irrigation Rehabilitation Project (VIRP). The largest ones are managed and maintained by the DAS (and in some cases by the Irrigation Department). Under these programs the diversion weirs were made out of concrete and canals were sometimes lined. Due to rehabilitation, farmers experienced benefits as well as problems. Before rehabilitation, the weirs used to be washed out during the rainy season, but now they need not be repaired every year, and the anicuts are more reliable. The conveyance efficiency and diversion increase, allowing farmers to expand their command areas. This may affect downstream anicuts, as more water is diverted by upper anicuts and return flows are reduced. As is the case in most communal run-of-river systems, the reduction of maintenance work has also weakened the cohesion of the group derived from the necessity to rebuild the weir structure every year."}]},{"head":"Landownership","index":7,"paragraphs":[{"index":1,"size":96,"text":"In general terms, most farmers cultivate very small plots and the average size generally varies between 0.2 and 0.6 hectare (0.5 and 1.5 acres). There are, however, several exceptions to that situation. In a few cases, some land concentration has occurred, often because a local businessman 4 or moneylenders have acquired land given as collateral to loans (e.g., Mr. Hantha, a gem businessman in A5/2). In another anicut (A2) command, there is a large landowner (also the owner of a tea factory) who inherited the land from his father who had bought it from other villagers."},{"index":2,"size":246,"text":"In all cases, these large landowners hardly own more land than one family can farm by itself. Some exceptions can be found in the eastern part of the study area, in the Diyakanna oya catchment (C20), where it seems that colonization has been different and seems to have been partly of the plantation type. In fact, some \"large-scale\" commercial farms can be found in the area, but these are not irrigated farms: the largest landowner resides in Colombo and has 26 hectares (64 acres) of rubber with pepper intercropped, while another property of 10 hectares (25 acres) is planted to tea and pepper. In C19, one man owns 36 hectares (90 acres), including rubber, tea, pepper and paddy land. These lands, however, mostly comprise upland areas. The conclusion is that, in general, land in anicut systems has been fragmented and has rarely been significantly concentrated in the hands of a particular individual. The \"biggest\" landowners, or considered as such by local farmers, generally have between 2 and 4 hectares (5 and 10 acres), which are not much in absolute terms but may sometimes make up one-third or more of the anicut command area. In contrast, nonirrigated lands are sometimes held by middle-size commercial farmers, especially in the eastern part. It is apparent that land division at inheritance also works against land concentration; for example, a former \"large\" landowner in the A2 area had 6.1 hectares (15 acres) but today his land is divided among his children."},{"index":3,"size":53,"text":"The small size of the family plots suggests that land division has long reached a level where further division among heirs is unsustainable. While, despite variations, the cultural norm would tend to favor equal division amongst heirs, it is apparent that this custom is severely constrained and has given place to several alternatives:"},{"index":4,"size":57,"text":"• The most important one is the system of thattu maru, whereby the children of the landowner get access to the land in turn, often waiting several years before having the right to cultivate for one season 5 (A1, A2). In addition, whoever cultivates must give a certain amount of rice (e.g., 2 bushels) to his siblings."},{"index":5,"size":41,"text":"• The youngest son receives the house and the others a portion of the land (in case there is no land asset, the younger son/daughter would also receive the house and would take care of his/her parents in their old age)."},{"index":6,"size":32,"text":"• Land is given to one particular offspring, to the daughter (daughters) as dowry (dowries), or to the son who engages in farming (when other siblings opt to move out of agriculture)."},{"index":7,"size":126,"text":"The proportion of tenants is variable but often very high (two-thirds or more), although data from the DAS relative to a total of 60 anicut commands point to a tenancy rate of 48 percent. This reflects not only a skewed distribution of land and the importance of land belonging to temples/ devalas (shrines constructed to worship deities), but also the fact that some landowners have moved to other activities and released land to the rental market. Because of the small size of the anicuts, it can be hypothesized that most rental arrangements are done either directly with temples or between relatives, but this needs to be substantiated by more in-depth investigation. 6 The land rent is still paid in kind, generally between 8 and 10 bushels."},{"index":8,"size":84,"text":"Temples and devalas 7 were major landholders in the past and still retain some rights in many places, such as in A3/5 and A5/4, where most of the land belongs to the temple, or in A4/2, where Morahala was a viharagama (temple land), given by Parakramabahu VI (1418-1458) to the Saman devalaya of Sababaragamuwa. The Morahala temple also owns 2 hectares of land, donated by a radala (high-class) landowner. Religious offerings, such as land, add to whatever other historical rights the temples have retained."},{"index":9,"size":148,"text":"Some legends also point to the way land was formerly gifted by kings. In B14, in the reign of King Sriwikrama Rajasinghe (1797-1815), a rebellion occurred near the Kalupahana bridge. Mudliyar Weerakoon suppressed it and the king rewarded him with the land of the area (Weerakoongama). Oral tradition has it that a king had visited the area in C20 and donated its paddy land to the Eria Kadura family. In A4/1 and 15/1, the totality of the land earlier belonged to one radala family called the Rathwatta 8 family. This family had received the land from the king (nindagama/bandara idam, or feudal land) and the harvest was divided into three portions: one for the king, one for the landlord and the remaining part for the farmers. The farmers were eventually given the land after the 1956 agrarian reform (on condition that they contribute labor to some public works)."},{"index":10,"size":80,"text":"In Soragune (C15-16), there is a very old devalaya (Soragune Kudakatharagam devalaya), which owns large tracts of land where people have settled. The devalaya was destroyed by the Dutch but was reconstructed and is still serves its old purpose. According to historical records (inscription of the devalaya) Kudakatharagam devalaya was constructed by a yapa (a ruler of a small province) who was seeking the blessing and protection of god Katharagama while he was away, living in the Uggal Aluthnuwara palace."},{"index":11,"size":134,"text":"In several cases, too, farmers received the ownership of land through public redistribution. Under the Irrigation Ordinance of 1946 some tenants received land (but still do not have deeds for the land: A4/1), while some tenant cultivators or even migrants benefited from the Agrarian Service Act of 1979 (A1, A2). In B11, too, the upper part of the land was given to farmers as Jayabhoomi oppu (Jayabhoomi land deeds) under the Land Reform Act of 1972. In the lower Belihul oya catchment, after the Second World War each farmer received the ownership of 0.4 hectare (1 acre) of land (for paddy cultivation as well as for building a house) through the LDO scheme (Land Development Ordinance of 1935, implementing the distribution of some public land), as well as Rs 1,500 to build a house."},{"index":12,"size":142,"text":"In B10, only 3 out of 20 families are cultivating their own land. The owners live in the Muttetuwegama area and cede their land to migrants from Badulla, Hambantota and Tangalle, and the population there is said to be still on the rise because of the good climate and the availability of water resources. In C17, a hundred families cultivate land that used to belong to an Indian owner who sold it before the Land Reform Commission (1972) came into effect. These farmers came from various places, as distant as from Matara. In C18, a rubber plantation of the British period was neglected by their (absentee) owners; after Independence the rubber trees were eventually cut down (for fuelwood) and the land given to people as Jayabhoomi oppu after 1972. Some Tamil workers remained in the area and the people developed their anicuts."},{"index":13,"size":113,"text":"All these examples show that the origin, settlement and acquisition of landownership are extremely varied from one place to another. Most of the lands in the time of kings seem to have been feudal lands or to have belonged to devalas but their ownership has gradually passed on to the hands of local people 9 through the 1935 LDO, the 1946 Irrigation Ordinance and the 1972 Land Reform Act (Ellman et al. 1976). However, tenancy remains quite high, showing that these reforms have not been fully effective and that many villagers endowed with land are not engaged in agriculture and rent out their plots. A more detailed analysis is needed to confirm this."}]},{"head":"Water Status","index":8,"paragraphs":[{"index":1,"size":133,"text":"All the surveys show a clear (and expected) relationship between the position of the anicut along the stream and its water status. Usually, upstream anicuts have plentiful water in both maha (wet season from May to September) and yala (dry season from November to March). As we go down along the streams, anicuts are likely to experience some water shortages in some dry spells, while those situated further downstream may not have enough water to cultivate the full area during yala (B12/3). Of course, this general situation is altered when significant tributaries join the main stream. Such a counterexample can be found in C15, where the topography does not allow for much expansion of the irrigated land and where springs and lateral streams tend to increase the available water as one goes downstream."},{"index":2,"size":81,"text":"Strikingly, almost all interviewees argued that rainfall and water discharges have declined, especially during the last 10 years. These statements are, of course, qualitative and judgmental and may have been influenced by the recent drought periods of 2001-2002. However, the unanimity and the periods indicated for such decline suggest that this diminution can be considered as a credible and crucial evolution of the hydrological regime. Other induced changes in crop choice and collective action also strongly support this hypothesis (see below)."},{"index":3,"size":151,"text":"In the Belihul oya area, for example, farmers estimate that the flow at the Maha anicut is only half of what it was in 1990. In several areas (B12), springs that provide domestic water are reported to have decreased, or even dried up in 2001, with the decline of conservation forests. In A5/3, during some acute water shortage, water was diverted from the main rivers into tea land and the downstream anicuts were affected to the point that some crops have been lost. In A3/5, there is not enough water in the dry season and farmers have to face a severe water shortage. The farmers located at the tail end of the system get a smaller amount of water. All streams are said to undergo discharge reduction and this reduction is said to have surfaced between the last 5 to 15 years, with a clear aggravation during the 2001-2002 dry period."},{"index":4,"size":86,"text":"The reasons given by farmers for such a trend are diverse. Flows are said to have decreased in the rivers for the following reasons: 10 1. The plantation of pines in the upper parts of the catchment (B6, B13, B14, etc); like eucalyptus this alien vegetation is known for its high extractive capacity and is not well accepted by local villagers. 11 It is said to reduce the groundwater level and base flows in the dry season (B13); these pines were introduced in the early 1970s."},{"index":5,"size":42,"text":"2. Deforestation, destruction of forest cover for logging, chena cultivation, fuelwood for tea factories, timber for construction; fires are kindled by people raising animals and willing to expand pastures for them (e.g., A5/3), or by hunters chasing away animals to ambush them."},{"index":6,"size":13,"text":"3. The reduction of rainfall (also sometimes ascribed by villagers to deforestation: A1)."},{"index":7,"size":54,"text":"4. Expansion of tea estates. In a village of the A5 area, it is believed that change in runoff patterns comes from the use of the reservation area for tea cultivation. In the British period there used to be a separate land called \"ground land,\" but it has now been taken up for cultivation."},{"index":8,"size":23,"text":"5. Abstraction by the tea estate or commercial farms (A5/1;C16). The possible changes in water use in the upper anicuts are never mentioned."},{"index":9,"size":197,"text":"There is an apparent contradiction between the first two points, as both afforestation (planting commercial trees in natural open land) and deforestation (of primary or secondary \"natural\" forests) are held responsible for the decline in runoff. This issue has been at the core of the \"pinus controversy\" of the 70s and 80s in Sri Lanka (Starkloff 1998a, b). The likely explanation is that while natural forests tend to increase infiltration of rainfall into the soil, and reduce transpirationand thus the base flow to the river-in the dry season, pines intercept more rainfall, extract water from deeper soil layers and are an extremely water-consuming species, thus increasing the water uptake by vegetation and reducing the runoff coefficient. 12 Likewise, but this is probably more prone to local variations, the land exposed by the clearing of forest would develop a harder superficial layer that increases runoff in times of rain at the expense of infiltration and base flows (Elkaduwa and Sakthivadivel 1999). While this latter phenomenon is still controversial there is little question that the afforestation with Pinus caribaea has disrupted the catchment hydrology, as widely observed in the upper Mahaweli (Starkloff 1998b) and elsewhere (Scott et al. 2003)."},{"index":10,"size":204,"text":"Rainfall is also almost unanimously believed to have declined during the last two or three decades. Series of rainfall data from Balangoda (figure 7) do not really support this claim. Several informants underlined the fact that it is rather the unpredictability of precipitations that has been on the rise. An exception to this is that some people in Soragune (C16) think that rainfall has increased after the construction of the Samanalaweva dam. Wells are rare in the area. Domestic water is in general diverted from springs, often through pipe systems, which seem to have spread to almost all localities in the past few years. In the A1 area, however, a project of 10 tanks has been funded by a few foreign organizations, and people are using shallow wells as well. Recently, these wells have been polluted by the toilets of villagers and most houses now use tap water coming from the school premises. In B10, villagers have organized a shramadana (collective voluntary work) campaign to build a pipe system. In some areas (e.g., A4), villagers do have wells for domestic water but many dried up during the 2001 drought. The agro-wells in B11 and C17 were reported to be dry in August every year."},{"index":11,"size":77,"text":"The problem of excess water was found only at A4. The lower parts of the command area were flood-prone and usually irrigated only in yala. The reduction of the flow in the river in the last 15 years happened to be beneficial in that respect and part of these fields could be brought under cultivation during maha as well. Two tanks are supposed to store part of this excess flow but they are not functional any longer."},{"index":12,"size":65,"text":"Soil erosion is also a recurrent problem associated with land cover change (Elkaduwa and Sakthivadivel 1999). Several villagers reported that the improper management of tea plantations, particularly by smallholders, was resulting in land degradation and solid transport, a phenomenon observed in other parts of the country (Illukpitiya 1999). Occasionally, landslides occur, such as the one that recently cut the Balangoda-Badulla road (see bottom left photo)."}]},{"head":"Land Use and Crop Selection in Irrigated Areas","index":9,"paragraphs":[{"index":1,"size":52,"text":"Rice is the main irrigated crop under the anicut commands. Until around 1970, only one crop of a traditional variety, with a long growing period, was cultivated. With the spread of non-photosensitive High-Yielding Varieties, double-cropping was quickly adopted since, in most cases, water supply was sufficient to supply two crops per year."},{"index":2,"size":185,"text":"Other crops, however, have also gradually appeared in the irrigated areas, mostly during yala. Most commonly, farmers have grown bean, tomato, onion, chili, pumpkin (B7), maize (B8), cabbage (B14), aubergine (B7, C16, C18), okra (C18), snake gourd (A4/4), sweet potato (B8), cowpea, green gram (B11), or other crops such as radish and leema (vigna cylindrical) on a small scale for home consumption (A1). Tomato has been a very popular crop in the last decade and some areas (A2, A3, A5) have very suitable conditions of soil and climate for its cultivation. Sometimes it has been the main source of local income in recent years (B8, Belihul oya catchment). In addition, the market for tomato, although unpredictable, is said to be quite good because of the high demand for it at the Manning Market in Colombo. Traders pick up the product at the farm gate and transport it to Colombo, 13 or to wholesalers at Bandarawela (B10); other products are sent to the Balangoda market (B7/3) or to the Haputale market (C16). The expansion of tomato cultivation in the wet season is constrained by fungi problems."},{"index":3,"size":151,"text":"The shift to other field crops (OFCs) was due to two factors. The first (in 20% of cases) is the low profitability of rice, due to low selling prices and high production costs. In some cases, farmers even reduced rice production to the point that they had to buy rice for their own consumption, but there is a general reluctance to do so and they tend to first produce whatever rice is necessary for the family and then to allocate the rest of the land to cash crops. The second is the decrease in water supply, which precluded the growing of rice in yala (80% of cases). While farmers in most anicut commands tackle the reduction in supply by shifting to OFCs or by letting part of the land fallow, the farmers in the B20 area resort to the BG300 rice variety, which has a cyclic duration of only 3 months."},{"index":4,"size":70,"text":"Although most of this conversion of paddy land into OFC land is fairly recent (since 1985), it would be incorrect to think that vegetable cultivation started only in recent times. Indeed, in the 1940s, farmers in B7 began to grow vegetables during yala (aubergine, tomato, chili, etc.), but this was mostly for local consumption. In B8, B14 and C17 too, such cultivation has been practiced for four or five decades."},{"index":5,"size":31,"text":"The land under cultivation in the irrigated areas is often reported to have declined in the past years because of the construction of houses. Ricelands are also converted into home gardens."},{"index":6,"size":139,"text":"Our focus on the anicuts should not suggest that agriculture in rain-fed areas is negligible. In some areas, mainly in the eastern part (C15-16-17-18), upland agriculture takes precedence over irrigated crops. Villagers have a few acres of upland or home gardens and draw revenue mostly from cinnamon, pepper (sometimes intercropped with tea), areca nut, clove, and several fruit trees; for their consumption they grow mostly jackfruit, breadfruit, orange, banana and mango. In C17, people have from 2 to 2.4 hectares (5 to 6 acres) and they do mostly chena cultivation. They also cultivate sugarcane, make sugar honey and jaggery (and need fuel wood, which has depleted the surrounding forests, brought erosion problems and has affected springs). A rose plantation has sprung up in this area and it is reported that water from the river is used for this plantation."},{"index":7,"size":181,"text":"Chena cultivation used to be popular but has now widely disappeared because of the pressure on land resources. In A1, some of this former chena land has been reserved for state forest plantation. People feel that this has decreased the amount of land available to them. They also ascribe to this plantation the increase in damage from wild boars that have forced farmers to guard their chena fields during the night (B7), and even to abandon their fields (A1). In the western part (A2, A4), chena cultivation was seriously curtailed as early as the 1930s, when the British expanded tea plantations, 14 while in the Diyakannaoya area (B20) chena cultivation disappeared in 1975. Some of this earlier chena cultivation land has been turned into tea land, not by tea estates but by peasant farmers who, incidentally, sell their tea leaves to the Pinnawala factory (B6) or other factories (A3/2). This is said to provide these farmers a fair income. It was only at B14/2 that chena cultivation was reported to be on the rise, presumably at the expense of reservation forests."},{"index":8,"size":91,"text":"In the A1 vicinity there used to be 20 hectares (50 acres) of forest but this land cover has now dropped down to 4 hectares (10 acres), a part of it having been planted with pines and the greater part turned into a tea plantation (A1, A2). Other nearby areas, planted to tea in British times, have later been planted to sugarcane by the villagers. This crop has now drastically declined because it must be transported to the factory down at Uda Walawe, which is costly and affects its economic profitability."},{"index":9,"size":21,"text":"Home gardens are everywhere and they are of great importance for the provision of fruits, vegetables, medicinal herbs, spices, flowers, etc."}]},{"head":"Livelihoods and Economic Diversification","index":10,"paragraphs":[{"index":1,"size":48,"text":"Many farmers growing rice in the areas served by anicuts could still be considered mainly as farmers but economic diversification is also quite high, especially at the household level. Alternative economic activities are similar to those observed in other parts of Sri Lanka (Marzano 2002;Van der Molen 2001)."},{"index":2,"size":74,"text":"A large number of girls have migrated to factories in the free trade zone of Biyagama (A2) and commute to Balangoda (A1, A4), Bathgama (C17) and Diyathalawa factories (C16), or elsewhere (B7, B14). There is also a garment factory in Rye Wattha, which employs youth from the surrounding areas. In A2, young men have joined the army in considerable numbers or gone to the cities for various types of employment (e.g., B7, B14, C16)."},{"index":3,"size":87,"text":"A large number of villagers in A1 and A2 are reported to do carpentry and masonry, which are quite popular occupations among the youth. People are commuting to Balangoda and Ratnapura. A very significant employment opportunity in the area is work in a tea estate: In A1, farmers are said to have become workers, plucking tea at the Allearawa estate. In A2, 100 people work in the Blue Mountain tea factory. Many people are also employed in the Belihul oya (B7) and the Black Wood (C20) factories."},{"index":4,"size":39,"text":"Some villagers are employed locally in government jobs (such as being nurses, teachers, police officers, etc.), as well as being drivers, bakers, or rice mill workers; some have opened boutiques or have found occupation in the University of Sabaragamuwa."},{"index":5,"size":26,"text":"In A2, a vocational training center was established 15 years ago, in order to bring in and disseminate new skills and support the creation of jobs."},{"index":6,"size":34,"text":"Illegal timber extraction is also locally significant (A3, C17) while activities like sand collection and gem mining are very site-specific (A1/2; A4/2; B11); other common activities include the production of illicit liquor and toddy."}]},{"head":"Population and Migrations","index":11,"paragraphs":[{"index":1,"size":41,"text":"It is difficult, of course, to account for early migration flows into the area. A major migration movement in the nineteenth century was that of Tamil people brought by the British, especially in the early 1830s for tea cultivation (Madekkanda estate)."},{"index":2,"size":186,"text":"While the area, particularly the vicinity of Balangoda and Kaltota, has been settled for a very long time, population growth and pressure over resources have become critical in the twentieth century. The Maha anicut of Belihul oya, for example was constructed at the time of King Mayadunne (1521-1581 AD) and was reported to serve only 80 families in 1900. A family in the early part of the century would easily farm an area of between 2 and 4 hectares (B7). With the growth of population the area expanded and the anicut is now said to supply water to the land of 1,500 households (interviews in B7). This increase makes up for both natural growth and the inflow of migrants from the Balangoda area; in particular, some farmers received land at the time of the land reform. In the A4/2 area, there were only a few families 50 years ago, but it is now home to around 90 families. In A2, there were only 150 to 200 families in the 1940s, while there are now about 500 families; but no migration is taking place at the moment."},{"index":3,"size":58,"text":"In several areas (B6, B12, C19), most people, including youth, are engaged in agriculture (tea, paddy, OFCs; banana in C19) and migration for economic reasons is said to be very limited. In contrast, in other anicut areas many of the youth work in factories or have migrated to cities (A4, B14, C18, C20) like Balangoda, Ratnapura and Colombo."},{"index":4,"size":164,"text":"The interviews have yielded a series of hints on some of the migration fluxes into the area. In A2, early migrants came from Kalutara and Maggona to engage in trade. Another village has been settled in the late nineteenth century by Christians migrating from Beruwala and Maggona, also for trade. Some people from Embilipitiya and Galle are also said to have moved in for diverse motives (opening boutiques or because of marriage) (A1). A reverse flow was observed late in the 1950s when villagers of the area (A1, A2) migrated to Kaltota or Madabadda, where some land was made available and distributed through the land reform implementation. More intensive settlement in this area had been earlier constrained by the prevalence of malaria. Some (A3/4) went to Uda Walawe when the Mahaweli Authority distributed land, but some of them later returned to the village because they found that the land they had received under the land reform implementation was too far away from their village."},{"index":5,"size":83,"text":"One family in A5/4 and several others in B13/2 migrated to these areas because of the construction of the Samanalaweva in early 1992. The command area under the main anicut on the Belihul oya (Deyiyange amuna) was also increased by 20 hectares to accommodate settlers displaced by the construction of the dam. The tank submerged around 800 acres of the land of Uggal Aluthnuwara Kataragama devalaya and many people who provided services to the devalaya were sent to the Mahaweli area (Gunasena n.d.)."},{"index":6,"size":13,"text":"In the study no evidence of significant emigration to foreign countries was found."}]},{"head":"Water Management and Collective Action","index":12,"paragraphs":[{"index":1,"size":349,"text":"There is a clear-cut correlation between the water regime and the type of water management in the command areas of the anicuts. When water supply is satisfactory, continuous free flow is the rule. Return flows are high, since a great advantage of such mountain irrigation schemes is that all the excess water is quickly returned to the river, incurring very few losses. When water gets scarce, farmers, as expected, set up some kind of rotational arrangement (mura). This arrangement can be simple (e.g., 3 days for each of the two canals), but can also be more elaborate, with a certain amount of time allocated to each plot (or each farmer) (3 hours per acre in A3/4; 6 hours per quarter of an acre in B14; time according to plot size and location in A4/2, etc.). In rare cases, as in A2, the corresponding schedule is kept in written form. In C17, the arrangement follows the traditional bethma system, whereby all farmers will have access to some plot close to the anicut, proportionally to their land area. The schedule is commonly set up by the Farmer Organization (FO). When the scheme is not too large, farmers enforce and manage it by themselves; in larger schemes a person is responsible for monitoring and enforcement, either someone appointed by farmers or a govi niyamaka 15 (government agricultural agent). Earlier, a Gamarala (traditional leader at the village level) handled water-management activities using traditional norms and principles. In 1917, during the British period the authority for water management was handed over to the vel vidane (village-level irrigation officer first selected from the community but later appointed by the government) (see Weerawardena 1986). The vel vidane wielded great authority, and punishments were often severe (A1); in some places, villagers recall that the vel vidane would severely punish any wrongdoing in water management even \"if they broke a branch of some valuable tree\" (B7). Later, responsibility was shifted to government agents, who bore different names from one reform to the other: the palaka lekam, waga niladhari (cultivation officer), and grama niladhari (lowest-level government administrative officer, B7)."},{"index":2,"size":28,"text":"Likewise, before FOs were established in 1992, the government had established similar successive organizations: govi samithi (farmer organizations), govi samaja (farmer societies) and govi sanvidhana (farmer associations), (B6)."},{"index":3,"size":100,"text":"Allocation among users of the same stream sometimes gives way to collective negotiations and agreements, such as in the case of Belihul oya. Villagers beat \"andaberaya\" and get all the groups along the river to negotiate. Conflicts are rare but an exception is the pumping of water from the Kirikali oya to convey water to the University of Sabaragamuwa and its vicinity. Local farmers have tried to blast or to obstruct the pipe in the past, and it is to be feared that the conflict will reappear at the next drought (especially because domestic water needs are on the rise)."},{"index":4,"size":106,"text":"There is also one case of \"federation of anicuts\" or, rather, of a set of 20 anicuts, which are controlled by the Ekamuthu Govi Sanvidhanaya, an association that comprises 250 families in the C19 area and that manages two wasams or regions. In C16, the Soragune village has a population of 600 (142 families) and it gets water from two streams that serve 15 anicuts and 50 acres. In case of water shortage, the upstream anicuts are not served. The \"adviser\" of the organization is the monk of the temple. In B11, an FO controls three successive anicuts and devises allocation rules if the need arises."},{"index":5,"size":55,"text":"Apart from these examples, there is generally little interaction between anicuts, even if they are water-short and obviously dependent upon how much water is used upstream. An exception to this is the set of anicuts on the Gima ela river, a branch of Walawe (A4), where some discussions take place in case of water shortage."},{"index":6,"size":184,"text":"In addition to water management, the FOs usually perform the maintenance of the anicuts and the canals, as well as other tasks, such as setting up fences around the fields. Most often, the responsibility of the ela pollas (canal reaches or lengths) rests with the various water users. In other cases, the dredging of canals is done through shramadana and there are provisions to fine those who shirk work. The FO is also instrumental in keeping contact with related government institutions such as the Department of Agriculture (B14, A4/2), or NGOs (JAICA, IRDP). In a few cases, the FO is also involved in the supply of seeds and small trees (A2, B10, C17) and in providing credit facilities (A3/4, B14/3) or fertilizers (B13/4) to members. In A2/3, the FO is quite effective and was given sprayers 16 by the DAS. In B10, the FO is led by a reputed leader and it was instrumental in setting up a domestic water project. In B11, the FO manages three anicuts, levies high fees (Rs 60/month) and engages in subcontracting with a profit margin of 5 percent."},{"index":7,"size":62,"text":"In B9, existing organizations often revolve around temples, e.g., dayaka sabhawa (association of laymen that helps in finding finance for, and organizing activities of, the temple) and awamangala samithi (association of villagers that donates money and helps bereaved families to bury or cremate their dead). The Tea Small Holders Association provides an example of vocational association, under the auspices of the government."},{"index":8,"size":89,"text":"The FOs normally elect their board members every year, as stipulated by state regulation, but there were two cases where elections were said to be held every 3 years (and others where they were said to be held every season). The membership fee, however, is even much more variable. While the annual fee is often low (between Rs 5 and 12), it can also be monthly and reach Rs 60 to 120. In A3, the fee is 12 kilos of rice every year. The entry fee is also variable."},{"index":9,"size":31,"text":"The overall impression derived from the surveys is that collective action is rather efficient in maintaining the anicut and the canals, as well as in managing water, when the needs arise."}]},{"head":"Other Problems and Aspects of Rural Life","index":13,"paragraphs":[{"index":1,"size":165,"text":"Villagers in the Upper Walawe river basin face several problems, other than that of water resources. The lack of transportation was often cited as one of the main constraints; it must be noticed, however, that the topography of the area is not favorable to the development of a dense network of roads. Another problem, with specific occurrences, is that of landslides; because of such a risk, 80 farmers in A5/4 have been warned to relocate their houses. Basic health services are available locally but not in some places (like C17), where villagers have to travel 8 miles to find a dispensary. Education is widely available but it is apparent that wealthier families send their children to schools in Balangoda, while \"only poor people's children go to village schools.\" Domestic water supply by a network of pipes is now available in most villages. Electricity is still not reaching several villages. Despite the lack of these items, the villagers consider their standard of living to have increased."},{"index":2,"size":102,"text":"Another very serious problem mentioned earlier is the destruction of crops by wild boars (A1, A3). This may be so severe as to force farmers to let their land fallow (A1/1, A3/2). Some associate the increase in the number of these animals to the reduction of their habitat, in particular the reduction caused by the construction of the Samanalaweva dam and the felling of reservation forests. Monkeys and birds can also cause significant damage (A5, B8). Strong winds are experienced in some months (B6/6, B7), which preclude growing certain types of crops (for example banana, which is also affected by diseases, B7a)."},{"index":3,"size":107,"text":"The importance of water in the life of peasants is attested to by several legends 17 and customs. In the Boltube Saman devalaya 18 (A2) there is a flag called ravana kodiya and it is believed that if the flag is taken away it will rain heavily. There is a perahera (religious procession), which ends with a \"water-cutting ceremony\" at Wallahun ella, a small pond in the upper part of the Boltuba oya supplied by two springs that are believed never to dry. 19 When water gets scarce, farmers in B7 go to the \"Bo tree\" in the village and perform a ceremony to ask for rain."}]},{"head":"Synthesis","index":14,"paragraphs":[{"index":1,"size":126,"text":"The upper catchment of the Walawe basin has been the site of very early human settlements, and kingdoms had been centered around cities, such as Balangoda or Kaltota, which developed from the second century BC to the fifteenth century AD. The region then declined and it was sparsely populated when the British established tea cultivation in the area (which expanded around 1930), with a large forest cover, numerous wild animals, very limited communication facilities, chena cultivation and rice grown under the anicut commands, and a population drawing its subsistence from forest products. Only salt and a small variety of spices came from outside the area. Thus, despite the limited population, the most favorable locations for anicuts, where farmers could cultivate several acres of rice, were exploited."},{"index":2,"size":164,"text":"Most farmers under the anicut commands farm small areas, typically from 0.1 to 0.6 hectare. The rather high, but irregular, rate of tenancy shows that in some anicut commands landownership has been partly retained by influential families, acquired by wealthy local people, or remained under temples and devalas. But it also shows that many who have inherited land may have chosen not to farm and rented it out to relatives. Altogether, land concentration rarely exceeds 1.5 hectares of irrigated land. 17 A legend is reported concerning the Ranmudu oya: King Mayadunne had gone to war and had left seven spouses, telling them that a white or a black flag would be raised depending upon winning or losing the war. The king won the battle but the black flag was mistakenly raised and the king's wives jumped into the Ramudu ella and drowned themselves. However, this is a common legend in Sri Lanka regarding some other kings and the \"seven wives\" of each such king."}]},{"head":"18","index":15,"paragraphs":[{"index":1,"size":96,"text":"The origin of this devalaya is obscure, i.e., whether King Surya during the Seethawaka reign, or King Yapa Bandara helped build it. But it has been developed and rehabilitated in course of time and it has served as a depository for the valuables of Ratnapura Saman devalaya when Ratnapura was under attack. There are nearly 50 groups of people doing duties of the devalaya but earlier there used to be up to 99 such groups. Following the the Katharagama perahera (a religio-cultural procession) another perahera connected to this devalaya starts, which lasts 15 days (Ghanawimala 1942)."}]},{"head":"19","index":16,"paragraphs":[{"index":1,"size":24,"text":"One of these sources has been tapped for domestic use but the villagers have opposed the tapping of the second source considered as sacred."},{"index":2,"size":217,"text":"A striking finding of the survey is the very high diversity of situations. From one anicut to the next, it is not only the water status that may change but also other fundamental features. For example, in the C19/1 anicut area, most people including youth are engaged in agriculture; in the neighboring C19/2 anicut, however, out-migration is quite high and people tend to seek job opportunities outside the area. Some activities are extremely localized, a good example being gem mining. Wild boars may severely affect a particular area, but not neighboring ones. At a wider subregional scale, the upper catchment also displays a notable heterogeneity: the western part is composed of small farms and forests, and chena lands have disappeared to a great extent, partly to the benefit of tea cultivation. Population density is quite high and out-migration to cities as well as to work at Balangoda and local factories is frequent. In the Central part, the Belihul oya catchment has successfully occupied a niche in tomato production that has brought significant wealth to the area, as recent and modern housings that have popped up in the area bear witness to. The eastern side relies more on uplands and home gardens and on products like pepper, cinnamon and sugarcane, which have had more economic significance than rice."},{"index":3,"size":101,"text":"This shows how opportunities to diversify and intensify agriculture can contribute to supporting a growing population and to limiting out-migration. When this is not possible (or does not occur) it is crucial that other activities in other sectors are provided, locally or otherwise. People are forced to be quite mobile in their search for opportunities and this is reflected by the permanent inflow and outflow of a portion of the population. Despite a willingness to diversify to cash crops there is a reluctance to jeopardize the household food security and to convert paddy land whose produce is consumed within the household."},{"index":4,"size":83,"text":"Although some catchments still enjoy a rather good water supply, it seems beyond question that river flows have declined, especially in the last 15 years, and that this decline has been aggravated in the last 5 years. This is generally blamed on both the disappearing of forest cover and the plantation of pines. This decline has had very clear implications on water management in the anicuts. The following figure of a typical catchment allows us to synthesize the most common situation (figure 8)."},{"index":5,"size":146,"text":"The uppermost parts of the catchment have small anicuts, typically 2 to 6 hectares, which receive an abundant supply in both seasons but which cannot be easily expanded because of topography and soil constraints (anicuts 1 and 2). Villagers may complement their income by planting a few patches of tea, working in estates, clearing remaining forests, etc. In anicut 3, water is likely to get scarce in the dry season and this spurs a shift towards OFCs and a rotational arrangement for water distribution in yala. The proximity of the road eases commuting to Balangoda, to schools and to daily work. Anicut 4 is situated in the downstream part and may be larger, since it commands larger valleys or land with much less slope. Water problems force rotations to be extended to maha and some areas may be left fallow in yala, while OFCs get spread."},{"index":6,"size":193,"text":"Beyond this diversity of situations, the overall impression derived from this reconnaissance study is that population pressure over land and water resources is already quite high. Chena cultivation has almost disappeared and expansion is constrained by pinus plantations and forest reserves. Intensification has consisted in the generalization of double-cropping and the adoption of cash crops sold to urban markets. The identification of \"niches\" other than the successful case of tomato would mean a lot for the economic development of the region. Population density is regulated through out-migration and it goes without saying that maintaining a minimum supply of job opportunities in other sectors (or abroad) is vital to counter poverty. Water efficiency is almost optimal, due to direct return flow to the streams, and water management/maintenance appears to be quite good, leaving little scope for improvement in these areas. The importance of anicuts, however, is still considerable with regard to rice production and food self-sufficiency and they support a significant portion of the rural population. Challenges for the future revolve around the interlocked issues of land cover, hydrological regime and population pressure, which will remain shaped by the evolution of the wider economy."}]}],"figures":[{"text":"Figure 1 . Figure 1. Anicuts in Sri Lanka. "},{"text":"Figure 2 . Figure 2. Streams surveyed with their numbers. "},{"text":"Figure 3 Figure 3. 3-D model of the Upper Walawe catchment. "},{"text":"Figure Figure4. Land use (1956 and 1985). "},{"text":"Figure 5 . Figure 5. Anicuts in the Upper Walawe catchment. "},{"text":"Figure 7 . Figure 7. Annual rainfall in Balangoda. "},{"text":"Figure 8 . Figure 8. Typical layout of a sub-catchment. "},{"text":"  "},{"text":"Table 1 . Population in the basin and study area(Census, 2001). Basin Population Population Population density No. of Area BasinPopulationPopulationPopulation densityNo. ofArea   (% of basin) (persons/km 2 ) GNDs (km 2 ) (% of basin)(persons/km 2 )GNDs(km 2 ) Upper Walawe 156,577 26 175 121 894 Upper Walawe156,57726175121894 Walawe basin 596,144 100 244 406 2,442 Walawe basin596,1441002444062,442  "},{"text":"Table 2 . Distribution of sample anicuts, Period Number of anicuts Proportion of anicuts (%) Total area (ha) Total area(%) PeriodNumber of anicutsProportion of anicuts (%)Total area (ha)Total area(%) Time of kings 19 66 1,247 85 Time of kings19661,24785 British rule 8 28 194 13 British rule82819413 Post-Independence 2 7 26 2 Post-Independence27262  "}],"sieverID":"dc48af60-1121-48de-82dd-19d4ad35441a","abstract":"IWMI receives its principal funding from 58 governments, private foundations and international and regional organizations known as the Consultative Group on International Agricultural Research (CGIAR). Support is also given by the Governments of Ghana,"}

data/part_2/04bfeb497e24080346434b12eb6feed5.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04bfeb497e24080346434b12eb6feed5","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/9b794e85-9358-4374-83da-611a3020b321/retrieve"},"pageCount":15,"title":"Diversity of cultural practices used in banana plantations and possibilities for fine-tuning: Case of North Kivu and Ituri provinces, eastern Democratic Republic of Congo","keywords":["Cropping","cultivars","cultural practices","de-budding","de-leafing","de-suckering"],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":119,"text":"Musa species (banana and plantain, here after referred to as banana) constitute the staple food available all year round for the population of eastern Democratic Republic of Congo (DR Congo) with consumption per inhabitant of about 200 kg/year (Ndungo et al., 2004). The eastern provinces of DR Congo produce a staggering 70% of the banana and plantain crop, with 24% produced in North Kivu province (Bakelana and Ndungo, 2004). However, the area planted to banana and plantain, and yield per unit area have declined over the past decades by 20 to 60% (Mobambo et al., 2010) even though demand remains high, leading to high market prices that are beyond the reach of poor urban households (Bakelana and Ndungo, 2004)."},{"index":2,"size":222,"text":"The decline in banana production and productivity is attributed mainly to the increased burden of pests and diseases (Vuylsteke, 1993). Xanthomonas wilt of banana (XW) and Banana Bunchy Top Disease (BBTD) are the two most important banana diseases threatening food security in DR Congo. There are no known resistant cultivars to these diseases in the east and central African region (Smith et al., 1998;Tripathi et al., 2008). Cultural practices improve the overall farm health and are the main affordable options available to the resource poor households for mitigating crop losses due to pests and diseases and for maintaining soil fertility. Nicholls and Altieri (2005) reported that agroecosystem health can be optimized through habitat manipulation and soil fertility enhancement. Several cultural practices on the banana farms focus at manipulating the crop or crop environment, thus improving its ability to withstand stresses in its environment. For example, cultural practices, including early de-budding, disinfection of garden tools, removal of infected mats, cutting of single diseased plants in mats and banana free fallows are some of the recommended control measures for the control of XW (Turyagyenda et al., 2008;Sivirihauma et al., 2013;Blomme et al., 2014). Similarly, cultural practices such as identifying and destroying virusinfected plants/mats as early as possible, replanting with virus-free plants are recommended strategies for controlling BBTV (Robson et al., 2007;Niyongere et al., 2012)."},{"index":3,"size":96,"text":"Practices that replenish and maintain high soil organic matter and enhance the level and diversity of soil macro and microbiota create an environment that enhances plant health, reducing crop losses due to insect pests and diseases (McGuiness et al., 1993;Altieri and Nicholls, 2003). In contrast, farming practices that cause plant nutrition imbalances can lower crop resistance to pests and diseases (Magdoff and van Es, 2000). Cultural practices that improve soil fertility include, but not limited to, crop rotation, mulching, use of organic manure and crop diversification for example through intercropping (Lampkin, 1990;Magdoff and van Es, 2000)."},{"index":4,"size":260,"text":"Despite the potential of agronomic practices to reduce pest and disease pressures, improve soil conditions and crop tolerance, their application especially among resource poor farmers in east and central Africa is limited. Ocimati et al. (2013) emphasized the need to strengthen knowledge extension to farmers in banana growing zones of Burundi, Rwanda and eastern DR Congo. For example, Ocimati et al. (2013) observed that the use of clean planting materials was not highly adopted, with most farmers using suckers from their own or neighboring farms. They also noted that, some of the recommended agronomic practices, such as de-trashing (that is, removal of old leaves), de-suckering (that is, removal of excess suckers), de-budding (that is, removal of the male inflorescence part) and weeding, need to be revised/adapted in the face of new and emerging challenges, especially those from diseases such as XW. Agroforestry and fallowing were not widely applied due to an increased pressure on the land arising from a high human population density in this region and the perennial nature of the banana crop. Table 1 gives a summary of examples of different cultural practices and how they impact on banana yields, soil fertility/erosion, pest and disease incidence level. The assumption is that if widely and properly applied, the cultural practices can improve banana productivity in these regions. This study built on Ocimati et al. (2013). It assessed the adoption and use of different recommended agronomic practices for optimizing banana yield and production in Ituri province and parts of the North Kivu province, as a basis for further improvement efforts."}]},{"head":"MATERIALS AND METHODS","index":2,"paragraphs":[{"index":1,"size":128,"text":"Farm surveys and focus group discussions (FGD) were conducted in 2011/2012 in North Kivu and Ituri provinces in the eastern DR Congo. This study covered 8 territories, 5 from Ituri province (Aru, Djugu, Irumu, Mahagi, and Mambasa) and 3 from North Kivu province (Beni, Lubero, Rutshuru). A total of three villages in which bananas play an important income and food security role were purposively sampled per territory with the help of local agronomists, resulting in a total of 24 villages across the eight territories. In each village, two focus group discussions consisting of 20 men and 20 women were separately conducted to obtain a quick impression of the cultural practices applied on the banana farms. Women and men were separated to encourage greater participation *Corresponding author. E-mail: [email protected]."},{"index":2,"size":65,"text":"Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0 International License Table 1. The links between cultural practices with soil factors, pests and diseases and banana crop management. Stars ('*') denote the ease with which the cultural practice can be applied. The more the stars, the easier it is for the practice to be applied."}]},{"head":"Cultural practice","index":3,"paragraphs":[]},{"head":"Importance in disease, pest, soil and crop management","index":4,"paragraphs":[]},{"head":"Possible negative effect/ limitations","index":5,"paragraphs":[{"index":1,"size":7,"text":"Ease of applicability under small-scale farmer conditions"},{"index":2,"size":27,"text":"De-budding using a forked stick Increases bunch size (Tushemereirwe et al., 2001) The bent leaves can still continue to some degree with photosynthesis (Blomme et al., 2017)."},{"index":3,"size":10,"text":"Could possibly increase black leaf streak incidence/severity on younger leaves."},{"index":4,"size":145,"text":"***** in each group. The FGD were followed by field diagnostic surveys. A total of 10 farms/households having at least 20 mats per plot/farm of banana/plantain were selected per village, totaling 240 farms for this household survey using a questionnaire (Figure 1). The questionnaire determined the typologies of the banana cropping systems and the key cultural practices on the banana farms. The questionnaire for example ranked nine criteria that could be used by farmers to select banana cultivar types to grow. The nine criteria included: (i) the availability of planting materials, (ii) bunch size, (iii) tolerance to infertile soils, (iv) drought tolerance, (v) good pulp flavor, taste and juice quality, (vi) long mat lifespan, (vii) high market demand and prices, (viii) short production cycle and (ix) resistance to pest and diseases. Other cultural practices such as de-suckering, de-leafing, de-budding, mulching and manuring were also assessed."},{"index":5,"size":72,"text":"Geographical positions of the sampled farms were recorded using a GPS (Etrex) device at a precision of ±3 m and used to generate a map (Figure 1). Data were cleaned, coded and the SPSS software used to generate descriptive statistics for different cultural practices obtained across the study sites. Chi-square tests were used to compare means for the different cultural practices between the North Kivu and Ituri province sites at P <0.05."}]},{"head":"RESULTS","index":6,"paragraphs":[]},{"head":"Farmer selection criteria for banana cultivars, type and origin of planting material","index":7,"paragraphs":[{"index":1,"size":91,"text":"Similar trends in farmer's criteria for selection of cultivars to grow were observed in both North Kivu and Ituri provinces (Figures 2 and 3). Across the study sites, farmers ranked bunch size, pulp/juice flavor/taste/quality and the market price of bunches highest out of nine possible banana cultivar selection criteria presented to them. Other important criteria included the availability of planting materials and the lifespan of the mats for a cultivar. Soil fertility and drought tolerance and resistance to diseases were not highly ranked in both study sites (Figures 2 and 3)."},{"index":2,"size":90,"text":"No significant differences (P>0.05) were observed between the two provinces for the period of selecting banana planting materials, the responsibility of selecting planting materials within the household, type, and source of planting materials. Planting materials were selected by most farmers at the beginning of the rainy season in September in both North Kivu (58%) and Ituri provinces (62%) while the other farmers were not conscious of the timing. This task was, in over 83% of cases undertaken by the heads of the households (predominantly male) in both sites (Table 2)."},{"index":3,"size":47,"text":"All of the farmers across the study sites used suckers as planting material (Table 2). These planting materials come mainly from neighboring farmers' fields. A small proportion (1 to 3%) of the farmers obtain planting materials from either their own farms or from Uganda, the neighboring country."}]},{"head":"Banana cropping systems","index":8,"paragraphs":[{"index":1,"size":60,"text":"Most farmers across North Kivu (61%) and Ituri provinces (52%) practiced intercropping compared to 39 and 48%, respectively, who planted banana as a mono-crop. More farmers in North Kivu province intercropped banana compared to Ituri province (Table 3). However, no significant differences (P>0.05) were observed between the two sites in the proportions of farmers who either intercropped or mono-cropped banana."},{"index":2,"size":48,"text":"Only between 14 and 18%, respectively, in North Kivu and Ituri provinces practiced agroforestry on their farms. In most of the cases (89 to 92%), farmers had scattered trees within their banana farms. No significant differences (P>0.05) in agroforestry practices were observed between the two sites (Table 3)."},{"index":3,"size":74,"text":"Eighteen and 14 different banana-other crop (annual and perennial) or banana-tree associations were found in Ituri and North Kivu provinces respectively. Among the different types of inter-cropping systems, the most commonly practiced in both Ituri and North-Kivu provinces included banana-bean (15 and 39%), bananabean-taro (18 and 30%), banana-maize-bean (2 and 14%) and banana-coffee (7 and 5%) intercrops (Table 3). Significant differences (P<0.05) in the combinations of cropping mixtures were visible between the two provinces. "}]},{"head":"De-suckering of banana mats","index":9,"paragraphs":[{"index":1,"size":103,"text":"Sixty nine percent of the farmers in both Ituri and North Kivu provinces applied the technique of de-suckering, mainly to (i) decrease interplant competition and hence increase bunch sizes, (ii) obtain suckers for establishing new banana plots/fields and (iii) to maintain their fields tidy. The majority of farmers (between 53 and 57%) desuckered when it was necessary, while 42 to 41% at the onset of the rainy season at the beginning of September/ October (Table 4). The number of suckers maintained varied between 3 and 5 per banana mat. No significant differences occurred in the de-suckering practices between North Kivu and Ituri provinces."},{"index":2,"size":85,"text":"A minority of farmers (31%) did not apply de-suckering on their farms. In North Kivu this was mainly because the plantations were old and less productive (45% of farmers) to warrant further investment, while it was due to lack of time (that is, competed with other farm activities) in Ituri province (61%). Between 26 and 28% did not de-sucker because it was cumbersome (Table 4). Significant differences (P<0.05) were observed between the two sites for the reasons cited by the farmers not de-suckering their farms."}]},{"head":"De-leafing and de-budding","index":10,"paragraphs":[{"index":1,"size":154,"text":"Eighty five percent of the farmers in North Kivu and 74% in Ituri province cut off fresh green banana leaves (deleafing) in their plantations. The green leaves were mainly cut to maintain banana plantations clean, to obtain mulch material and to decrease shade and allow in sunlight for the intercrops, especially beans (Table 5). Most farmers (62 to 65%) cut leaves when they found it necessary, while a good proportion (34 to 38%) cut leaves at the onset of the rainy season, corresponding with the time of planting annual crops. Significantly, more farmers (P<0.001) cut leaves as a field maintenance practice in Ituri province, while more cut leaves to allow light for intercropped annual crops in North Kivu. For the purpose of reducing shading, most farmers maintained between 4 and 6 leaves on each banana plant (Table 5). Those that did not de-leaf and de-trash attributed it to lack of time for this practice."},{"index":2,"size":194,"text":"De-budding (removal of the male buds) is a more common practice in North Kivu (66% of farms) than Ituri province (56%) (Table 5) despite no significant difference (P<0.05) was observed between the two sites. The major reason behind de-budding was to prevent spread of diseases, especially XW disease that is prevalent in the study sites (Table 5). A smaller proportion (12 to 33%) of farmers de-budded to increase the bunch size. Significant differences (P<0.01) in the objectives of de-budding were recorded between the two sites, with more farmers (88%) de-budding to manage diseases in North Kivu compared to 67% in Ituri province. In contrast, more farmers (33%) in Ituri province compared to 12% in North Kivu debudded to increase bunch size. Farmers who did not debud solely attributed it to the lack of time for the practice. Timely de-budding with a forked stick to minimize access to the male inflorescence by insect vectors of Xanthomonas campestris pv. musacearum is one of the control options for banana bacterial wilt (Brandt et al., 1997). However, a good proportion of farmers, 51% in North Kivu and 38% in Ituri did not timely de-bud their plants (Table 5)."}]},{"head":"Staking, use of harvested pseudostems and weeding","index":11,"paragraphs":[{"index":1,"size":100,"text":"The technique of staking (supporting of banana plants) is applied by the majority of farmers surveyed (at least 94% of farmers in Ituri and North Kivu). Staking is mainly practiced in order to prevent lodging/toppling/snapping/ doubling of banana plants caused by either the heavy weight of bunches or wind. A total of 58 and 59% of the farmers in North Kivu and Ituri, respectively staked their plants whenever they found it necessary, while 36 to 39% and 3 to 4% across sites staked plants during bunch filling and at flowering (that is, at specific plant growth stages), respectively (Table 6)."},{"index":2,"size":49,"text":"Regarding the use of pseudostems after harvesting, 85 and 91% of farmers in Ituri and North Kivu provinces, respectively, cut them into small pieces for use as mulch material. A minority of farmers (2 to 4%) use it for feeding livestock, while others left them standing (7 to 11%)."},{"index":3,"size":46,"text":"Weeding was mainly (96 and 94% in North Kivu and Ituri, respectively) performed using a hand hoe. 12 and 21% of farmers in North Kivu and Ituri, respectively, cut down weeds using machetes (Table 6). Herbicide use to kill weeds was not practiced across the sites."}]},{"head":"DISCUSSION","index":12,"paragraphs":[{"index":1,"size":34,"text":"This study assessed the diversity and use of cultural practices in banana plantations in Ituri and North Kivu 'ns' denote no significant difference at P<0.05) for a given practice between the two study sites."},{"index":2,"size":307,"text":"provinces, eastern DR Congo. Agronomic practices are often knowledge intensive and yet influence the severity of biotic and abiotic stresses and the production of banana plantations. The study showed a low variability in agronomic practices used and their application within and between sites. Agronomic practices with perceived immediate benefits tended to be widely applied. The study suggests that slight changes are needed to a few practices to achieve good management of XW disease. The choice of cultivars grown was mainly influenced by their food attributes (taste, flavour and quality) and ability to fetch higher incomes (influenced by bunch size, market demand and prices, and food attributes). Banana and plantains in these regions are important for food and income. The market price for the bunch of a cultivar is based on its size and taste. Availability of planting materials and the lifespan of banana mats were also important. This could be a reflection of farmers need for cultivars with inexhaustible ability to produce suckers. For example, a poor suckering ability has been reported in plantains at the low altitude sites (Sikyolo et al., 2013) despite being conducive for plantain production. Demand for planting materials has also been increased by disease outbreaks, more recently the banana XW disease that has affected swathes of areas. Clean planting materials are currently needed for re-establishment of destroyed fields. Soil fertility and drought tolerance were not perceived important by farmers in the study area. The eastern DR Congo highlands are characterized by fertile soils and a good level of rainfall; as such these criteria may not be listed as priority concerns for farmers. In earlier studies in eastern DR Congo (Ocimati et al., 2013) observed that farmers maintained more suckers than recommended due to the relatively good soil fertility conditions that could support larger number of plants per mat without compromising bunch yield."},{"index":3,"size":168,"text":"Pest and disease resistance was also not perceived as important in the study regions. It was expected that farmers would rank resistance to pest and diseases highly in this region, especially due to the presence of XW which is currently the most important constraint to banana production (Ndungo et al., 2008). Ocimati et al. (2016) reported that diseases had greatly contributed to Musa genetic erosion and the diversity trends in eastern DR Congo with Fusarium wilt decimating the AAB dessert and ABB beer bananas, while XW affecting all banana types, with ABB beer type 'Pisang Awak' the most affected cultivar. The observed response could be attributed to the fact that all cultivars in region are susceptible to XW and most farmers are resigned to the disease. For example, several farmers attribute the disease to a curse from God and others to a soil infection as such with no ultimate control (Ocimati W. personal communication). To address such misconceptions, knowledge extension on the epidemiology of the disease is needed."},{"index":4,"size":73,"text":"Cultivar selection was mostly the responsibility of the male household heads. This could be linked to the fact that there is distribution of agricultural work between genders with men mostly occupied with land preparation, Table 3. Frequency (%) of farms practicing different intercropping and agro-forestry practices in the banana-based systems across the study sites in Ituri and North Kivu provinces in eastern DR Congo. Dash (-) denotes that the cropping system is missing."}]},{"head":"Farming system applied","index":13,"paragraphs":[{"index":1,"size":27,"text":"North Kivu (n=90) Ituri (n=149 'ns' and '*' respectively denote no significant and a significant difference at P<0.05) for a given practice between the two study sites."},{"index":2,"size":437,"text":"material, while women are mostly involved in secondary activities such as weeding, harvesting, transportation and processing of banana. Ochieng et al. (2014) observed that despite the existence of gender neutrality for both banana cultivation and harvesting in parts of eastern DR Congo, banana cultivation was mainly male dominated while women mainly dominated in the production of annual crops such as sweet potato, cassava, beans, groundnuts, peas and soybeans. Ochieng et al. (2014) also reported male dominance in farm decision making in this region despite the dominance of women in agricultural activities. Similarly, Enete and Amusa (2010) reported male dominance in farm decision making functions in Nigeria even where women are the largest providers of farm labor. Planting materials were mainly selected at the onset of the rainy season. This can be attributed to the absolute reliance on suckers picked from own or neighboring fields that does not require prior preparation. In addition, banana production is entirely rain fed. Reliance on suckers from farmers' own and neighbors' farms in eastern DR Congo has been attributed to the lack of capacity for the production of clean planting material through field sucker multiplication plots, macropropagation and micro-propagation (Ocimati et al., 2013). Dependency on suckers results in a high risk of pest (e.g. banana weevil and nematodes) and disease (e.g. Xanthomonas wilt of banana, Fusarium wilt, banana bunchy top disease and the banana streak virus) transmission, especially when recommended cultural practices (such as the selection of healthy suckers from clean mother gardens, corm paring and/or boiling water treatment to remove weevil larvae and parasitic nematodes) are not applied (FAO, 2010). For example, the dependency on suckers from own or neighboring farms have been reported to have greatly contributed to the spread of XW in eastern DR Congo (Ndungo et al., 2008). It is often difficult to distinguish between healthy suckers and those apparently healthy especially for XW, BBTD and nematodes which are living inside roots. A minority of farmers (1%) in the province of North Kivu use macro-propagated plantlets, a technology that was disseminated by the Consortium for Improving Agriculturebased Livelihoods in Central Africa (CIALCA) in this part of the country. In addition to the lack of capacities to produce clean planting material, the cost of macropropagated and tissue culture-derived plantlets (~$1) compared to $0 to 0.25 for suckers are high and out of reach for most farmers. Building capacities for clean seed production (e.g., clean mother gardens, macropropagation) coupled to promotional activities in these study regions is urgently recommended. This is postulated to improve the management of biotic constraints, aid in timely planting and ultimately the improvement of banana production."},{"index":3,"size":85,"text":"In 39 to 48% of farms, banana was grown as a sole crop while in 52 to 61% was intercropped with a total of 14 to 18 different crop/crop and crop/tree combinations. It is important to note that the East Africa highlands have a high population density (Voortman et al., 2003) that has increased pressure on the land (Fermont et al., 2008). The associations of cultivated plants are designed to take 'ns'denotes no significant at P<0.05 for the given practice between the two study sites."},{"index":4,"size":476,"text":"best advantage of the available small area of land per household (Sileshi et al., 2007;Ouma, 2009). Diversified cropping systems, such as those based on intercropping and agroforestry or cover crops, have also gained interest largely due to the emerging evidence that these systems are more stable and more resource conserving (Vandermeer, 1995). Opportunities for coexistence and beneficial interference between species that can enhance agroecosystem sustainability have been reported with increased diversity on farm (Vandermeer, 1995). Bananabean, banana-bean-taro and banana-coffee were the commonest intercrops in the study regions. Annual intercrops were often planted at the beginning of the raining season. The legume banana associations benefit the banana crop through nitrogen fixation and by controlling erosion. However, this practice involves tilling within the banana plantations which damages the superficial roots of banana plants and could potentially promote the spread of Xanthomonas wilt of banana, Fusarium wilt and nematodes. The practice of mulching of banana plots in combination with zero tillage and the use of a piece of wood for planting e.g. beans could be explored to prevent root damage and limit the risk of infections. The currently most widely recommended banana mat spacing in East and Central Africa is 3 × 3 m (Tushemereirwe et al., 2001). Studies to determine the optimum spacing for banana-annual crop intercropping with minimal interference from the banana crop or the intercrop are thus necessary. De-suckering helps to maintain the chosen plant density thus reducing competition for available resources (Tushemereirwe et al., 2001). Most farmers (69%) practiced de-suckering across North Kivu and Ituri provinces. A slightly lower number of farmers (65%) were observed to de-sucker in North Kivu in an earlier study by Ocimati et al. (2013), however, North Kivu ranked behind Rwanda, Burundi and the South Kivu province in eastern DR Congo. Ndungo et al. (2008) also reported that farmers in North Kivu put low effort into the management of their banana plantations. However, in the current study, and unlike in Ocimati et al. (2013) where most (over 90%) farmers de-suckered at the onset of the rains, most farmers de-suckered when necessary (that is, not linked to a specific time period). This could be a reflection of the chosen application of the practice. Similarly, most farmers maintained between 3 and 4 plants compared with 4 to 7 plants as reported by Ocimati et al. (2013). This could be attributed to intensive extension efforts spearheaded by the CIALCA project during 2007 to 2011. Nonetheless, a large number of farmers' still maintained more than the three recommended (at various growth stages-parent, child and grandchild) plants per mat (Tushemereirwe et al., 2001). Ocimati et al. (2013) reported that the maintenance of more suckers than recommended is sustained by the high soil fertility conditions in the study region that can still support a large number of plants per mat without compromising the yield per unit area."},{"index":5,"size":175,"text":"Cutting of green leaves (de-leafing) was common in 74 to 85% of farms. Apart from their use for domestic purposes, leaves were mainly cut to maintain the field and reduce shading at the onset of the rains when intercrops especially, legumes were planted. Intercropping bananas is a common practice mainly resulting from the high population density and the limited access to land (Ocimati et al., 2013;Fermont et al., 2008). Despite the potential benefits of intercropping (such as nitrogen fixation, pest suppression, soil erosion control) leaf cutting exposes the banana plants to XW infection through tool use. Indeed, tools are one of the most common means of XW spread in this region. Ocimati et al. (2013) recommends the removal of only the fully dried out leaves to prevent tool transmission of XW through deleafing. In addition, cutting of leaves at bunch emergence could severely impact on bunch yields. Blomme et al. (2017) recommends leaf-bending in fields where XW is present in order to prevent disease spread because the bended leaves can potentially still carry out photosynthesis."},{"index":6,"size":222,"text":"De-budding, practiced in 66 (North Kivu) to 56% (Ituri) of the farms was aimed at XW management (preventing insect vector transmission) and increasing bunch size. The current figure in North Kivu (66%) is slightly higher than the 62% earlier reported for North Kivu by Ocimati et al. (2013). Male bud removal as soon as the last hand in a bunch is formed has been reported to prevent the spread of XW (Blomme et al., 2005). However, most of the farmers who de-budded, either were not concerned about the time of de-budding or de-budded too late to be able to prevent a possible XW infection. Similar observations were reported by Ocimati et al. (2013). This could partially explain the continuous perpetuation of the XW problem in the study region. De-budding is also one of the measures for preventing fungal infections such as cigar end rot disease caused by Verticillium theobromae, Trachsphaera fructigena and/or Gloeosporium musarum (Mwangi, 2007). Removal of the male bud has been reported to increase the bunch weight due to an increase in finger size (Daniells et al., 1994). Daniells et al. (1994) reported that the male bud represented a significant competing photosynthetic sink. Thus, there is need to highlight the numerous benefits that accrue from the timely male bud removal so as to promote its application among the farming communities."},{"index":7,"size":112,"text":"The technique of staking was highly applied. Staking was mainly practiced to prevent lodging/toppling/ snapping/doubling of banana plants caused by the weight of bunches. Across the sites, the harvested pseudostem was mainly used as mulch material. This practice is important for nutrients recycling, reducing water runoff and loss through evaporation and in suppressing weeds, functions that are important for the sustainable productivity of the banana farms in these regions (Ocimati et al., 2013). The importance of mulching using pseudostems in the study regions is important as the resource poor households are not able to apply other sources of mulch (e.g. grass and other crop residues) due to associated costs and limited availability."},{"index":8,"size":58,"text":"Weeds were mainly controlled using hand hoes, while a minority used machetes to cut or slash the weeds. Hand  hoe weeding is attributed to the need to intercrop with legumes and other annual crops. Hand weeding and herbicides were not at all used across the sites. Similar observations were reported in North Kivu by Ocimati et al. (2013)."}]},{"head":"Cultural practice Recommendation","index":14,"paragraphs":[]},{"head":"CONCLUSION AND RECOMMENDATION","index":15,"paragraphs":[{"index":1,"size":235,"text":"Cultural/Agronomic practices are crucial agro-ecological intensification practices for enhancing food productivity and soil/field health. However, some of the practices such as de-budding and mulching are knowledge intensive and do not have immediate perceived benefits to the farmers and thus the need to strengthen knowledge extension to farmers to enhance their adoption. Ease of applicability of the various cultural practices and their contribution to pest and disease management and productivity are listed in Table 1. In the face of severe diseases such as XW, cultural practices such as de-trashing, de-leafing and banana spacing need to be modified. Some slight modifications were suggested to the current cultural practices in Table 7 to minimize XW disease spread. For example, cutting of green banana leaves to allow for intercropping was prevalent, potentially affecting banana yields and exacerbating the XW problem. In such communities where intercropping of banana with annual crops is in-evitable, we recommend studies to revise banana spacing to enable both the intercrop and banana to co-exist with minimum interferences. The recommended changes are not cumbersome and with clear benefits, thus have a high probability of success within the communities. Capacities for clean seed production need to be urgently built. In addition, promotional activities are needed to foster clean seed use and other practices for management of biotic constraints. Regular feedbacks from extension workers could possibly contribute to timely fine-tuning of recommended cultural practices and enhance their adoption."},{"index":2,"size":50,"text":"for Development (DGD-Belgium) for its financial contribution through the Bioversity-CIALCA project. Special thanks to David Turner (The University of Western Australia) for his contribution through the scientific editing of this paper. This work was carried out in the overall framework of the CGIAR research program on Roots, Tubers and Bananas."}]}],"figures":[{"text":"Figure 1 . Figure 1. Survey locations across Ituri and North Kivu Provinces in eastern DR Congo. "},{"text":"Figure 2 . Figure 2. Farmer rankings for different criteria they consider for when selecting/ chosing cultivars in different use groups to grow in North Kivu, eastern DR Congo. Error bars denote 95% Co-efficient Interval. "},{"text":"Figure 3 . Figure 3. Farmer rankings for different criteria they consider when selecting/ chosing cultivars in different use groups to grow in Ituri Province, eastern DR Congo. Error bars denote the 95% Co-efficient Interval. "},{"text":" De-trashing Only cut the dry leaves to avoid BXW spread Weeding Mulching suppresses weed growth, keeps the ground soft, conserves soil moisture and in combination with zero tillage could reduce the risk of BXW spread in fields De-leafing (cutting green leaves) Increase spacing of banana to >3 m × 3 m where inter-cropping is inevitable to minimize the need for leaf cutting to increase level of sun light penetration for annual intercrops Bend leaves (at the petiole level) using forked sticks instead of cutting. Such leaves could potentially continue to partition assimilates Selection of planting material Build capacities for clean seed production using simple techniques e.g. macro-propagation Increase promotional activities for the use of clean seed. Inter-cropping Increase spacing of banana to >3 m × 3 m to minimize shading of intercrops Identify shade tolerant crop species to plant under the banana crops Banana-agroforestry practices Test/Fine-tune good practices for integrating trees in banana e.g. use of tree at borders and as hedges Planting spacing/ density In densely populated communities and where farmers inter-crop (the case in eastern DR Congo), wider banana spacing (>3 m × 3 m) is recommended Leaf bending Recommended in inter-cropped or XW infected fields instead of leaf cutting. The bent leaves could still continue with photosynthesis. "},{"text":"Table 1 . Contd.     , ,  "},{"text":"Table 2 . Planting material attributes, across the study sites in Ituri and North Kivu provinces in eastern DR Congo. Attributes Attributes  "},{"text":"Table 4 . Frequency (%) of farmers de-suckering or not de-suckering, de-suckering at different times and the number of suckers they maintain on a banana mat across the study sites in Ituri(I) and North Kivu (NK) provinces in eastern DR Congo. Parameter Parameter  "},{"text":"Table 5 . Frequency (%) of farmers for different de-leafing and de-budding practices in North Kivu and Ituri provinces, eastern Democratic Republic of Congo. NK and I respectively, denote North Kivu and Ituri Provinces. Parameter Parameter  "},{"text":"Table 6 . Frequency (%) for staking banana plants, pseudostem uses and weeding practices by farmers in North Kivu and Ituri provinces, eastern Democratic Republic of Congo. NK and I respectively, denote North Kivu and Ituri Provinces. Parameter Parameter  "},{"text":"Table 7 . Recommendations for improving the efficacy of selected cultural practices in the face of Xanthomonas wilt disease and high population densities.  "}],"sieverID":"02a2ce5e-b5ff-4ce7-953b-827221fb86d8","abstract":"Diverse cultural practices have been communicated to and/or applied by resource-poor households over the past two decades to improve the overall farm health and crop tolerance to biotic/abiotic factors. This study assessed the current diversity and use of cultural practices on banana fields in Ituri and North Kivu provinces, eastern Democratic Republic of Congo (DR Congo). Interview schedules coupled with farm diagnosis were used to take stock of cultural practices. Farmers' choice of banana cultivars was mainly influenced by bunch size, demand/price, pulp flavor/taste, and juice quality. Availability of planting materials and the lifespan of mats were also important. In contrast, drought tolerance, soil fertility conditions, length of production cycle, and pest and disease resistance were not highly considered. Suckers were the predominant type of planting material used. Banana-bean (in 15 to 39% of farms) and banana-taro-bean (18 to 30%) were the dominant intercrops. Staking of banana plants with bunches was applied by 94 to 95% of the respondents, possibly due to the perceived immediate benefits from bunches. Cutting of green leaves to among other things improve sunlight penetration for legume intercrops which was practiced by 74 to 85% of the farmers. This practice has greatly contributed to the perpetuation of banana Xanthomonas wilt disease (XW) in the region. Male bud removal was applied in 55 to 66% of farms to control XW and improve bunch size. However, 38 to 51% of these farmers de-budded after the recommended time. Other common cultural practices included de-suckering, pseudostem use for mulch and weeding. Strategies for safe application of some of the practices such as weeding, leaf cutting, de-trashing and in light of diseases such as XW are recommended. In addition, some practices such as mulching and male bud removal are knowledge intensive, while others such de-suckering have no immediate perceived benefits to farmers, thus the need to strengthen knowledge extension to enhance their adoption."}

data/part_2/05b0ad83fbd5a2492f6debb96272e8e6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05b0ad83fbd5a2492f6debb96272e8e6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/48ff61ca-86a6-48b2-93ce-ef9d0ec9d104/retrieve"},"pageCount":31,"title":"Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 |","keywords":[],"chapters":[{"head":"Glosario de Siglas y Acrónimos","index":1,"paragraphs":[{"index":1,"size":148,"text":"La Secretaría de Agricultura y Ganadería(SAG),como institución rectora del Estado para el sector agroalimentario hondureño, presenta la Estrategia Nacional de Adaptación al Cambio Climático del Sector Agroalimentario de Honduras 2015-2025 ENACCSA, con el objetivo de promover la gestión de riesgos climáticos y la adaptación del sector agroalimentario al cambio climático identificando las posibles sinergias en acciones de mitigación, y que tiene como visión que: \"Al 2025 la SAG ha liderado y generado mecanismos de concertación y sinergia para la reducción de la vulnerabilidad agroclimática y el incremento de la resiliencia y capacidad de adaptación en el sector agroalimentario de Honduras\", siendo de vital importancia para su implementación, la participación y el involucramiento de productores, productoras, pueblos originarios, instituciones del Estado, ONGs, gobiernos locales, la academia, centros de investigación y la empresa privada, considerando las aportaciones que el sector provee para el desarrollo, económico, social y ambiental del país."},{"index":2,"size":138,"text":"La Estrategia se formuló atendiendo el mandato de la Ley de Adaptación al Cambio Climático, Estrategia Nacional de 1 Cambio Climático la Política de Estado para la Gestión Integral del Riesgo en Honduras , y de otras políticas afines de índole regional e internacional. Está fundamentada en los conceptos de ambiente, adaptación, mitigación al cambio climático y la gestión de riesgo de desastres, considerando la relación entre la recuperación y conservación de los agroecosistemas con las acciones y medidas para la adaptación al cambio climático y la gestión de riesgos. Pretende promover un cambio hacia una agricultura sostenible, sustentable y resiliente, siendo la persona humana la finalidad superior del desarrollo y sobre todo de los más vulnerables al cambio climático, bajo principios de intercultural, equidad de género, participación e inclusión social de hombres, mujeres, jóvenes, niños y niñas."},{"index":3,"size":201,"text":"La ENACCSA tiene la finalidad de orientar a técnicos (as), productores (as), cooperantes y otros actores del sector agroalimentario, para el diseño de sus intervenciones de adaptación al cambio climático y la variabilidad climática, para la sostenibilidad de la agricultura y la seguridad alimentaria, hacia el logro de los Objetivos de Desarrollo Sostenible (ODS, 2030). Los daños y pérdidas se están volviendo recurrentes afectando de manera significativa la economía y medios de vida de las familias especialmente del área rural que su seguridad alimentaria y su economía depende de la agricultura. Datos de COPECO y del Comité Técnico Interinstitucional para la Gestión del Riesgo de Sequía, señalan que en el 2014, de los 298 municipios de Honduras, 66 municipios de 10 departamentos presentaron severa crisis por sequía, afectando 76,712 familias de pequeños productores de maíz, frijol y sorgo (COPECO, 2014); mientras que en el 2015 según la declaratoria de la situación de emergencia fueron afectados por el fenómeno de El Niño y la sequía 146 municipios, de estos, 62 estuvieron en condiciones críticas de escasez de alimentos. Esto significó para el país una asignación de cien millones de lempiras (L.100,000,000.00) de los recursos del Fideicomiso para Reactivación del Sector Agroalimentario FIRSA."},{"index":4,"size":60,"text":"En este mismo año, el prolongado fenómeno de la canícula generó pérdidas en áreas de cultivo, especialmente en el 96% de maíz, frijoles 95%, maicillo 46%, y frutales 67%. En la producción pecuaria se dieron pérdidas el 52% de gallinas, 23% en abejas, 21% en vacas y un 12% en caballos, cerdos y toros (OXFAM y Cáritas de Honduras, 2015)."},{"index":5,"size":100,"text":"Sobre la base del análisis de los efectos del cambio climático, de los costos y beneficios de una acción en este ámbito, la SAG, mediante la Mesa Técnica de Cambio Climático y Gestión del Riesgo y consultas participativas en las regionales con técnicos y productores, se propuso desarrollar e implementar la Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras (2015-2025),que integra una serie de elementos y acciones estratégicas puntuales para reducir la vulnerabilidad y mejorar la capacidad de adaptación del sector agroalimentario al cambio climático y la variabilidad para una agricultura más resiliente y sostenible."},{"index":6,"size":68,"text":"La ENACCSA está estructurada con 4 Ejes Estratégicos y contiene objetivos estratégicos que apuntan al fortalecimiento de la institucionalidad y de las capacidades humanas, la concertación de acciones para la prevención y recuperación ante eventos extremos, mejoramiento de las capacidades técnicas y financieras para implementar las medidas de adaptación, la articulación y alianzas para innovación tecnológica y el acceso a la información agroclimática y la gestión del conocimiento."},{"index":7,"size":27,"text":"La implementación de la Estrategia será posible con el aporte de productores y otros actores del sector público y privado, así como de los organismos de cooperación."}]},{"head":"Introducción","index":2,"paragraphs":[{"index":1,"size":28,"text":"VERSIÓN EJECUTIVA Ambiente: se considera como el conjunto de valores naturales, sociales y culturales existentes, que influyen en la vida del ser humano. Enmarca todas las acciones de:"},{"index":2,"size":4,"text":"Gestión de Riesgos (GR)"},{"index":3,"size":3,"text":"Cambio Climático (CC)"},{"index":4,"size":14,"text":"• Resiliencia: Capacidad humana de asumir con tolerancia situaciones límite y sobreponerse a ellas."},{"index":5,"size":21,"text":"Las acciones de GR y CC, coinciden con las acciones, medidas, planes y estrategias de adaptación necesarias para reducir la vulnerabilidad."},{"index":6,"size":19,"text":"Pretenden ayudar al sector agroalimentario de Honduras a volverse resiliente ante los efectos e impactos de la variabilidad climática."},{"index":7,"size":17,"text":"Permiten desarrollar una mayor capacidad adaptativa al cambio climático, para garantizar la seguridad alimentaria de la población."},{"index":8,"size":53,"text":"La Adaptación se considera una interface entre las acciones y medidas orientadas tanto a la gestión de riesgos como al cambio climático. Estas medidas forman parte de las acciones de seguridad alimentaria necesarias, que incluyen brindar disponibilidad, acceso, utilidad biológica y adecuación de los alimentos (inocuidad), en el presente y en el futuro."},{"index":9,"size":67,"text":"La vulnerabilidad actual (VA) y la vulnerabilidad futura (VF) influirán en la definición de las medidas de adaptación, bajo un marco conceptual incluyente. El sector agroalimentario debe conceptualizarse como un sistema agroalimentario que incluye elementos en las fases de producción, circulación y consumo de bienes y servicios asociados a la alimentación humana y en la fase de distribución del ingreso generado en dichos elementos (PESAH, 2004(PESAH, -2021))."}]},{"head":"Conceptos claves y su descripción","index":3,"paragraphs":[{"index":1,"size":13,"text":"Para la elaboración de la ENACCSA, se consideran como fundamentales los siguientes conceptos: "}]},{"head":"Cambio Climático","index":4,"paragraphs":[{"index":1,"size":87,"text":"Según el Panel Intergubernamental de Expertos en Cambio Climático (IPCC, 2012) se considera como un proceso para diseñar, aplicar y evaluar estrategias, políticas y medidas destinadas a mejorar la comprensión de los riesgos de desastre. Incluye el fomentar acciones para la reducción de desastres, así como la transferencia de técnicas, medidas y conocimiento que promueva las prácticas de preparación, respuesta y recuperación para casos de desastre, con el objetivo explícito de aumentar la seguridad humana, el bienestar, la calidad de vida, la resiliencia y el desarrollo sostenible."}]},{"head":"Concepto Descripción","index":5,"paragraphs":[]},{"head":"Gestión de Riesgos Concepto Descripción","index":6,"paragraphs":[{"index":1,"size":69,"text":"Se conoce como la capacidad de los sistemas de ajustarse de forma espontánea o planificada, en respuesta a eventos climáticos actuales y futuros, incluye cambios en las prácticas, procesos y estructuras, para moderar daños o aprovechar las oportunidades. Según el AR5-IPCC (2014), los gobiernos, a diferentes niveles, están empezando a desarrollar planes y políticas de adaptación y a integrar consideraciones sobre cambio climático en planes de desarrollo más amplios."},{"index":2,"size":60,"text":"El desarrollo sostenible busca armonizar el proceso económico con la conservación de la naturaleza, favoreciendo un balance entre la satisfacción de necesidades actuales y las de las generaciones futuras. Sin embargo, pretende realizar sus objetivos revitalizando el viejo mito desarrollista, promoviendo la falacia de un crecimiento económico sostenible sobre la naturaleza limitada del planeta. (Manifiesto por la Vida, 2002: 7)."},{"index":3,"size":100,"text":"En cambio, la sustentabilidad se funda en el reconocimiento de los límites y potenciales de la naturaleza, así como en la complejidad ambiental, inspirando una nueva comprensión del mundo para enfrentar los desafíos de la humanidad en el tercer milenio. Promueve una nueva alianza naturaleza/cultura fundando una nueva economía, reorientando los potenciales de la ciencia y la tecnología y construyendo una nueva cultura política fundada en una ética de la sustentabilidad -en valores, creencias, sentimientos y saberes-que renueva los sentidos existenciales, los mundos de vida y las formas de habitar el planeta Tierra. (Manifiesto por la Vida, 2002, p. 7)."}]},{"head":"Adaptación al Cambio Climático","index":7,"paragraphs":[{"index":1,"size":44,"text":"El Dicha influencia ha sido detectada en cambios en el ciclo global del agua, en las reducciones de la cobertura de nieve y hielo, en la elevación del nivel medio mundial del mar y en los cambios de algunos eventos climáticos extremos. (AR5-IPCC, 2014)."},{"index":2,"size":38,"text":"Las concentraciones atmosféricas de dióxido de carbono (CO2), metano (CH4) y óxido nitroso (N2O) han aumentado desde el año 1750 debido a la actividad humana, excediendo en 2011 los niveles preindustriales en un 40%, 150% y 20% respectivamente."},{"index":3,"size":98,"text":"Asimismo, las concentraciones de CO han aumentado 2 en 40% desde la época pre-industrial, en primer lugar, las provenientes de las emisiones de combustibles fósiles, y en segundo lugar, de las emisiones netas del cambio de uso de la tierra. Las emisiones anuales de CO de la quema de combustibles fósiles y producción 2 de cemento fueron 8.3 GtC/año en promedio para 2001-2011 y 9.5 GtC/año en 2011, 54% arriba del nivel de 1990; y las emisiones netas de CO del cambio 2 antropogénico de uso de la tierra, fueron de 0.9 GtC/año en promedio para 2002-2011(AR5-IPCC, 2014)."},{"index":4,"size":55,"text":"Es muy probable que, a escala mundial, el número de días y noches fríos haya disminuido y que el número de días y noches calientes haya aumentado; el océano ha absorbido un 30% del CO2 antropogénico emitido, causando su acidificación y entre 1901 y 2010 el nivel medio del mar subió 19 cm (AR5-IPCC, 2014)."}]},{"head":"Manifestaciones en el ámbito mundial","index":8,"paragraphs":[{"index":1,"size":15,"text":"El Perfil estratégico de la SAG y el Programa Nacional de Agricultura Bajo Riego (PRONAGRI)."},{"index":2,"size":11,"text":"El Programa de Investigación, Desarrollo e Innovación de Tecnología Agropecuaria (DICTA)."},{"index":3,"size":14,"text":"La nueva Unidad de Agroambiente, Cambio Climático y Gestión de Riesgos de la SAG. "}]},{"head":"Manifestaciones e impactos en el ámbito regional y nacional","index":9,"paragraphs":[{"index":1,"size":20,"text":"Para Centroamérica, las proyecciones de tres modelos de simulación del clima diferentes, bajo el escenario de emisiones medio-altas (A2), indican:"},{"index":2,"size":26,"text":"• Aumentos en las temperaturas para todos los horizontes de tiempo futuros, y en el caso de las lluvias, una mayor variabilidad respecto al período 1980-2000."},{"index":3,"size":22,"text":"• En el caso de Honduras, los cambios proyectados indican que la temperatura media anual aumentaría en los rangos siguientes: VERSIÓN EJECUTIVA"},{"index":4,"size":63,"text":"• Los efectos del cambio climático principalmente en la producción de granos básicos hacen prever que la seguridad alimentaria y los ingresos de ese sector de la población sufrirán una reducción significativa, lo cual es probable que ocasione un aumento de la migración del campo a la ciudad y más problemas para abastecer de alimentos básicos a la población urbana pobre. (CEPAL, 2009)."},{"index":5,"size":60,"text":"• El brote de roya del café de 2012-2013, en el caso de Honduras como uno de los rubros de mayor importancia productiva y generador de divisas. El área total afectada fue de 70 mil ha (25% del total del área cultivada), con un total de pérdidas de US$230 millones correspondientes a 1.3 millones de quintales (PROMECAFÉ & Vandermeer, 2013)."},{"index":6,"size":35,"text":"• De acuerdo al AR5, las tendencias actuales y los efectos del cambio climático a futuro en las dimensiones que de acuerdo al IPCC, aumentarían la vulnerabilidad y agravarían los Impactos negativos del Cambio Climático."},{"index":7,"size":18,"text":"• Para 2030-2040 se proyecta un riesgo muy alto tanto de escasez de agua como de inseguridad alimentaria."},{"index":8,"size":22,"text":"• Para 2080-2100, dicho riesgo continuaría siendo muy alto con un incremento de 2°C, y extremadamente alto con un incremento de 4°C."},{"index":9,"size":44,"text":"• Entre otros impactos, la disponibilidad de alimentos estaría amenazada por las reducciones proyectadas en los rendimientos agropecuarios y pesqueros y con un aumento de 3°C. Habría una pérdida de la capacidad de adaptación de los agricultores en función a sus prácticas (AR5-IPCC, 2014). "}]},{"head":"Relevancia del sector agropecuario en Honduras","index":10,"paragraphs":[{"index":1,"size":87,"text":"Como síntesis, en el período 2010-2014 el PIB Agrícola fue de 13.4% (L. 23,153 millones) posicionándose como la tercera actividad económica más importante del país. Las exportaciones representaron un 34.1% del total de bienes equivalentes a US$ 2,639.2 millones. En relación a la Población Económicamente Activa (PEA) más del 50% se encuentra ubicada en las zonas rurales, de ese porcentaje, poco más de 45% forma parte de la población económicamente activa (PEA).  Según FAOSTAT, el 12% de la población hondureña sufre de desnutrición; por lo que prevé:"},{"index":2,"size":26,"text":"• Que la volatilidad de los precios de los alimentos puede agravar los problemas de desnutrición y pobreza, sobretodo en el 60% de la población rural."},{"index":3,"size":31,"text":"• Los aumentos en el precio de los alimentos pueden traer beneficios a algunos sectores de algunas regiones del mundo, pero en general, se prevé que aumentará la cantidad de pobres."},{"index":4,"size":45,"text":"También el Banco Mundial resume el impacto que la volatilidad de los precios internacionales ejerce sobre la producción hondureña, las importaciones, exportaciones y precios internos de cinco de los principales productos básicos de Honduras: café, maíz, arroz, frijoles y aceite de cocina, lo que representa:"},{"index":5,"size":10,"text":"• Casi 60% del gasto total de los extremadamente pobres."},{"index":6,"size":7,"text":"• Más de 40% de los pobres."},{"index":7,"size":8,"text":"• El 18% de quienes no son pobres."},{"index":8,"size":18,"text":"En las zonas rurales estos cinco productos representan 55% del gasto total, independientemente de la clasificación del ingreso."},{"index":9,"size":63,"text":"Las cifras precedentes indican que la economía hondureña es vulnerable en cuanto a generar divisas y actividad económica como resultado de los cambios en los precios internacionales del café, los frijoles y el aceite de cocina, aunque los precios al consumidor (internos) no son tan sensibles. Algunas conclusiones acerca del impacto que los cambios de los precios internacionales tienen sobre la economía hondureña."},{"index":10,"size":52,"text":"Una reducción permanente del 16,65% en el precio internacional del café, reduce el precio al consumidor del café un 0,88% en relación al escenario base. Aunque el impacto en la inflación es mínimo, los impactos en las divisas extranjeras y en la actividad económica generada por el sector del café son significativos."},{"index":11,"size":53,"text":"En realidad, el sector produce una pérdida de US$ 178,9 millones (aproximadamente el 6% del stock actual de reservas internacionales del Banco Central de Honduras) a la vez que contrae la actividad económica en un 5% y conduce a una reducción general de la actividad económica de entre el 0,2% y el 0,3%."},{"index":12,"size":52,"text":"A diferencia de la agricultura comercial, que tiene como único objetivo la maximización de la rentabilidad, el agricultor familiar busca reducir el riesgo a través de la diversificación productiva. Ante esto, los agricultores familiares de Centroamérica carecen de sistemas productivos especializados en un único bien. Por el contrario, combinan la producción de:"},{"index":13,"size":7,"text":"• Granos básicos (principalmente maíz y frijol)"},{"index":14,"size":2,"text":"• Hortalizas"},{"index":15,"size":7,"text":"• Animales menores (aves, cerdos y abejas)"},{"index":16,"size":5,"text":"• Algunas variedades de frutas"},{"index":17,"size":2,"text":"• Café"},{"index":18,"size":13,"text":"• Ganado vacuno (fundamentalmente en la etapa de cría y producción de leche)"},{"index":19,"size":23,"text":"Del total de agricultores familiares, cerca del 61% corresponde a agricultores por cuenta propia que tienen esta actividad como ocupación principal. De ellos:"},{"index":20,"size":22,"text":"• El 4% de pequeños agricultores empleadores a cargo de unidades productivas, tienen hasta cinco empleados (contando a los familiares no remunerados)."},{"index":21,"size":54,"text":"• Y el restante 35%, son asalariados agrícolas y no agrícolas o trabajadores por cuenta propia no a g r í c o l a s , q u e t i e n e n a l a a g r i c u l t u r a independiente como actividad secundaria."},{"index":22,"size":15,"text":"• Para Honduras esto representa según CEPAL, FAO, IICA, 2013: 366,000 trabajan por cuenta propia."},{"index":23,"size":4,"text":"11,000 son pequeños empleadores."},{"index":24,"size":73,"text":"107,000 pequeños agricultores familiares. El gobierno de la República de Honduras, a través de la SAG, se ha propuesto como objetivo incidir positivamente en el bienestar sustentable de las familias rurales. Ha declarado la lucha contra la pobreza y la inseguridad alimentaria. La inversión en agricultura, la formulación y adopción de políticas y programas para aumentar la producción de bienes y servicios provenientes de la Agricultura Familiar de manera sostenible, son prioridad nacional."},{"index":25,"size":20,"text":"Si consideramos los escenarios de emisiones A1B (niveles intermedios de emisiones de GEI) al 2030 se tendrá el siguiente panorama:"},{"index":26,"size":13,"text":"• El promedio anual de la temperatura del país habrá aumentado 1.4 °C."},{"index":27,"size":13,"text":"• Este aumento de temperatura, acompañado de periodos de sequía y de calor."},{"index":28,"size":27,"text":"• Reducción de la lluvia, que provocara un déficit del agua y consecuentemente un cambio en las zonas aptas para los diferentes cultivos. 12 % en 2050."},{"index":29,"size":14,"text":"También se analizó la producción promedio de frijoles y se prevé una disminución de:"},{"index":30,"size":6,"text":"11 % para el año 2025."},{"index":31,"size":46,"text":"32 % para el año 2050. • En las zonas de tierras bajas se superó el rango de temperatura óptimo, sobre todo en el caso de los frijoles. Estos resultados sugieren que el cambio climático tendrá un efecto más determinante en la agricultura de tierras bajas."},{"index":32,"size":13,"text":"La SAG cuenta con un Plan e Iniciativa basada en 3 ejes fundamentales:"},{"index":33,"size":23,"text":"• Promoción de las políticas e instrumentos que permitan ampliar la base de activos del agricultor (dotación de recursos productivos, infraestructura y capital)."},{"index":34,"size":10,"text":"• Fortalecimiento de la institucionalidad pública para la agricultura familiar."},{"index":35,"size":136,"text":"Promoción de las organizaciones de productores eficaces e incluyentes. La Agencia de los Estados Unidos para el Desarrollo Internacional (USAID), publicó en agosto del 2014, un estudio sobre la \"Vulnerabilidad y Resiliencia frente al Cambio Climático en el Occidente de Honduras\", donde hacen una evaluación del impacto del cambio climático en los sistemas sociales y ecológicos con énfasis en los departamentos del occidente en el corredor seco de Honduras: Copán, Ocotepeque, Lempira, Santa Bárbara, Intibucá y La Paz. El objetivo principal fue identificar respuestas de adaptación existentes y de estas las aplicables, a fin de fortalecer la resiliencia de los medios de vida y de los ecosistemas frente al impacto climático. Se analizó la sensibilidad del café, el maíz, el fríjol, la lechuga y la papa ante la variabilidad y el cambio climático, tomando en cuenta:"},{"index":36,"size":23,"text":"• Los rangos de las temperaturas y las precipitaciones necesarias para el desarrollo de cada uno de estos cultivos en el occidente hondureño."},{"index":37,"size":10,"text":"• Las proyecciones climáticas para la región occidental de Honduras."}]},{"head":"Reportes Agro Meteorológicos","index":11,"paragraphs":[{"index":1,"size":85,"text":"La SAG, por medio del Servicio de Información Agroalimentario (INFOAGRO) y la Dirección de Ciencia y Tecnología Agropecuaria (DICTA), en coordinación con el Centro Nacional de Estudios Atmosféricos, Oceanográficos y Sísmicos (COPECO-CENAOS), ponen a disposición periódicamente, cada 10 días: 3 por mes, Reportes Agro Meteorológicos con el objetivo de presentar las condiciones meteorológicas en las principales zonas productoras de granos básicos de Honduras. Publica además de los mapas nacionales de precipitación y temperatura, las variables meteorológicas por departamento, fases de la luna y comentarios agronómicos."},{"index":2,"size":26,"text":"• En contraste, en el litoral caribeño llueve durante casi todo el año registrándose una disminución en la precipitación durante los meses de febrero a mayo."},{"index":3,"size":22,"text":"• La región donde más llueve es el litoral Caribe y la región donde menos llueve es la zona central del país."},{"index":4,"size":21,"text":"En 2014 Honduras soportó un período de sequía sin precedentes que, dependiendo de la zona, varió entre 45 y 60 días."},{"index":5,"size":12,"text":"• Los territorios más afectados fueron los departamentos del sur del país."},{"index":6,"size":23,"text":"• La sequía durante los meses de julio y agosto ha producido pérdidas muy altas en las áreas de producción de granos básicos."},{"index":7,"size":40,"text":"• El Gobierno de Honduras a través de la Secretaría de Agricultura y Ganadería (SAG) y su Comisión Permanente de Contingencias (COPECO) dio a conocer que la canícula prolongada ocurrida entre julio y agosto de 2014, tuvo las siguientes consecuencias:"},{"index":8,"size":9,"text":"Afectó a casi un millón de personas (186,311 familias)."},{"index":9,"size":8,"text":"Afectó 165 municipios de los 298 del país."},{"index":10,"size":10,"text":"Debido a su ubicación geográfica el clima de Honduras es:"},{"index":11,"size":40,"text":"• De características tropicales, sin embargo, la orografía hondureña y su interacción con los vientos que soplan sobre el territorio y los fenómenos tropicales, como ondas y ciclones, generan microclimas que van desde el tropical seco hasta el tropical húmedo."},{"index":12,"size":35,"text":"• La orientación de las sierras hondureñas juega un rol muy importante en el régimen de precipitación estableciendo diferencias bien marcadas entre el litoral Caribe, la región inter-montaña y el sur del país (Argeñal, 2010)."},{"index":13,"size":16,"text":"El régimen de precipitación de Honduras es una consecuencia directa e indirecta de los siguientes fenómenos:"},{"index":14,"size":43,"text":"• Zona Intertropical de Convergencia (Z.I.T.C.), vaguadas en el oeste de latitudes medias, ondas tropicales, sistemas de baja presión atmosférica en altura y superficie, brisas de mar a tierra, brisas de valle y de montaña, frentes fríos, líneas de cortante y ciclones tropicales."},{"index":15,"size":53,"text":"• La estación seca y la canícula (julio-agosto), en las regiones sur e inter-montana, es una consecuencia del fortalecimiento y desplazamiento hacia el oeste del anticiclón del Atlántico Norte, ubicado sobre las Islas Bermudas durante esta época del año, ya que provoca un aumento en la velocidad de los vientos alisios (Argeñal, 2010)."}]},{"head":"Predicciones climáticas para Honduras","index":12,"paragraphs":[{"index":1,"size":1,"text":"2"}]},{"head":"El análisis fenológico reveló que todos los cultivos son vulnerables a los efectos proyectados del cambio climático en cuanto a:","index":13,"paragraphs":[{"index":1,"size":5,"text":"Un aumento en la temperatura."},{"index":2,"size":7,"text":"Lluvias más variables y en menor cantidad."},{"index":3,"size":21,"text":"2. La fenología es la ciencia que estudia la relación entre los factores climáticos y los ciclos de los seres vivos."}]},{"head":"Vulnerabilidad de la agricultura ante eventos climatológicos: las amenazas y riesgos más recurrentes y sus tendencias actuales","index":14,"paragraphs":[{"index":1,"size":34,"text":"Según Argeñal 2010, la mayor parte del territorio hondureño, especialmente las zonas inter-montañas y el litoral del Golfo de Fonseca, tienen un clima con un régimen de precipitación que presenta dos estaciones bien marcadas."}]},{"head":"Una estación lluviosa y la otra seca","index":15,"paragraphs":[{"index":1,"size":6,"text":"Se muestra además las siguientes situaciones:"},{"index":2,"size":62,"text":"• Durante la estación lluviosa de estas regiones (mayo-octubre) se presenta: Una disminución en la precipitación en un período conocido como Canícula. • El impacto del fenómeno de El Niño en el año 2014 representa un indicio sobre la forma en que los choques meteorológicos repercuten en las cadenas de valor del maíz y del fríjol en el occidente de Honduras (USAID)."},{"index":3,"size":28,"text":"• Los medios de vida en el occidente del país presentan un alto grado de sensibilidad frente a los efectos climáticos, ya que dependen predominantemente de la agricultura."},{"index":4,"size":47,"text":"Una reducción en la cantidad de lluvias de entre el 10 y el 20 por ciento y un aumento en las temperaturas de entre 1,0 y 2,5°C generarán efectos considerables en los medios de vida y en las cadenas de valor agrícola en el occidente de Honduras."},{"index":5,"size":44,"text":"Según la Dirección General de Riego y Drenaje (DGRD) de la SAG, a quien le corresponde la conducción de acciones relacionadas con la promoción y desarrollo del riego y drenaje en actividades agrícolas y el Programa Nacional de Fomento a la Agricultura Irrigada (PRONAGRI):"},{"index":6,"size":39,"text":"• La infraestructura existente de riego en el país se da más por las grandes empresas privadas y es alrededor de 70,000 ha de las compañías bananeras, cañeras, agro exportadoras de hortalizas, tabaco, frutas, plantas ornamentales y de follaje."},{"index":7,"size":139,"text":"• Los pequeños, medianos y microempresarios agrícolas (MiPymes) apenas disponen de alrededor de 10,000 hectáreas de riego. La SAG a través de la DGRD cuenta con 10 distritos de riego para un área total de 10,000 ha, cinco de ellos están en el departamento de Comayagua y uno en los departamentos de La Paz, Santa Bárbara, Valle, Francisco Morazán y El Paraíso. En Honduras existe una gran diversidad de federaciones de grupos étnicos, que son parte de la diversidad cultural que viven en determinados territorios del país. Estos pueblos poseen una cultura basada en su cosmovisión y en sus prácticas fundamentadas en conocimientos ancestrales que le han permitido adaptarse y enfrentar los múltiples desafíos a lo largo de su historia, mismos que deben ser reconocidos e incorporados en el abordaje y construcción de capacidades para enfrentar el cambio climático."},{"index":8,"size":68,"text":"De igual manera, estos impactos negativos del clima están y continuarán afectado de manera diferenciada a hombres y mujeres, no solamente en sus funciones o condiciones biológicas (embarazo, lactancia y desnutrición), sino en sus papeles dentro de la sociedad. Por tanto, es importante que las evaluaciones de vulnerabilidad e impactos y las estrategias y medidas de adaptación y mitigación incorporen un abordaje con enfoque y equidad de género."}]},{"head":"El enfoque de interculturalidad y de equidad de género","index":16,"paragraphs":[{"index":1,"size":9,"text":"La formulación de la estrategia se ha fundamentado en:"},{"index":2,"size":59,"text":"• U n p r o ces o p a r t i ci p a t i v o y d e co n s u l t a permanente con la Mesa Técnica de Cambio Climático y Gestión de Riesgos de la SAG creada para este propósito y que a futuro tendrá vigencia como órgano de consulta."},{"index":3,"size":33,"text":"El proceso se inicia cuando los miembros del 3 SCASA proponen y aprueban trabajar una Estrategia de CC de la SAG. Los pasos seguidos para la formulación de la estrategia fueron los siguientes:"}]},{"head":"Metodología y proceso para la formulación de la Estrategia","index":17,"paragraphs":[{"index":1,"size":36,"text":"• Conformación de una Mesa de Técnica de Cambio Climático y Gestión de Riesgos (MTCC&GR) en la SAG, como paso previo a la creación de la Unidad de Agroambiente, Cambio Climático y Gestión de Riesgos (UACC&GR)."},{"index":2,"size":20,"text":"• Definición y consenso de la ruta metodológica para la formulación de la estrategia y su presentación en el SCASA."},{"index":3,"size":30,"text":"• Talleres con la MTCC&GR y aportes nacionales (COPECO y otros) para la formulación de la visión, objetivos estratégicos, resultados esperados, indicadores, y estrategias específicas para el logro de resultados."},{"index":4,"size":34,"text":"• La MTCC&GR y de la UACC&GR de la SAG, y la asesoría de GIZ en la revisión y sistematización respecto a los estudios de análisis de vulnerabilidad del sector agroalimentario en Honduras (Diagnóstico)."},{"index":5,"size":12,"text":"• Validación de la estrategia en regiones priorizadas del país: consultas regionales."},{"index":6,"size":9,"text":"• Presentación y aprobación en el SCASA de Honduras."},{"index":7,"size":13,"text":"• Aprobación oficial de la Estrategia y presentación pública para iniciar su implementación."},{"index":8,"size":89,"text":"Este proceso participativo promovido por la SAG y apoyado por el Programa CliFor de GIZ, se inició en julio 2014 con apoyo de un consultor externo. Desde octubre se suma un equipo de consultores nacionales apoyados por el Programa CliFor de GIZ, quienes continúan con la conducción y asesoría a la UACC&GR de la SAG en la formulación de la ENACCSA. De manera que así se ha constituido un equipo consultor que trabajó con la MTCC&GR de la SAG, en coordinación directa con el consultor internacional y la SAG."},{"index":9,"size":80,"text":"En septiembre de 2014, con la intención de probar y revisar exhaustivamente la ENACCSA, se realizó en Choluteca un taller sobre escenarios socio económicos y ambientales futuros, combinados con los impactos climáticos esperados en el sector agrícola. Liderado por el Programa de Investigación de CGIAR en Cambio Climático, Agricultura y Seguridad Alimentaria (CCAFS) y la Universidad para la Cooperación Internacional en Costa Rica, el taller reunió importantes funcionarios de gobierno y diseñadores de políticas que trabajan directamente con los agricultores."},{"index":10,"size":67,"text":"El mecanismo de consulta, aprobación y difusión definido ha sido la MTCC&GR, la cual está integrada por miembros de las diferentes direcciones de la SAG, expertos en la temática del cambio climático y gestión de riesgo. La cooperación internacional a través del programa Clifor-GIZ, con el apoyo de consultores nacionales e internacionales, han participado en las reuniones de trabajo de la mesa en calidad de agentes asesores."}]},{"head":"CAPÍTULO VI: EJES Y OBJETIVOS ESTRATÉGICOS","index":18,"paragraphs":[{"index":1,"size":36,"text":"Al 2025 la SAG ha liderado y generado mecanismos de concertación y sinergia para la reducción de la vulnerabilidad agroclimática y el incremento de la resiliencia y capacidad de adaptación en el sector agroalimentario de Honduras."},{"index":2,"size":26,"text":"De forma participativa a través de talleres, se consensuaron los criterios básicos que le dan el marco de referencia a la estrategia. A continuación, se mencionan:"},{"index":3,"size":17,"text":"Énfasis en la seguridad alimentaria, como medida principal para proteger a las personas y sectores más vulnerables."},{"index":4,"size":37,"text":"Énfasis en el diseño e implementación de medidas de adaptación al cambio climático, prioridad en respuestas de corto y mediano plazo, sin perder de vista el largo plazo. (distinguir y abordar simultáneamente lo urgente y lo estratégico)."},{"index":5,"size":50,"text":"Priorización de los sectores, territorios y poblaciones humanas más vulnerables e impactados por el cambio climático en el país. • Orienta y propone la formulación de políticas públicas, planes y programas del sector agroalimentario hacia un desarrollo agrícola de manera sostenible que contribuya a la adaptación y gestión de riesgos."},{"index":6,"size":17,"text":"Orienta el funcionamiento de la Unidad de Agroambiente, Cambio Climático y Gestión de Riesgos de la SAG."},{"index":7,"size":18,"text":"• Se refiere a la concertación y armonización de acciones de ambiente, cambio climático y gestión de riesgos."},{"index":8,"size":26,"text":"• Se proyecta realizar está concertación por medio de la Mesa Técnica de Cambio Climático y Gestión de Riesgos (MTCC&GR&GR) a lo interno de la SAG."},{"index":9,"size":24,"text":"A lo externo, con la definición de herramientas de trabajo para el Sub-comité de Agricultura y Seguridad Alimentaria, que preside este Secretaría de Estado."}]},{"head":"Primero (EE-1)","index":19,"paragraphs":[{"index":1,"size":29,"text":"Fortalecimiento institucional de la Secretaría de Agricultura y Ganadería en materia de capacidades y recursos humanos, para la gestión ambiental, adaptación al Cambio Climático y Gestión del Riesgo agroclimático."}]},{"head":"Segundo (EE-2)","index":20,"paragraphs":[{"index":1,"size":18,"text":"Concertación y armonización de acciones de prevención y respuesta ante eventos extremos: con énfasis en sequía e inundaciones."},{"index":2,"size":18,"text":"Está orientado a fortalecer las capacidades técnicas del Sector Agroalimentario en referencia a la adaptación al cambio climático."},{"index":3,"size":21,"text":"Responde a la necesidad de investigación, innovación, evaluación y monitoreo de los sistemas, tecnologías y buenas prácticas agropecuarias, fomentando la intercooperación."}]},{"head":"Tercer (EE-3)","index":21,"paragraphs":[{"index":1,"size":18,"text":"Fortalecimiento de las capacidades técnicas del Sector Agroalimentario para diseñar e implementar medidas de ACC y de GR."}]},{"head":"Cuarto (EE-4)","index":22,"paragraphs":[{"index":1,"size":59,"text":"Articulación y alianza con redes de investigación y otras fuentes que generan innovación, investigación, tecnología, sistemas de información y conocimiento para la ACC. La UACC&GR coordina, propone, da seguimiento y consulta los aspectos de manejo y dominio de políticas y propuestas de organización, procedimientos y aspectos presupuestarios (el medio de verificación será el Acuerdo Ejecutivo publicado en La Gaceta)."}]},{"head":"Eje Estratégico Descripción","index":23,"paragraphs":[{"index":1,"size":17,"text":"Las Regionales de la SAG cuentan con un enlace técnico de Cambio Climático y Gestión de Riesgos."},{"index":2,"size":32,"text":"Se cuenta con un reglamento operativo con base en el acuerdo ejecutivo publicado. La MTCC&GR ha generado convenios de trabajo con todas las instituciones del SCASA para la implementación de la Estrategia."},{"index":3,"size":30,"text":"A partir del 2017 se presentan informes trimestrales sobre la ejecución de los POAs y la ejecución de los proyectos, conteniendo los lineamientos de ACC&GR en los POAS y Presupuestos."},{"index":4,"size":25,"text":"Presentación de una propuesta sobre la creación de la UACC&GR como instancia especializada de la SAG en temas de cambio climático para aprobación del Ministro."},{"index":5,"size":15,"text":"Promueve la formación y funcionamiento de las Mesas Agroclimáticas Participativas a nivel regional del país."},{"index":6,"size":28,"text":"Propone una carta de entendimiento entre la UACC&GR de la SAG y el CENAOS de COPECO, para intercambio de información, análisis y colaboración en materia de información agroclimática."},{"index":7,"size":12,"text":"Crea el Reglamento, objetivos, agenda de trabajo y funciones de la MTCC&GR."},{"index":8,"size":17,"text":"Fortalece las Unidades de planificación para incorporar la ACC&GR en la formulación de POAS, proyectos y presupuestos."}]},{"head":"VERSIÓN EJECUTIVA","index":24,"paragraphs":[]},{"head":"35","index":25,"paragraphs":[{"index":1,"size":14,"text":"Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025"},{"index":2,"size":37,"text":"VERSIÓN EJECUTIVA R 1.2.3 Del 2017-2020 las Regionales de la SAG están promoviendo la aplicación de medidas de ACC&GR, respondiendo a las demandas de los productores locales, 4 bajo el enfoque de equidad de género e interculturalidad."},{"index":3,"size":54,"text":"Regionales enlazados con la UACC&GR, teniendo planes de acción estructurados y con plataformas de coordinación y articulación generando propuestas y proyectos de implementación de al menos dos medidas de adaptación y de gestión de riesgos con los actores del sector agroalimentario de la región. (Reportes trimestrales sobre acciones de ACC&GRAC implementándose en cada regional)."},{"index":4,"size":51,"text":"Integra las Mesas Agroclimáticas Participativas en las Regiones de la SAG que tiene mayor presencia institucional y prioridad con proyectos en ejecución o por ejecutarse en el periodo; luego, replicar las medidas en otras regionales con capacidades técnicas establecidas y alianzas estratégicas (Proyectos en ejecución que aplican y validan las medidas)."},{"index":5,"size":17,"text":"Responsable: UACC&GR de la SAG. Socio: BANCO MUNDIAL, BID, BCIE. Aliados: EMPRENDESUR, PROMECOM, HORIZONTES DEL NORTE, COMRURAL."},{"index":6,"size":29,"text":"4. La estructura presupuestaria de la UPEG cuenta con técnicos para la unidad de género; el enfoque de género debe retomarse como un enfoque de género y seguridad alimentaria."},{"index":7,"size":39,"text":"R 1.2.2 Del 2016 al 2025 existe un equipo humano institucional formado y capacitado, que orienta y asesora la transversalización del tema de ACC&GR en la SAG, y el abordaje sinérgico interinstitucional e intersectorial del tema del cambio climático."},{"index":8,"size":37,"text":"Equipo instalado y operando, cuenta con profesionales formados para el análisis de la información agroclimática en aspectos técnicos, metodológicos e instrumentales, apoyando iniciativas locales, regionales y nacionales de ACC&GR y liderando áreas claves dentro de la SAG."},{"index":9,"size":74,"text":"Establece un programa de formación continua sobre ACC&GR para personal de la SAG, sus dependencias centrales y regionales y otras instituciones del sector y de unidades ambientales de gobiernos locales. VERSIÓN EJECUTIVA R 2.2.1. A partir del 2017 se están implementando prácticas de producción agropecuaria y acuícola sostenibles adaptadas al clima, considerando la producción de especies que aportan a la seguridad alimentaria en beneficio a pequeños productores y población en riesgo por inseguridad alimentaria."},{"index":10,"size":37,"text":"R 2.2.2 Al 2017 se han sistematizado medidas y prácticas de adaptación al cambio climático del sector agroalimentario, orientadas a productores de pequeña escala, incorporando las prácticas ancestrales como parte de las estrategias para la seguridad alimentaria."},{"index":11,"size":28,"text":"R 2.2.3 Al 2020 se han desarrollado capacidades de los productores para aumentar la producción de material vegetativo y pie de cría adaptado a las condiciones agroclimáticas imperantes."},{"index":12,"size":21,"text":"Número de productores y productoras en riesgo agroclimático que incorporan sistemas productivos sostenibles adaptados al clima para incrementar su seguridad alimentaria."},{"index":13,"size":32,"text":"Número de buenas prácticas documentadas/ sistematizadas que se incorporan a las medidas de prevención y respuesta ante la sequía e inundaciones aplicadas por productores y productoras agropecuarios, pescadores y pequeños productores acuícolas."},{"index":14,"size":23,"text":"Número de productores innovadores, incorporados a la producción de material vegetativo y pie de cría validado por su capacidad de adaptación y productividad."},{"index":15,"size":15,"text":"Aumentado el acceso de los pequeños productores a materiales genéticos adaptados a condiciones climáticas extremas."},{"index":16,"size":45,"text":"Número de buenas prácticas documentadas/ sistematizadas que se incorporan a las medidas de prevención y respuesta ante la sequía e inundaciones Identifica la ubicación de los emprendimientos nacionales de acuicultura y captura de peces y mariscos, categorizando aquellas que se encuentren en el corredor seco."},{"index":17,"size":23,"text":"Integra y fortalece las redes de gestión del conocimiento sobre prácticas y medidas de adaptación y de gestión de riesgos para pequeños productores."},{"index":18,"size":67,"text":"Fomenta el establecimiento de bancos de semillas, zoocriaderos y otras instalaciones para el fito-mejoramiento, mediante alianzas de cooperación técnica y financiera. Objetivo Estratégico, OE 2.2 Fomento y apoyo de prácticas que contribuyan a la seguridad alimentaria local, mediante la producción agroalimentaria sostenible, de acuerdo a los medios de vida y potencial agroecológico del territorio, priorizando a los pequeños productores con enfoque de equidad de género e interculturalidad."}]},{"head":"Resultados Indicadores","index":26,"paragraphs":[{"index":1,"size":61,"text":"Estrategias para logro de Resultados Responsable, socios y aliados R 2.1.1 La SAG a través de la UACC&GR ha logrado coordinar, concertar y promover mecanismos estratégicos con el sector público, organizaciones privadas del sector agroalimentario frente a eventos extremos como la sequía, las inundaciones y otros, haciéndose acompañar de un mecanismo legal y marco estratégico vigente con incidencia nacional y regional."},{"index":2,"size":38,"text":"La MTCC&GR&GR cuenta con un plan de trabajo y protocolos establecidos para responder a sequías, inundaciones y otros eventos climáticos extremos, incorporado en los Sistemas de Alerta Temprana que se han establecido a nivel nacional, regional y local."},{"index":3,"size":36,"text":"Mesas de Cambio Climático, Mesas Agroclimáticas Participativas y demás estructuras organizativas vinculantes han consolidado agendas y planes de acción enfocados a reducir los daños y pérdidas y aumentar su resiliencia ante los efectos del cambio climático."},{"index":4,"size":41,"text":"La SAG y COPECO desarrollan y promueven mecanismos interinstitucionales, cada vez con mayor énfasis en la prevención del riesgo ante eventos extremos como la sequía y las inundaciones, que afecta cultivos, animales, y otros medios de vida de la población rural."},{"index":5,"size":20,"text":"Armoniza la institucionalidad regional de cambio climático con gestión de riesgos, valorando las iniciativas, saberes y experiencias regionales y locales."},{"index":6,"size":32,"text":"Establece directrices para gestionar el riesgo ligado a la reducción de las perdidas en cultivos a consecuencia de eventos climáticos extremos, incidencia de plagas y enfermedades y otras amenazas. Eje Estratégico 2."},{"index":7,"size":18,"text":"Concertación y armonización de acciones de prevención y respuesta ante eventos extremos: con énfasis en sequía e inundaciones."},{"index":8,"size":80,"text":"Objetivo Estratégico, OE 2.1 La SAG armoniza y concerta mecanismos y acciones con el sector público, las organizaciones privadas y demás del sector agroalimentario, para lograr propuestas prácticas que contribuyen a la reducción de los impactos producidos por las sequias y las inundaciones en el sector agroalimentario. VERSIÓN EJECUTIVA R 3.2.1. Para el año 2018 se cuenta con un diagnóstico de la oferta y demanda de agua por cuencas en el país para uso agrícola (Gestión de la información hídrica)."}]},{"head":"Resultados","index":27,"paragraphs":[{"index":1,"size":41,"text":"R 3.2.2 Para el 2020 las cuencas utilizadas para proveer a los sistemas de riego establecidos, cuentan con un plan de manejo que permita el uso sostenible del agua incrementando la productividad agropecuaria sobre todo en zonas más vulnerables del país."},{"index":2,"size":17,"text":"Se cuenta con un documento elaborado que resume la información de la situación hídrica para uso agrícola."},{"index":3,"size":16,"text":"Planes de manejo con enfoque de gestión integral del recurso 7 hídrico para proyectos de riego."},{"index":4,"size":21,"text":"Número de sistemas de cosecha de agua (reservorios) establecidos en el país que benefician a familias en condiciones de riesgo agroclimático."},{"index":5,"size":7,"text":"Gestión de recursos técnicos financieros, alianzas estratégicas."},{"index":6,"size":14,"text":"Fortalece las Regionales con técnicos expertos en riego apropiado a condiciones de riesgos agroclimáticos."},{"index":7,"size":87,"text":"Incluye en todos los proyectos de riego, la protección y restauración de las áreas de recarga hídrica. VERSIÓN EJECUTIVA R 3.2.3. Al 2020 con prioridad en las comunidades del Corredor Seco y otras del país, se ha incrementado la oferta de agua para riego y se ha mejorado su gestión y eficiencia. R 3.2.4 Al 2020 se visualiza la inversión pública de proyectos de afianzamiento hídrico, dotando de agua de riego en mayor porcentaje a las familias más vulnerables y expuestas a los impactos de la sequía."},{"index":8,"size":35,"text":"Número de sistemas de riego implementados bajo el Programa de Desarrollo Agrícola Bajo Riego (PDABR) que benefician a familias en condiciones de riesgo agroclimático, implementando el blindaje de proyectos y la sostenibilidad del recurso hídrico."},{"index":9,"size":31,"text":"Cada año, a partir del 2017 se elaborarán informes sobre la tasa de eficiencia de uso de agua en la agricultura, esperando que al menos se incremente de 33% a 63%."},{"index":10,"size":23,"text":"Un 40% de las familias del Corredor Seco tienen acceso a riego tecnificado y han sido capacitadas en su uso, mantenimiento y reemplazo."},{"index":11,"size":23,"text":"Capacita a los usuarios de riego en protección de cuencas, conservación y uso eficiente del agua (enfoque de gestión integral del recurso hídrico)."},{"index":12,"size":35,"text":"Mejora las capacidades del sector para articular las iniciativas e inversiones locales, de programas, proyectos y servicios de la SAG y de otras instituciones para facilitar el acceso a sistemas de riego en zonas prioritarias."},{"index":13,"size":54,"text":"Facilita y coordina la implementación del financiamiento para 9,255 hectáreas productivas bajo sistemas de riego como Objetivo Estratégico, OE 3.2 Prevenir la reducción del volumen disponible de agua, mejorando su calidad y cantidad mediante un 6 correcto manejo de las cuencas y priorizando proyectos y programas de afianzamiento hídrico como inversión para la ACC."}]},{"head":"Resultados","index":28,"paragraphs":[{"index":1,"size":10,"text":"Indicadores Estrategias para logro de Resultados Responsable, socios y aliados "}]},{"head":"Objetivo General","index":29,"paragraphs":[{"index":1,"size":57,"text":"Fomentar y velar por la incorporación de la variable ambiental en todas las políticas, planes, programas, proyectos y actividades agropecuarias; incluyendo la adaptación al cambio climático y su mitigación, así como la gestión integrada del riesgo agroclimático; mediante la reducción de la vulnerabilidad agroclimática y el incremento de la resiliencia y capacidad de adaptación del sector agropecuario."}]},{"head":"•","index":30,"paragraphs":[{"index":1,"size":48,"text":"Generar procesos metodológicos a través de instrumentos técnicos y administrativos que faciliten la incorporación del enfoque para la adaptación y mitigación del cambio climático y la reducción del riesgo agroclimático, en todas las políticas, planes, programas, proyectos y medidas impulsadas por la SAG y por el sector agroalimentario."},{"index":2,"size":37,"text":"• Apoyar el cumplimiento de los compromisos y obligaciones multilaterales del Estado hondureño derivados de las convenciones multilaterales, en el marco de la articulación del sector agroalimentario con la adaptación, mitigación, gestión del riesgo agroclimático, entre otros."},{"index":3,"size":34,"text":"• Conformar y consolidar espacios institucionales e interinstitucionales para el fomento de la incorporación de la variable agroambiental, que incluya la adaptación, mitigación, gestión del riesgo agroclimático de todos los actores del sector agroalimentario."}]},{"head":"Objetivo General","index":31,"paragraphs":[{"index":1,"size":33,"text":"• Conformar espacios intersectoriales para la discusión, consulta, divulgación, fomento e implementación de las políticas, planes, mecanismos facilitadores y financieros, programas y proyectos orientados hacia la adaptación, mitigación y reducción del riesgo agroclimático."},{"index":2,"size":37,"text":"• Fomentar la incorporación de la adaptación, mitigación y gestión del riesgo agroclimático en los proyectos agropecuarios, ya sea que requieran o no licenciamiento ambiental, y generar orientaciones metodológicas y manuales de buenas prácticas para tal efecto."},{"index":3,"size":58,"text":"• Fomentar la ejecución de la Estrategia de Adaptación al Cambio Climático para el Sector Agroalimentario, tanto a lo interno como a lo externo de la SAG; y establecer un sistema de seguimiento y evaluación, sobre la base de los indicadores de resultado y de impacto incluidos en dicho instrumento de planeación. La UACC&GR tendrá la siguiente estructura:"},{"index":4,"size":10,"text":"Incluiría la coordinación general y una unidad de apoyo técnico-administrativo."},{"index":5,"size":5,"text":"Incluiría los cuatro componentes siguientes:"},{"index":6,"size":3,"text":"Investigación y tecnología."},{"index":7,"size":2,"text":"Fortalecimiento técnico-institucional."},{"index":8,"size":3,"text":"Estrategias y medidas."},{"index":9,"size":3,"text":"Gestión de riesgos."},{"index":10,"size":23,"text":"Todas las unidades técnico-operativas abordarían las tres dimensiones fundamentales planteadas en los objetivos de la UACC&GR: Ambiente Cambio climático Gestión del riesgo agroclimático."},{"index":11,"size":6,"text":"Tabla 3. Estructura de la UACC&GR"}]},{"head":"Niveles","index":32,"paragraphs":[{"index":1,"size":2,"text":"Asesor Técnico-operativo"}]},{"head":"Descripción","index":33,"paragraphs":[{"index":1,"size":78,"text":"En ese contexto internacional y nacional, la SAG deberá jugar un papel central y protagónico, en coordinación y sinergia con otras entidades gubernamentales y espacios intergubernamentales pertinentes, para dotar al Estado y a la sociedad hondureña de una «Estrategia para la Adaptación al Cambio Climático en el Sector Agroalimentario de Honduras», así como de los mecanismos de implementación más efectivos para prevenir, reducir o minimizar los efectos e impactos adversos del cambio climático en el sector agroalimentario nacional."},{"index":2,"size":76,"text":"Para el logro de los objetivos de esta Estrategia, la SAG deberá dotarse de las capacidades institucionales, técnicas y humanas que le faciliten su implementación de manera apropiada y que la habiliten para asumir el papel de liderazgo requerido en el ámbito nacional, territorial y local, con la sustentación científico técnica y la legitimación social requeridas, para asegurar la viabilidad política de las decisiones y acciones para enfrentar el cambio climático de manera oportuna y efectiva."},{"index":3,"size":51,"text":"La SAG a través de la UACC&GR, tendrá que participar activamente desde ya en los procesos nacionales en curso y por venir, encaminados a la conceptualización y formulación de los planes, programas y proyectos que en materia de adaptación al cambio climático para el sector agroalimentario y agropecuario se deberían priorizar."},{"index":4,"size":34,"text":"Para tal efecto, la UACC&GR deberá desarrollar dichas iniciativas para el sector agroalimentario en el contexto de un Plan de Adaptación, y sustentarlas de acuerdo a las directrices establecidas, las cuales demandan elaboración de:"},{"index":5,"size":5,"text":"• Escenarios de cambio climático."},{"index":6,"size":7,"text":"• Estudios de impacto, adaptación y vulnerabilidad."},{"index":7,"size":10,"text":"• Identificación de las necesidades y planes de acción tecnológicos."},{"index":8,"size":6,"text":"• Propuestas de medidas de adaptación."},{"index":9,"size":15,"text":"Dicho Plan y las iniciativas vinculadas, constituirían los instrumentos de implementación de la Estrategia UACC-GRAC. "}]},{"head":"Justificación","index":34,"paragraphs":[{"index":1,"size":19,"text":"Los impactos observados y proyectados a futuro para el sector agroalimentario debido al cambio climático tienen efectos directos en:"},{"index":2,"size":6,"text":"• La seguridad alimentaria y nutricional."},{"index":3,"size":9,"text":"• Los sistemas de vida y su entorno natural."},{"index":4,"size":15,"text":"• Los ingresos familiares y medios de sobrevivencia de una gran mayoría de la población."},{"index":5,"size":57,"text":"En el marco de su mandato legal, incluyendo otros compromisos derivados de la Convención Marco sobre Cambio Climático, que es Ley secundaria de la República, así como de las directrices emanadas de la Estrategia Nacional de Cambio Climático, la SAG deberá asumir los desafíos correspondientes para enfrentar el cambio climático, en el marco de sus funciones institucionales."},{"index":6,"size":25,"text":"Para tal efecto, la SAG deberá concebir, desarrollar e implementar mecanismos de naturaleza diversa en materia de adaptación y mitigación del cambio climático, tales como:"},{"index":7,"size":17,"text":"• Gestión pública, lo que incluye estrategias, planes, programas proyectos y medidas de fomento de la adaptación."},{"index":8,"size":14,"text":"• Científico-tecnológicos, lo que incluye la investigación, experimentación, innovación, desarrollo, transferencia y difusión tecnológica."},{"index":9,"size":20,"text":"• Normativos, referidos al marco jurídicolegal, a la institucionalidad pública y privada, y a plataformas o espacios multisectoriales o intersectoriales."},{"index":10,"size":2,"text":"• Educacionales."},{"index":11,"size":12,"text":"• Organizativos, para mejorar la efectividad de las actividades agropecuarias y agroalimentarias."},{"index":12,"size":2,"text":"• Económico-financieros."},{"index":13,"size":12,"text":"• Participación ciudadana, transparencia y rendición de cuentas de la función pública."}]}],"figures":[{"text":" Figura 3. Rangos de la Precipitación media anual. "},{"text":"Figura 2 . 5 Estrategia Figura 2. Rangos de la Temperatura media anual. °C 5 "},{"text":"3. 3 Efectos del cambio climático en la producción de granos básicos y la Seguridad AlimentariaSegún el último Censo Nacional Agropecuario (CNA) de 1993, el maíz es el cultivo principal en la mayor parte del territorio nacional, junto con otros granos básicos como frijol y sorgo (231 municipios), seguido del café que se focaliza en 41 municipios principalmente en zonas altas de los departamentos de Santa Bárbara, O c o t e p e q u e , L a Pa z y C o m a y a g u a . E n l o s departamentos de Atlántida y Colón predomina la palma africana y en el departamento de Gracias a Dios el cultivo del arroz, yuca y granos básicos (CGIAR/CCAFS, 2014). "},{"text":"Figura 8 : Figura 8: Mapa de los principales cultivos por municipio, según CNA 1993. "},{"text":" 4.1.2 Contribución e importancia de la pequeña agricultura familiar a los mercados nacionales y locales Para un total de 484,000 agricultores familiares. Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025VERSIÓN EJECUTIVA "},{"text":"• Lo anterior, sumado a la variabilidad climática y eventos extremos (sequías y tormentas tropicales) puede causar mayor impacto en la agricultura. En Honduras, el Instituto Internacional para el Desarrollo Sostenible (2013), IISD por sus siglas en inglés, realizó el Proyecto Resiliencia Climática y Seguridad Alimentaria en Centroamérica sobre la gestión del riesgo climático para pequeños agricultores en diferentes zonas geográficas del país, en el cual analizó los impactos climáticos en siete municipios hondureños. Este proyecto reflejó lo siguiente: • Una gran superficie total de cultivos de maíz y frijol. • Los municipios estaban situados en alturas que oscilan desde los 411 m a los 1665 m sobre el nivel del mar, en los departamentos de Cortés, Copán, Lempira, El Paraíso y Choluteca. • Sobre la base de escenarios climáticos localizados, los resultados presentados indican reducciones significativas en los rendimientos de los cultivos de granos básicos. • Por lo que se prevé que en los siete lugares del e s t u d i o h a b r á u n a d i s m i n u c i ó n e n l o s rendimientos promedio del maíz en comparación con el año 2000: 4 % en el año 2025. "},{"text":" L o s r e s u l t a d o s d e l o s m o d e l o s r e v e l a r o n específicamente lo siguiente: • Los rendimientos de los cultivos se vieron menos afectados en general por el cambio climático en las zonas más elevadas y frías. "},{"text":"4. 2 El cambio climático y el sector agropecuario VERSIÓN EJECUTIVA 25 Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 VERSIÓN EJECUTIVA "},{"text":" Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 VERSIÓN EJECUTIVA "},{"text":" Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 VERSIÓN EJECUTIVA 7.4 Estructura organizacional y diagrama funcional de la UACC&GR. "},{"text":"Figura 6 : Figura 6: Organigrama con las unidades que constituirían la UACC&GR "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" En Honduras el sector agroalimentario es uno de los ejes fundamentales que dinamiza la economía del país; según el Banco Central de Honduras (BCH) en el 2015 aportó el 13.8% del Producto Interno Bruto, (L. 26,196 millones, en valores constantes), aproximadamente un 70.3% del valor agregado con aportes que realiza la ganadería, avicultura, pesca, silvicultura y otras menores como la apicultura y la caza.Asimismo, generó del 34.4% del total de las exportaciones agropecuarias que sumaron US $ 2,761.4 millones, brinda empleo a 1,100,712 personas que significa el 28% del total de la Población Económicamente Activa (PEA), que asciende a 3,935,335 personas. De estas, el 46.1% es población rural(INE, 2015). En materia de seguridad alimentaria, la oferta de los principales alimentos: maíz, frijol, sorgo y arroz provienen de la agricultura familiar en la cual se han identificado 484,000 agricultores (CEPAL, FAO, IICA, 2013).  "},{"text":"ciclos solares, erupciones volcánicos o cambios antropog ́enos persistentes de la composición de la atmósfera o del uso del suelo.  VERSIÓN EJECUTIVA VERSIÓN EJECUTIVA VERSIÓN EJECUTIVAVERSIÓN EJECUTIVA Variación del estado del clima, identificable (por ejemplo, mediante pruebas estadísticas) en las variaciones del valor medio o en la variabilidad de sus propiedades, que persiste durante largos períodos de tiempo, generalmente decenios o periodos más largos. El cambio climático puede deberse a procesos internos naturales o a forzamientos externos tales como modulaciones de los La Convención Marco de las Naciones Unidas sobre el Cambio Climático (CMNUCC), en su artículo 1, define el cambio climático como \"cambio de clima atribuido directa o indirectamente a la actividad humana que altera la composición de la atmósfera global y que se suma a la variabilidad natural del clima observada durante periodos de tiempo comparables\". La CMNUCC diferencia, pues, entre el cambio climático atribuible a las actividades humanas que alteran la composición atmosférica y la variabilidad climática atribuible a causas naturales (AR5-IPCC, 2014). Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 Variación del estado del clima, identificable (por ejemplo, mediante pruebas estadísticas) en las variaciones del valor medio o en la variabilidad de sus propiedades, que persiste durante largos períodos de tiempo, generalmente decenios o periodos más largos. El cambio climático puede deberse a procesos internos naturales o a forzamientos externos tales como modulaciones de los La Convención Marco de las Naciones Unidas sobre el Cambio Climático (CMNUCC), en su artículo 1, define el cambio climático como \"cambio de clima atribuido directa o indirectamente a la actividad humana que altera la composición de la atmósfera global y que se suma a la variabilidad natural del clima observada durante periodos de tiempo comparables\". La CMNUCC diferencia, pues, entre el cambio climático atribuible a las actividades humanas que alteran la composición atmosférica y la variabilidad climática atribuible a causas naturales (AR5-IPCC, 2014).Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025  11 11  "},{"text":"Desarrollo Sostenible y el Desarrollo Sustentable: una revisión conceptual necesaria   CAPÍTULO II:  CAPÍTULO II: VERSIÓN EJECUTIVA MARCO NORMATIVO 2.1 Marco Internacional 2.2 Marco Nacional VERSIÓN EJECUTIVA VERSIÓN EJECUTIVAMARCO NORMATIVO 2.1 Marco Internacional 2.2 Marco NacionalVERSIÓN EJECUTIVA  Existen en la región iniciativas políticas institucionales En su interés de luchar contra los efectos del cambio  Existen en la región iniciativas políticas institucionalesEn su interés de luchar contra los efectos del cambio  para hacer frente a los retos y desafíos que implica el climático en los diferentes sectores del país, Honduras  para hacer frente a los retos y desafíos que implica elclimático en los diferentes sectores del país, Honduras Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 cambio climático y la gestión de riesgos: Estrategia Regional de Cambio Climático (ERCC) Estrategia Regional Agroambiental y de Salud (ERAS), (2008) Política Centroamericana de Gestión Integral del Riesgo (PCGIR, 2010) Plan Regional de Reducción de Desastres del CEPREDENAC El Consejo Agroalimentario Centroamericano (CAC), ha elaborado un diagnóstico sobre la investigación en materia de cambio climático, agricultura y seguridad alimentaria en cada uno de los países miembros; este diagnóstico incluye la definición de una agenda conjunta en el marco de adaptación, que muestra: Mapeo de actores. Revisión de la normatividad existente alrededor de esta temática. Centro de Coordinación para la Prevención de los Desastres Naturales en América Central (CEPREDENAC), conformado por las Comisiones de Prevención de Riesgo y Atención de Emergencias de los países miembros del SICA. En ha firmado y ratificado las siguientes convenciones internacionales que surgen de la \"Cumbre de Rio\" en 1992: Convención Marco de las Naciones Unidas sobre el Cambio Climático (CMNUCC) (febrero, 1995) Convenio sobre la Diversidad Biológica (febrero, 1995) Convención de las Naciones Unidas de Lucha contra la Desertificación y la Sequía (abril, 1997) Convención de Humedales Ramsar (junio, 2007) Los esfuerzos realizados a nivel nacional, implican el establecimiento de diversas políticas, planes estratégicos y programas que permitan garantizar la incorporación de la variable ambiental en las políticas públicas, así como en el sector agroalimentario, con la seguridad agroalimentaria del país; y a su vez integrar la gestión de riesgos y del cambio climático. Desde un enfoque general a lo sectorial, las políticas adoptadas por el país incluyen: El Plan de Nación/Visión de País de Honduras (2010-2038). El Plan de todos para una vida mejor, es el Plan Estratégico de Gobierno 2014 -2018. Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025cambio climático y la gestión de riesgos: Estrategia Regional de Cambio Climático (ERCC) Estrategia Regional Agroambiental y de Salud (ERAS), (2008) Política Centroamericana de Gestión Integral del Riesgo (PCGIR, 2010) Plan Regional de Reducción de Desastres del CEPREDENAC El Consejo Agroalimentario Centroamericano (CAC), ha elaborado un diagnóstico sobre la investigación en materia de cambio climático, agricultura y seguridad alimentaria en cada uno de los países miembros; este diagnóstico incluye la definición de una agenda conjunta en el marco de adaptación, que muestra: Mapeo de actores. Revisión de la normatividad existente alrededor de esta temática. Centro de Coordinación para la Prevención de los Desastres Naturales en América Central (CEPREDENAC), conformado por las Comisiones de Prevención de Riesgo y Atención de Emergencias de los países miembros del SICA. Enha firmado y ratificado las siguientes convenciones internacionales que surgen de la \"Cumbre de Rio\" en 1992: Convención Marco de las Naciones Unidas sobre el Cambio Climático (CMNUCC) (febrero, 1995) Convenio sobre la Diversidad Biológica (febrero, 1995) Convención de las Naciones Unidas de Lucha contra la Desertificación y la Sequía (abril, 1997) Convención de Humedales Ramsar (junio, 2007) Los esfuerzos realizados a nivel nacional, implican el establecimiento de diversas políticas, planes estratégicos y programas que permitan garantizar la incorporación de la variable ambiental en las políticas públicas, así como en el sector agroalimentario, con la seguridad agroalimentaria del país; y a su vez integrar la gestión de riesgos y del cambio climático. Desde un enfoque general a lo sectorial, las políticas adoptadas por el país incluyen: El Plan de Nación/Visión de País de Honduras (2010-2038). El Plan de todos para una vida mejor, es el Plan Estratégico de Gobierno 2014 -2018.Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 12 el caso particular de Honduras es la Comisión Permanente de Contingencias (COPECO). Nutricional de Largo Plazo (PSAN) y el Plan La Política para la Seguridad Alimentaria y 13 12el caso particular de Honduras es la Comisión Permanente de Contingencias (COPECO).Nutricional de Largo Plazo (PSAN) y el Plan La Política para la Seguridad Alimentaria y13   Estratégico para la Implementación de la Política  Estratégico para la Implementación de la Política   de Seguridad Alimentaria y Nutricional (2010).  de Seguridad Alimentaria y Nutricional (2010).   La Política de Estado para el Sector  La Política de Estado para el Sector   Agroalimentario y el Medio Rural de Honduras  Agroalimentario y el Medio Rural de Honduras   (2004 -2021).  (2004 -2021).  "},{"text":"Municipios según cultivos principales, 1993 (elaborado con datos del IV Censo Nacional Agropecuario  La distribución de los cultivos en Honduras ha La distribución de los cultivos en Honduras ha cambiado en los últimos 20 años, la Encuesta Nacional cambiado en los últimos 20 años, la Encuesta Nacional Agropecuaria del 2008, señala un crecimiento Agropecuaria del 2008, señala un crecimiento acelerado en el cultivo del café bajo sistemas acelerado en el cultivo del café bajo sistemas agroforestales, el cual actualmente representa el agroforestales, el cual actualmente representa el 2.16% del territorio lo cual equivale a 243,405 ha; los 2.16% del territorio lo cual equivale a 243,405 ha; los pastos y cultivos representan el 28.06% del territorio pastos y cultivos representan el 28.06% del territorio con 3156,028 ha; la agricultura tecnificada con con 3156,028 ha; la agricultura tecnificada con 100,985.3 ha (0.90%); la palma africana que 100,985.3 ha (0.90%); la palma africana que actualmente tiene una superficie de 121,447 ha actualmente tiene una superficie de 121,447 ha (1.08%); las camaroneras y salineras con 17,951.1 ha (1.08%); las camaroneras y salineras con 17,951.1 ha para un total del 30.19% del territorio nacional para un total del 30.19% del territorio nacional destinado al sector agropecuario (ICF/GIZ, 2014). destinado al sector agropecuario (ICF/GIZ, 2014).  "},{"text":" Aquí se resume la relación entre los Ejes Estratégicos y los Objetivos Estratégicos, resultados esperados e indicadores para el logro de resultados previstos.  Tabla 2. Ejes Estratégicos    Tabla 2. Ejes Estratégicos VERSIÓN EJECUTIVA • Obedece a la necesidad de fortalecer el papel de la SAG  VERSIÓN EJECUTIVA VERSIÓN EJECUTIVA•Obedece a la necesidad de fortalecer el papel de la SAGVERSIÓN EJECUTIVA   en el marco de la Adaptación al Cambio Climático y la   en el marco de la Adaptación al Cambio Climático y la Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 EE-1 EE-2 EE-3 Gestión de Riesgos en el Sector Agroalimentario. 6.1 Visión y criterios de la Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario 2015 -2025 6.2 Definición de criterios para el planteamiento de los objetivos estratégicos Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025EE-1 EE-2 EE-3Gestión de Riesgos en el Sector Agroalimentario.6.1 Visión y criterios de la Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario 2015 -2025 6.2 Definición de criterios para el planteamiento de los objetivos estratégicosEstrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 30    31 3031  EE-4    EE-4  "},{"text":" La SAG ha fortalecido sus capacidades técnicas y tecnológicas en su estructura institucional relacionado con la operatividad del Sub Comité del Sector Agrícola y Seguridad Alimentaria, la Mesa Técnica Cambio Climático y Gestión de Riesgos de la UACC&GR.  Objetivo Estratégico, OE 1.2    Objetivo Estratégico, OE 1.2 VERSIÓN EJECUTIVA Resultados Indicadores Estrategias para logro de Resultados Responsable: UACC&GR de la SAG. Socio: Organismos de la cooperación. Aliados: SEDUCA, INFOAGRO-SIMPAH. Responsable, socios y aliados VERSIÓN EJECUTIVAResultadosIndicadoresEstrategias para logro de ResultadosResponsable: UACC&GR de la SAG. Socio: Organismos de la cooperación. Aliados: SEDUCA, INFOAGRO-SIMPAH. Responsable, socios y aliados     Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025 Estrategia Nacional de Adaptación al Cambio Climático para el Sector Agroalimentario de Honduras 2015-2025     37 37  "},{"text":" El diagrama funcional de la UACC&GR se enmarca en la dirección y coordinación con las instancias nacionales de cambio climático, a lo interno la coordinación entre programas, servicios y proyectos de la SAG tanto a nivel central como regional, tal como se muestra en el diagrama siguiente: 7.2 Objetivos, estructura y diagrama   7.2 Objetivos, estructura y diagrama funcional de la UACCGR   funcional de la UACCGR    VERSIÓN EJECUTIVA VERSIÓN EJECUTIVA Subcomité de Agricultura y Seguridad Alimentaria Subcomité de Agricultura y Seguridad Alimentaria Sistema Nacional de Gestión de Riesgos  Sistema Nacional de Gestión de Riesgos Comité Interinstitucional de Cambio Climático  Comité Interinstitucional de Cambio Climático Ministro SAG   Ministro SAG UACCGR UPEG UACCGRUPEG R 3.3.1. El 2017 se ha conformado la \"Red de Mesas Agroclimáticas Participativas de Honduras (Red MAP) que Mesa de Número de actores miembros de la Red de Mesas Agroclimáticas Participativas de Honduras. Apoya y fortalece las redes nacionales y comunitarias para la gestión y el intercambio de la información agroclimática para R 3.3.1. El 2017 se ha conformado la \"Red de Mesas Agroclimáticas Participativas de Honduras (Red MAP) que Mesa de Número de actores miembros de la Red de Mesas Agroclimáticas Participativas de Honduras.Apoya y fortalece las redes nacionales y comunitarias para la gestión y el intercambio de la información agroclimática para contribuye en el diseño e implementación de medidas de Trabajo en  todos los actores del sector agroalimentario. contribuye en el diseño e implementación de medidas de Trabajo entodos los actores del sector agroalimentario. ACC&GRC en Honduras con base al análisis de información Cambio   ACC&GRC en Honduras con base al análisis de información Cambio agroclimática, con asesoría de la SAG y otros socios Climático  agroclimática, con asesoría de la SAG y otros socios Climático nacionales e internacionales.   nacionales e internacionales. R 3.3.2 A partir del 2016 la Red de Mesas Agroclimáticas Número de medidas validadas por la Red MAP que se han Desarrolla eventos de intercambio de medidas de adaptación R 3.3.2 A partir del 2016 la Red de Mesas AgroclimáticasNúmero de medidas validadas por la Red MAP que se hanDesarrolla eventos de intercambio de medidas de adaptación Participativas de Honduras (Red MAP) ha validado medidas para la ACC&GRC en el sector agroalimentario en cinco zonas DIGEPESCA SENASA SEDUCA reportado por sus miembros. Al 2017 se ha facilitado mecanismos apropiados de comunicación para acceso de la DICTA PRONAGRI PRONAGRO al cambio climático. Participativas de Honduras (Red MAP) ha validado medidas para la ACC&GRC en el sector agroalimentario en cinco zonas DIGEPESCA SENASA SEDUCAreportado por sus miembros. Al 2017 se ha facilitado mecanismos apropiados de comunicación para acceso de la DICTA PRONAGRI PRONAGROal cambio climático. piloto de Honduras, seleccionadas de acuerdo a su grado de información a los productores en las regiones. piloto de Honduras, seleccionadas de acuerdo a su grado deinformación a los productores en las regiones. vulnerabilidad y nivel de impactos climáticos. INFOAGRO   vulnerabilidad y nivel de impactos climáticos. INFOAGRO  Regionales Regionales 8. El Programa de Desarrollo Agrícola Bajo Riego deberá contabilizar el enfoque de género y la multiculturalidad. 8. El Programa de Desarrollo Agrícola Bajo Riego deberá contabilizar el enfoque de género y la multiculturalidad.  "}],"sieverID":"e0b61bf8-faa5-460e-b830-36d311773da3","abstract":"La ECC&GRA fue elaborada con el apoyo del Programa CliFor, financiado por la Unión Europea y el Gobierno Alemán e implementado por GIZ, a través de las dos consultorías puntuales:"}

data/part_2/05d904c74c72010f43021c7a4db00c4a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05d904c74c72010f43021c7a4db00c4a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3cae0576-404c-4875-a4aa-6a667867fa14/retrieve"},"pageCount":2,"title":"Feeding cassava leaves to livestock for reducing methane emissions","keywords":[],"chapters":[],"figures":[],"sieverID":"e586ca86-5de8-4aa4-a0d9-bf0c0b59145e","abstract":"Supporting low emissions development planning in the Latin American cattle sector Description of the innovation: Through an in-vitro experiment we demonstrated the potential of cattle diets with cassava supplements to reduce methane emissions. The practice of feeding cassava leaves to livestock is common during the dry season (when feed availability is low) among livestock farmers in northern Colombia. Our work demonstrated that supplementing livestock feed with cassava leaves may contribute towards reductions in enteric methane emissions. New Innovation: No Innovation type: Production systems and Management practices Stage of innovation: Stage 1: discovery/proof of concept (PC -end of research phase) Geographic Scope: National Number of individual improved lines/varieties: <Not Applicable> Country(ies): • Colombia Description of Stage reached: This concept has been demonstrated in-vitro using different proportions of cassava leaves and grass mixtures. Our results showed a reduction in methane production. The stage involves testing this concept in-vivo Name of lead organization/entity to take innovation to this stage: CIAT (Alliance) -"}

data/part_2/06005c08017cae9820dbe4cde31e5d9d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06005c08017cae9820dbe4cde31e5d9d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e5be4ab6-9885-4f1f-b677-097b1bb1d707/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"Low-infrastructure artificial insemination laboratory \"mobile kit\" (part of reproductive platform to support and scale goat breeding programs in Ethiopia and Tanzania)","index":1,"paragraphs":[{"index":1,"size":35,"text":"Project Title: P730 -Activity 1.2.3: Breeding Schemes Description of the innovation: The innovation is a low-infrastructure artificial insemination laboratory \"mobile kit\" which can be easily transferred to, installed in and used under full field conditions. "}]},{"head":"New Innovation: No","index":2,"paragraphs":[]}],"figures":[{"text":"Country Innovation type: Genetic (varieties and breeds) Stage of innovation: Stage 3: available/ ready for uptake (AV) Geographic Scope: Multi-national Number of individual improved lines/varieties: 1 reached: The platform is a real entity materialized with 3 labs, several people trained, confirmed synchronization protocols, regular insemination rounds supporting CBBP and we have spillovers in Sudan Name of lead organization/entity to take innovation to this stage: ICARDA -International Center for Agricultural Research in the Dry AreasNames of top five contributing organizations/entities to this stage:• ARARI -Amhara Regional Agricultural Research Institute• SARI -Southern Agricultural Research Institute (• https://dx.doi.org/20.500.11766/9552 1 This report was generated on 2022-08-19 at 08:32 (GMT+0) "}],"sieverID":"7c7cf13c-6f14-418d-a587-2b6bc5ad3ed1","abstract":""}

data/part_2/06467c0dcb7807359552bade4e92263b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06467c0dcb7807359552bade4e92263b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/765a529f-cfed-4a03-a343-139fbef66f4f/retrieve"},"pageCount":32,"title":"en quête d'un avenir meilleur","keywords":[],"chapters":[{"head":"le teMps du changeMent est arrivé","index":1,"paragraphs":[{"index":1,"size":145,"text":"«Cette conférence ne pouvait pas arriver à un meilleur moment», a déclaré Kareke Mbiuki, ministre adjoint de l'Agriculture (Kenya), aux délégués dans son allocution. «L'une des causes profondes de la faible productivité en Afrique est le manque de performance des services de vulgarisation et de conseil agricoles, ainsi que le soutien financier limité qu'ils reçoivent.» Le Kenya et les pays limitrophes ont traversé des temps dificiles, a-t-il expliqué. Il y a eu évidemment la crise permanente qui sévit dans la Corne de l'Afrique. Treize millions de personnes ont eu besoin d'une aide alimentaire d'urgence durant les derniers mois de l'année 2011 pour faire face aux effets conjoints de la sécheresse et des conflits armés. Les éleveurs ont perdu plus de 60 % de leur bétail, et des centaines de milliers de réfugiés se sont entassés dans des 5 camps surpeuplés près de la frontière somalienne."},{"index":2,"size":254,"text":"Les catastrophes humanitaires attirent l'attention du monde entier mais les défis permanents auxquels les agriculteurs et les consommateurs sont confrontés revêtent une importance toute aussi grande pour notre bien-être futur. Pour ne citer qu'un seul exemple, les prix des denrées alimentaires ont connu des augmentations spectaculaires en 2010. Divers facteurs en sont la cause. De toute évidence, les mauvaises récoltes dues à la sécheresse, aux inondations et aux imprévus météorologiques dans les pays exportateurs de céréales ont entraîné une réduction de l'offre, et la facture des importations de denrées alimentaires des pays à faible revenu et à déficit alimentaire a par conséquent augmenté de 20 %. Des dizaines de millions de personnes se sont ajoutées au milliard d'individus souffrant déjà de la faim. Un an plus tard, les prix mondiaux des denrées alimentaires dépassaient de 19 % ceux enregistrés à la même période l'année précédente. Conséquence : une aggravation de la faim et de la malnutrition dans de nombreux pays en voie de développement. La croissance de la population rend le défi de la lutte contre la faim plus difficile à relever. Aujourd'hui forte de 7 milliards d'individus, la population mondiale franchira le seuil des 9 milliards en 2050. Pour répondre à la croissance démographique, la production alimentaire mondiale devra augmenter d'au moins 70 % au cours des quatre prochaines décennies. D'autres défis restent cependant à relever : le changement climatique, qui menace de diminuer le rendement des cultures, les pertes post-récolte élevées, la dégradation de l'environnement et le chômage galopant en milieu rural."},{"index":3,"size":104,"text":"Après des décennies de sous-investissement dans l'agriculture, les gouvernements et les donateurs s'accordent désormais à reconnaître la nécessité d'établir des politiques et institutions adéquates, d'accroître le soutien financier, d'améliorer l'accès aux nouvelles connaissances, aux compétences et aux marchés. La réforme des services de vulgarisation devrait faire partie intégrante d'une série de mesures pour aider les petits exploitants agricoles à améliorer leur productivité, accroître leurs revenus et contribuer à la sécurité alimentaire. «Il s'agit de changer la manière dont ils travaillent et de s'assurer que les réformes engagées sont rentables et durables», a déclaré M. Michael Hailu, directeur du CTA, en guise de propos liminaires."},{"index":4,"size":63,"text":"Dans de nombreux pays, les systèmes de vulgarisation ont subi de profonds changements au cours des vingt dernières années : d'une approche centralisée, on est passé à une approche qui encourage de nombreuses organisations à collaborer étroitement avec les agriculteurs enfin perçus comme des partenaires égaux. Cette conférence a permis de faire progresser la réflexion sur les enseignements tirés d'un large éventail d'expériences."}]},{"head":"inventaire de la situation","index":2,"paragraphs":[{"index":1,"size":260,"text":"A côté des sessions plénières, des discussions thématiques ont permi d'aborder de manière plus participative les questions de politiques,  «Nous qui travaillons dans les secteurs de la vulgarisation et de la recherche avons échoué à donner à notre population ce qu' elle est en droit d'attendre», a déclaré Monty Jones, directeur exécutif du Forum pour la recherche agricole en Afrique (FARA). Selon lui, la proportion de la population souffrant de malnutrition en Afrique subsaharienne n'a diminué que de 1 % au cours des deux dernières décennies. «L'Afrique est à la traîne en matière d'innovation», a-t-il indiqué. M. Jones rappelle que la vulgarisation a été intégrée au sein du cadre de référence de l'Union africaine, le Programme détaillé pour le développement de l'agriculture en Afrique (PDDAA). «Nous pensons qu' en améliorant la coordination des activités de vulgarisation il sera plus facile de bâtir des synergies avec la recherche et l' éducation pour générer la base de connaissances nécessaire à la transformation de l'agriculture», a-t-il déclaré.  Au cours de la conférence, plus de 60 documents couvrant tous les sujets relatifs à l' évaluation de l' état actuel des services de vulgarisation et de conseil, et aux mesures mises en oeuvre ou envisagées pour les renforcer, ont été présentés lors des sessions thématiques. Certains des partici-pants ont pris part aux six sessions sur un thème spécifique, d'autres se sont répartis dans les différents groupes. Tous, d'une manière ou d'une autre, ont contribué à définir des messages clés qui ont ensuite été présentés lors de la réunion plénière finale. Ces messages sont décrits ci-après."}]},{"head":"%","index":3,"paragraphs":[]},{"head":"aspects politiques","index":4,"paragraphs":[{"index":1,"size":147,"text":"Les sessions se sont articulées autour de deux questions. D'abord, les améliorations en matière de services de vulgarisation et de conseil peuventelles réellement contribuer à réduire la pauvreté et à améliorer la sécurité alimentaire et nutritionnelle ? Ensuite, quels enseignements politiques peut-on tirer des deux dernières décennies de réformes ? Le groupe de travail sur les politiques a répondu positivement à la première question, mais a noté que ces services devraient se conformer à un ensemble de principes directeurs et tenir compte du rôle joué par les petits exploitants agricoles, les pêcheurs et les éleveurs. Le groupe a conclu que les réformes ont largement échoué, dans la mesure où il n'y a pas eu de progrès significatif en matière de responsabilité, d' efficacité, d'autonomisation ou d'impact. Bien plus, la privatisation des services de vulgarisation s' est faite au détriment des petits exploitants 16 repenser l'agenda des réformes"},{"index":2,"size":32,"text":"La conférence de Nairobi a examiné l'avenir des services de vulgarisation et de conseil agricoles en se concentrant sur quatre thématiques principales, l'opportunité étant donnée à chaque participant de contribuer aux délibérations.        "}]},{"head":"affirMant :","index":5,"paragraphs":[{"index":1,"size":37,"text":"• la nécessité de mettre en place des politiques, stratégies et initiatives nationales de vulgarisation agricole qui soient inclusives, spécifiques au contexte et contribuent à la réalisation des objectifs de développement au niveau national, continental et ;"},{"index":2,"size":24,"text":"• la nécessité d'un renforcement des capacités, d'une meilleure coordination et d'un plus grand professionnalisme dans les services de vulgarisation et de conseil ;"},{"index":3,"size":39,"text":"• la nécessité d'améliorer l'utilisation des technologies de l'information et de la communication (TIC), à la fois nouvelles et anciennes, ainsi que l' engagement des médias à accroître la portée et l'impact des services de vulgarisation et de conseil."},{"index":4,"size":4,"text":"notant égaleMent que :"},{"index":5,"size":63,"text":"• l'incapacité à clarifier les rôles et les responsabilités des différents acteurs et prestataires de services, mais aussi à mettre en place des mécanismes de collaboration, pourrait compromettre l' efficacité des services de vulgarisation et de conseil et avoir des conséquences néfastes pour l'agriculture, le développement des zones rurales, l'agriculture familiale et les petits exploitants agricoles, notamment chez les femmes et les jeunes."},{"index":6,"size":43,"text":"nous appelons l'enseMBle des parties prenantes, y compris les gouvernements, les professionnels de la vulgarisation, les associations paysannes, les organismes régionaux et internationaux, le secteur privé, la société civile, les partenaires du développement, ainsi que les donateurs, à unir leurs forces pour :"},{"index":7,"size":31,"text":"• Élaborer, de manière participative, des politiques et des stratégies claires en matière de services de vulgarisation et de conseil, et mettre en place des mécanismes de coordination et d'assurance qualité."},{"index":8,"size":50,"text":"• Plaider pour un financement accru dans le cadre des budgets nationaux, définir et instaurer des mécanismes de financement public, privé et par les donateurs garantissant la durabilité, le partage des risques et une utilisation efficace des fonds alloués afin d' offrir des services de qualité guidés par la demande."},{"index":9,"size":66,"text":"• Promouvoir et faciliter le renforcement continu des capacités, l'apprentissage et la prospective, ainsi qu'un usage plus large des TIC et des médias, qui prennent en compte la dimension culturelle et la question du genre dans la prestation des services de vulgarisation et de conseil, de sorte que des millions de petits exploitants agricoles voient leur position renforcée tout au long de la chaîne de valeur."},{"index":10,"size":31,"text":"• Développer et mettre en oeuvre des processus participatifs de suivi-évaluation, d' évaluation d'impact et de recherche en matière de vulgarisation afin de promouvoir l'apprentissage, la responsabilité, l' efficacité et l'autonomisation."},{"index":11,"size":32,"text":"La coalition de partenaires établie lors de la conférence demeure engagée à promouvoir et mettre en place des services de vulgarisation et de conseil efficaces en faveur du développement agricole et rural."},{"index":12,"size":56,"text":"Les participants appellent donc les organisateurs de la conférence à continuer d' offrir, à différents niveaux, des plates-formes permettant aux professionnels de la vulgarisation, aux chercheurs et aux exploitants agricoles de se réunir, d' échanger et de mobiliser leurs connaissances et leurs ressourcesterres, eau et ressources génétiques -au service de la sécurité alimentaire dans le monde. "}]}],"figures":[{"text":"\" la vulgarisation agricole consiste à partager les résultats de la recherche et les savoir-faire avec les agriculteurs, mais aussi à les aider à exploiter une plus large part de la chaîne des valeurs.\" Michael Hailu, directeur du Centre technique de coopération agricole et rurale ACp-ue (CtA), pays-Bas Un phytopathologiste examine une feuille malade dans une clinique des plantes, dans le village kényan de Wangigi. Ce type de cliniques est mis en place et géré par le Centre for Agricultural Bioscience International. "},{"text":"C décideurs politiques et des praticiens du secteur», a déclaré Judith Ann Francis, coordinatrice de programme sénior Politiques Sciences & Technologies au CTA, l'une des coprésidentes de la conférence et l'animatrice du groupe thématique sur les politiques. «Des services de vulgarisation efficients, efficaces et axés sur la demande sont essentiels pour accroître la productivité et les revenus des petits exploitants agricoles du monde.» n 1 omparons la productivité agricole en Afrique subsaharienne avec celle en Asie de l'Est. En 1961, le rendement moyen de la production céréalière était d' environ 1 tonne par hectare en Afrique subsaharienne et de 1,4 tonne en Asie de l'Est. En Afrique subsaharienne, les rendements ont à peine augmenté depuis. En Asie de l'Est, en revanche, les agriculteurs produisent en moyenne aujourd'hui plus de 5 tonnes à l'hectare. La faible productivité agricole est étroitement liée aux niveaux élevés de la pauvreté et de la faim. Entre 1981 et 2005, le nombre de personnes vivant avec moins de 1,25 dollar américain par jour en Afrique subsaharienne est passé de 212 à 388 millions ; en Asie de l'Est, leur nombre a chuté de 1 071 à 316 millions. "},{"text":" Sans aucun doute, cela a été l'un des leitmotiv durant la conférence de Nairobi : l'agriculture de subsistance ne doit être qu'un phénomène temporaire. Cela étant, pour permettre la transition, les pauvres des zones rurales ont besoin de davantage que des conseils agricoles de haute qualité. Il convient également de leur offrir un accès à l' éducation, aux services de santé, aux transports, aux moyens de communication, au crédit et aux marchés rémunérateurs. Autrement dit, la vulgarisation agricole doit faire partie intégrante d'un programme plus large destiné à stimuler la croissance tant du secteur agricole que de l' économie rurale non agricole.un Modèle pour l'avenir Au cours de la dernière décennie, le Brésil a réalisé des progrès remarquables dans la poursuite de ses objectifs de développement. Entre 2003 et 2011, 33 millions de personnes (sur une population qui en compte 180 millions) ont pu se hisser au-dessus du seuil de pauvreté ; 22 millions de personnes supplémentaires sont en train de leur emboîter le pas. Une grande partie des 4,5 millions d'agriculteurs familiaux brésiliens sont parvenus ces dernières années à accroître leur production et à améliorer leurs revenus. Au Brésil, le projet «Fome Zero» (Faim Zéro) et un programme de vulgarisation axé sur les agriculteurs familiaux ont été au coeur de cette réussite. «Dans les années 1970, nous avions un système de vulgarisation très efficace pour promouvoir le secteur agro-industriel», a déclaré Ben Corrêa da Silva, président de l'Académie brésilienne de vulgarisation rurale. Toutefois, les agriculteurs familiaux, qui produisent 87 % du manioc du Brésil, 70 % de ses haricots et 58 % de son lait (les aliments de base consommés par la plupart des Brésiliens), n' ont reçu aucune assistance -ou très peu -malgré leur contribution à la sécurité alimentaire et nutritionnelle et à l'économie. La situation a changé lorsque le gouvernement dirigé par Inácio Lula da Silva a adopté une politique de vulgarisation ciblant spécifiquement les agriculteurs familiaux. La politique qui définit la vulgarisation comme un service de formation continue et non formelle, a encouragé une approche pluraliste avec l'implication des ONG, des associations paysannes et des services gouvernementaux, entre autres, dans la prestation des services de vulgarisation, entièrement gratuits pour les agriculteurs. Le gouvernement a joint le geste à la parole : entre 2004 et 2009, le budget alloué à la vulgarisation est passé d'un peu moins de 50 millions de reais (100 millions de dollars EU) à plus de 250 millions de reais (250 millions de dollars EU). L'approche brésilienne de la vulgarisation est l'antithèse de l'ancien modèle descendant, sousfinancé : les services sont conçus pour répondre aux besoins et aux demandes des agriculteurs eux-mêmes. Les faits montrent que plus les services de vulgarisation sont participatifs et bien financés, plus les bénéfices apportés aux clients sont importants. «En Papouasie-Nouvelle-Guinée, les agents publics de vulgarisation disent aux agriculteurs ce qu'ils doivent faire, ils ne les consultent pas au préalable pour savoir ce dont ils ont réellement besoin», a déclaré Maria Senar Linibi, présidente de la Fondation des femmes de Papouasie-Nouvelle-Guinée dans le développement agricole. C' est à peu de choses près ce que l' on observe dans de nombreux autres pays. L' organisation présidée par Mme Linibi a fait figure de précurseur en adoptant une approche dite «les paysans d'abord» (farmers first) dans BV/alamy Des agricultrices travaillant dans un champ dans le Burundi rural. Christine est dépendante de l'agriculture pour son revenu et son alimentation. Elle a, dans le cadre d'un programme agricole local, suivi des cours sur l'irrigation des sols et la commercialisation des céréales. Elle est désormais professeur d'un groupe d'agriculteurs et enseigne à ses collègues ce qu'elle a appris.L a v u lg a ri s a ti o n a c c ro it le p o u v o ir d 'i n fl u e n c e d e s p ro d u c te u rslaquelle les agriculteurs établissent eux-mêmes, plutôt que des personnes extérieures, le programme de vulgarisation en fonction des besoins qu'ils ont déterminés. Cela leur a permis d'adopter de nouvelles variétés de cultures et d'améliorer leurs moyens de subsistance et leurs revenus. Cette approche les a en outre encouragés à présenter leurs points de vue au gouvernement et aux décideurs politiques.Il est désormais largement admis que le mouvement vers des systèmes plus pluralistes, orientés vers la demande, innovants et rentables, dans lesquels les services de conseil sont associés à un meilleur accès au crédit, aux intrants agricoles et aux marchés, permettra d'améliorer le bienêtre des petits exploitants agricoles, de réduire la pauvreté en milieu rural et d'accroître la production alimentaire. La section suivante propose une réflexion plus approfondie sur les forces et faiblesses des réformes engagées, et présente les mesures nécessaires pour les rendre plus efficaces au profit des petits exploitants agricoles. n \"Fini le temps où il y avait un agent de vulgarisation pour 300 agriculteurs. Aujourd'hui, nous avons de la chance s'il y en a un pour trois mille. Nous devons retrousser nos manches et tirer le meilleur parti des maigres ressources dont nous disposons, à travers notamment l'utilisation intelligente de la radio, de la téléphonie mobile et des autres médias.\" Doug Ward, président de Farm radio international, Canada 15 A u cours des mois précédant la conférence sur les innovations dans les services de vulgarisation et de conseil, le CTA et ses partenaires ont tenu une série de consultations en ligne sur les quatre thématiques principales : politiques, développement des capacités, outils et approches, et réseaux d'apprentissage. Ces consultations ont permis d' établir une synthèse des réflexions actuelles et ont servi de base aux discussions tenues lors de la conférence de Nairobi. "},{"text":" agricoles et des agences publiques de vulgarisation. Néanmoins, certains des documents présentés lors de la conférence avaient trait à des exemples de réussite où il était prouvé qu'une combinaison appropriée de mesures pouvait contribuer à l'amélioration des moyens de subsistance des petits exploitants agricoles. Cela requiert un cadre politique encourageant le pluralisme, la coopération et la concurrence. Le Brésil offre un exemple incontestable des avantages qui peuvent découler de politiques bien conçues. Le gouvernement brésilien a pris la décision stratégique d'introduire des mesures qui profitent directement aux exploitations familiales. L'approche pluraliste, soutenue par un financement substantiel, a contribué à améliorer la productivité et les revenus agricoles. Le gouvernement a également reconnu la nécessité d'impli-quer les agriculteurs dans le processus de formulation des politiques agricoles. En somme, il a mis en pratique la notion «les paysans d'abord». Le groupe de travail a conclu que les agences publiques de vulgarisation ne devraient pas être impliquées dans la fourniture d'intrants agricoles, tels que les semences et les engrais. L'État a un rôle majeur à jouer dans la coordination et la réglementation des services de vulgarisation et de conseil. Il a également un rôle important à jouer dans la conception de politiques qui encouragent un large éventail d'acteurs -y compris le secteur privé, les ONG et les associations paysannes -à proposer des services intégrés. La coopération est importante, tout comme une saine concurrence, qui devrait conduire à une plus grande efficacité. Les services de vulgarisation et de conseil doivent mettre l'accent sur l'amélioration du bien-être secteur privé dans la fourniture de services intégrés, comme les intrants, a été largement discuté lors de la conférence. Ici, des agriculteurs chargent un pick-up avec des sacs d'engrais devant le magasin La Gina Censeri, en République dominicaine.des petits exploitants agricoles. Les grandes entreprises commerciales peuvent généralement se permettre de payer au prix du marché les services de conseil dont elles ont besoin. Les politiques publiques, ainsi que les services nationaux de vulgarisation et de conseil, doivent par ailleurs reconnaître qu'agriculture ne signifie pas simplement production de denrées alimentaires, de fibres ou de carburant. Les agriculteurs sont les gardiens des ressources naturelles et les politiques nationales doivent encourager la gestion durable de ces ressources, ainsi que l'adoption de méthodes de production plus efficaces. Selon une étude présentée lors de la conférence de Nairobi, seuls 3 des 27 pays d'Afrique subsaharienne étudiés ont introduit des politiques juridiquement contraignantes en matière de vulgarisation. Il est en conséquence urgent que des changements politiques et institutionnels se produisent si l' on veut offrir aux petits exploitants des opportunités réalistes et rémunératrices. Il est impératif pour tous les pays de formuler des politiques qui orienteront la fourniture de services de vulgarisation et de conseil. Des enseignements importants doivent être tirés de l' expérience brésilienne, fortement axée sur la conception de politiques destinées à améliorer le bien-être et le rendement des familles d'agriculteurs. "},{"text":" vulgarisation et de conseil aux petits exploitants agricoles ? Deuxièmement, dans quelle mesure les «îlots de réussite» peuvent-ils devenir la règle plutôt que l' exception ? En d'autres termes, comment recenser et promouvoir les meilleures pratiques ? Les «outils» se réfèrent aux technologies utilisées pour transmettre les connaissances et les informations, telles que la radio, les podcasts, les téléphones mobiles et les programmes vidéo. Les «approches» renvoient aux moyens par lesquels de nouvelles connaissances et compétences sont partagées avec les agriculteurs. Différentes approches de formation peuvent être utilisées : les fermiers modèles, les champs-écoles paysans, les centres d'information villageois ou les services questions-réponses -pour n' en citer que quelques-unes. Les formules les plus concluantes consistent à autonomiser les agriculteurs et les communautés. Elles prennent en considération les cultures et traditions locales, et souvent elles ciblent des groupes spécifiques comme les femmes et les jeunes. Les meilleures approches tendent à être participatives et axées sur la demande, autrement dit, elles répondent aux besoins individuels des agriculteurs et des communautés. Elles impliquent en outre un dialogue constant entre client et prestataire de services, accompagné d'un processus d'apprentissage continu. Les approches qui réussissent aident les agriculteurs à adopter de nouvelles pratiques dans un monde en pleine mutation. Par exemple, l'introduction de nouvelles variétés ou techniques permettant aux agriculteurs de s'adapter aux variations climatiques ou aux changements des habitudes des consommateurs. Au cours des deux dernières décennies, une révolution s' est produite dans le secteur des TIC. Les téléphones mobiles sont devenus un outil indispensable pour transmettre aux agriculteurs des connaissances et des informations sur les marchés. Dans le même temps, l'utilisation de la radio et de la télévision a évolué de manière spectaculaire. La prolifération des stations de radio privées et communautaires offre aux agriculteurs un matériel de qualité en langues locales, mais également l' opportunité de participer à l' échange bidirectionnel d'information selon des modalités impensables il y a encore une génération. Les services qu' offrent les radios sont particulièrement importants pour les agriculteurs vivant dans des zones éloignées, où les agents de vulgarisation ne s'aventurent que rarement voire jamais, et où l'accès à Internet est quasi inexistant. Ces services sont aussi hautement rentables. Chaque outil possède sa propre niche, ses avantages et ses inconvénients. Les initiatives réussies en matière de TIC reposent généralement sur les capacités et les connaissances actuelles des agriculteurs et des entrepreneurs. Souvent, différents outils peuvent être combinés à bon escient. Par exemple, certains projets de vulgarisation ont intégré l'utilisation des services SMS, de l'Internet et de la radio. Néanmoins, il existe trop d' exemples de projets basés sur les TIC qui ont bien fonctionné mais qui n' ont pas survécu à l'interruption de leur financement. Les projets de ce type devraient donc être conçus dans une optique de développement durable. Les avantages offerts par les TIC ne doivent toutefois pas profiter qu'aux paysans les plus aisés. Les services de vulgarisation basés sur les TIC devraient davantage cibler les femmes et les populations pauvres, et une attention particulière devrait être accordée à leur durabilité lorsque leur gestion est confiée aux communautés locales. réseaux d'apprentissage L'innovation résulte d'une action collective, de l'apprentissage par la pratique et du partage des connaissances et des expériences. En fait, un réseau d'apprentissage se définit plus ou moins comme un groupe divers de personnes et d' organisations qui partagent volontiers leurs connaissances et leurs expériences. Ces réseaux peuvent revêtir de nombreuses formes, des communautés de pratique aux dispositifs qui réunissent des agriculteurs, des agents de vulgarisation et d'autres acteurs impliqués dans la production et la vente de biens et services agricoles. La plupart des services de vulgarisation et de conseil -qu'ils soient privés ou publics -proposent généralement des connaissances et des informations techniques aux agriculteurs. Ces services manquent pour la plupart des compétences nécessaires pour promouvoir un processus d'apprentissage interactif qui stimule et encourage l'innovation. De plus, ils décident souvent permettent à des agriculteurs, en Zambie, de communiquer leurs réactions à un programme radio sur l'agriculture, en indiquant quels sujets ils aimeraient voir aborder. L'émission, soutenue par l'IICD, est diffusée deux fois par semaine dans huit langues différentes. "},{"text":"3 services de vulgarisation et de conseil devraient élaborer des mécanismes permettant aux producteurs et autres clients de réfléchir sur l'intérêt des services offerts et d' exprimer clairement leurs besoins. 2. Des efforts accrus devraient être déployés pour renforcer la capacité des services de conseil à soutenir l'apprentissage interactif tout au long des 23 La connaissance, c'est le pouvoir. La diffusion d'une émission radiophonique sur les technologies de l'information et de la communication pour le développement (ICT4D) en Zambie. La vulgarisation a besoin des médias. © iiCD chaînes de valeur et au sein des pôles agroalimentaires. 3. Les services de vulgarisation et de conseil ne doivent pas tenter de remplacer les initiatives existantes en matière d'innovation ; ils doivent en revanche faire en sorte de soutenir ces initiatives et de répondre à leurs besoins. 4. Enfin, des efforts supplémentaires devront être faits pour établir des liens entre les réseaux d'apprentissage locaux et ceux implantés au niveau des districts et à l' échelon national et régional. n une déclaration d'intention L'agriculture à petite échelle continuera à jouer un rôle vital dans la plupart des pays en développement. Cependant, pour atteindre leur plein potentiel, les agriculteurs ont besoin du meilleur accès possible à la connaissance et à l'information. La Déclaration de Nairobi -le texte clé de la conférence -définit et décrit le type de services de vulgarisation nécessaires en ces temps difficiles. Les délégués à la conférence ont eu l'opportunité d'élaborer la Déclaration de Nairobi. l a conférence de Nairobi a été un événement d'une importance considérable et d'une ampleur sans précédent. « Ce n' était certainement pas une conférence ordinaire », a déclaré Ibrahim Mayaki, directeur général de l'Agence de planification et de coordination du NEPAD, dans son discours de clôture. « L'un des objectifs majeurs de la conférence était d' établir une coalition d'intérêts différents, et en cela ce fut un succès. » Au cours de la conférence, le comité organisateur a supervisé l' élaboration du projet de Déclaration de Nairobi sur les services de vulgarisation et de conseil agricoles, qui a été présentée en session plénière lors de la cérémonie de clôture. Tous les participants à la conférence ont été invités à apporter leurs conseils et exprimer leur avis au moment de la finalisation du document. La Déclaration de Nairobi présente un résumé succinct de l' état actuel des services de vulgarisation et de conseil, et les mesures requises pour améliorer leur performance. en voici les principaux points Les participants à la conférence se sont accordés à reconnaître que l'agriculture à petite échelle et l'agriculture familiale occupent une place préponvulgarisation et de conseil continueront de jouer un rôle crucial en aidant les petits exploitants agricoles à améliorer leurs rendements et leurs revenus. "},{"text":" Dans son discours de clôture, M. Michael Hailu, directeur du CTA, a fait remarquer que les différents acteurs des services de vulgarisation et de conseil ont tendance à opérer au sein de leur propre petit cercle d'intérêt, avec les chercheurs dialoguant entre eux, les vulgarisateurs s'adressant aux vulgarisateurs, de même pour les responsables politiques. « À travers cette conférence, nous avons essayé de créer un environnement au sein duquel tout le monde, quel que soit son intérêt ou sa profession, communique ouvertement avec tout un chacun », a-t-il déclaré. « C' est pourquoi il a été si important d' établir cette coalition. » Au cours des prochaines années, les partenaires de la conférence continueront d' offrir plate-forme permettant de débattre des mesures et des réformes nécessaires pour améliorer et revitaliser les services de vulgarisation et de conseil dans le monde. n \"le rôle des services de vulgarisation et de conseil s'élargit et inclut maintenant des questions relatives aux zones rurales qui vont au-delà de l'agriculture. Cela requiert des conseillers bien équipés, capables de travailler en réseau à l'échelon national, régional et international, mais aussi de faciliter l'apprentissage et l'innovation.\" silim Mohammed Nahdy, directeur exécutif de l'AFAAs et président du GFrAs, ouganda Les fruits du succès. Les services de vulgarisation et de conseil peuvent contribuer à mettre en relation les agriculteurs, comme ces producteurs d'oranges en Éthiopie, avec des marchés rentables. "},{"text":"Fait le 18 novembre 2011 Nairobi, Kenya Le Centre technique de coopération agricole et rurale (CTA) est une institution internationale conjointe des Etats du Groupe ACP (Afrique, Caraïbes, Pacifique) et de l'Union européenne (UE). Il intervient dans les pays ACP pour améliorer la sécurité alimentaire et nutritionnelle, accroître la prospérité dans les zones rurales et garantir une bonne gestion des ressources naturelles. Il facilite l'accès à l'information et aux connaissances, favorise l' élaboration des politiques agricoles dans la concertation et renforce les capacités des institutions et communautés concernées. Le CTA opère dans le cadre de l'Accord de Cotonou et est financé par l'UE. Pour plus d'informations sur le CTA, visitez www.cta.int. www.cta.int "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Au Kenya comme dans la plupart des pays d'Afrique, l'agriculture est l'épine dorsale de l'économie et la principale source d'emplois et de devises étrangères. Croissance agricole va de pair avec croissance économique, d'où la nécessité de disposer de bons services de vulgarisation.\" Kareke Mbiuki, ministre délégué à l'Agriculture, Kenya  cipaux. Au programme de la conférence, figu- cipaux. Au programme de la conférence, figu- raient également des tables rondes, des petits raient également des tables rondes, des petits groupes de discussion, des visites sur le terrain groupes de discussion, des visites sur le terrain (à Nairobi et dans sa périphérie) et une cérémo- (à Nairobi et dans sa périphérie) et une cérémo- nie de remise de prix pour les journalistes lau- nie de remise de prix pour les journalistes lau- réats du concours organisé avant la conférence. réats du concours organisé avant la conférence. de développement des capacités, d'outils, de développement des capacités, d'outils, d'approches et de réseaux d'apprentissage. d'approches et de réseaux d'apprentissage. Suite à l'appel à contributions lancé avant la Suite à l'appel à contributions lancé avant la conférence, le comité de pilotage avait reçu conférence, le comité de pilotage avait reçu quelque 400 résumés, parmi lesquels une cen- quelque 400 résumés, parmi lesquels une cen-  "},{"text":"La production alimen- taire doit augmenter de ce pourcentage d'ici 2050 afin de pouvoir répondre à la croissance démogra- phique. 9 Vue d'ensemble Durant les années 1960 et 1970, les services de vulgarisation et de conseil agricoles financés et gérés par l'État ont joué un rôle clé dans l'augmentation de la productivité agricole.Cependant, des programmes d'ajustement structurel, dans les années 1980 et 1990, ont conduit à un déclin important des fonds disponibles -ce dont les agriculteurs ont pâti. Il est désormais largement accepté qu'il est nécessaire de trouver un nouveau modèle de prestation des services. Celui-ci devra être pluraliste -avec un rôle important joué par le secteur privé -et orienté vers la demande. Idéalement, les services de vulgarisation devraient être fournis gratuitement aux petits exploitants agricoles.  "},{"text":"\"les services de vulgarisation en Afrique subsaharienne doivent être considérés comme un bien public, sachant que les petits exploitants agricoles n'ont pas les moyens de se les offrir.\" romano Kiome, secrétaire permanent, ministère kényan de l'Agriculture  Dans les années 1960 et 1970, les services de vulgarisation et de conseil dirigés et financés par l'État ont joué un rôle majeur dans la diffusion des informations et des nouvelles technologies auprès des agriculteurs. Ces services ont entre autres fourni des conseils et un soutien qui ont contribué à impulser la révolution verte en Asie. services nationaux de vulgarisation et de conseil. Cela a eu des conséquences profondes sur les culture a chuté de 17 % en 1980 à 3 % en 2006. publique au développement consacrée à l'agri-coles. Dans le même temps, la part de l'aide disponibles pour la prestation des services agri-conduit à une réduction significative des fonds le Fonds monétaire international (FMI) ont turel mis en oeuvre par la Banque mondiale et Toutefois, les programmes d'ajustement struc- Autrefois, dans de nombreux pays en dévelop-pement, il y avait en moyenne un agent public de vulgarisation pour 300 agriculteurs ; au-jourd'hui, on en compte un pour 1 500 à 3 000. Bien sûr, le simple fait d'avoir un grand nombre d'agents de vulgarisation ne garantit nullement la croissance agricole. Dans les années 1960 et 1970, les services de vulgarisation et de conseil dirigés et financés par l'État ont joué un rôle majeur dans la diffusion des informations et des nouvelles technologies auprès des agriculteurs. Ces services ont entre autres fourni des conseils et un soutien qui ont contribué à impulser la révolution verte en Asie. services nationaux de vulgarisation et de conseil. Cela a eu des conséquences profondes sur les culture a chuté de 17 % en 1980 à 3 % en 2006. publique au développement consacrée à l'agri-coles. Dans le même temps, la part de l'aide disponibles pour la prestation des services agri-conduit à une réduction significative des fonds le Fonds monétaire international (FMI) ont turel mis en oeuvre par la Banque mondiale et Toutefois, les programmes d'ajustement struc-Autrefois, dans de nombreux pays en dévelop-pement, il y avait en moyenne un agent public de vulgarisation pour 300 agriculteurs ; au-jourd'hui, on en compte un pour 1 500 à 3 000. Bien sûr, le simple fait d'avoir un grand nombre d'agents de vulgarisation ne garantit nullement la croissance agricole.  "},{"text":"une nouvelle façon de faire les choses ?  Selon Volker Hoffmann, économiste agricole et expert en vulgarisation à l'Université d'Ho-henheim, en Allemagne, les gouvernements ne devraient pas être directement engagés dans la prestation de services de vulgarisation, lesquels pourraient être mieux gérés par des entités juri-diques privées. Les services publics de vulga- Selon Volker Hoffmann, économiste agricole et expert en vulgarisation à l'Université d'Ho-henheim, en Allemagne, les gouvernements ne devraient pas être directement engagés dans la prestation de services de vulgarisation, lesquels pourraient être mieux gérés par des entités juri-diques privées. Les services publics de vulga-  "},{"text":"CHApitre 1 / Vue d'ensemble 10 Les téléphones mobiles permettent aux agriculteurs d'avoir accès à l'information qui peut les aider à améliorer leurs moyens d'existence et leurs pratiques agricoles. Ici, une paysanne à Kibirichia, au Kenya.  risation souffrent encore d'un certain nombre de faiblesses. Ils tendent à être bureaucratiques et inefficaces. Au lieu de consulter les agricul-teurs pour connaître leurs besoins, les agents publics de vulgarisation décident généralement de ce qui est le mieux pour eux. Par ailleurs, des conflits de rôles surgissent fréquemment, avec des agents publics de vulgarisation qui interviennent en tant que conseillers, policiers et arbitres pour décider de l' octroi de subven-tions ou d'autres aides aux agriculteurs. Cela se traduit inévitablement par un manque de confiance entre les agents de vulgarisation et les agriculteurs. «Il y a de fortes raisons pour soutenir la création de systèmes pluralistes de prestation, qui soient Les participants à la conférence de Nairobi ont unanimement reconnu la nécessité de fournir des services de vulgarisation entièrement gra-tuits aux petits exploitants. Les agriculteurs commerciaux à part entière (ou «émergents») devraient en revanche payer pour ces services. Il est clair que ces deux groupes ont des besoins différents. Les agriculteurs commerciaux au-ront besoin d'une formation en entrepreneuriat et de conseils qui les aideront à améliorer leur position dans les chaînes de valeur (en transfor-mant le cacao en chocolat ou en proposant des participatifs et orientés vers la demande», a dé-claré M. Hoffmann. Deux règles doivent être suivies : «éviter les conflits de rôles» et «pas de vulgarisation sans contenu». Selon M. Hoff-mann, l'État devrait continuer de jouer son rôle dans la détermination des politiques, la réglementation sur la façon dont les services de vulgarisation opèrent, tout en s'assurant que de bons conseils soient prodigués aux agriculteurs. Il devrait toutefois réduire son engagement di-rect dans la fourniture de services ou d'intrants aux agriculteurs. D'autres prestataires de ser-au lendemain.» a-t-il précisé. « On ne peut y parvenir du jour charger. «Cela doit être un processus graduel», sations non gouvernementales, pourraient s' en vices, tels que des sociétés privées et des organi- risation souffrent encore d'un certain nombre de faiblesses. Ils tendent à être bureaucratiques et inefficaces. Au lieu de consulter les agricul-teurs pour connaître leurs besoins, les agents publics de vulgarisation décident généralement de ce qui est le mieux pour eux. Par ailleurs, des conflits de rôles surgissent fréquemment, avec des agents publics de vulgarisation qui interviennent en tant que conseillers, policiers et arbitres pour décider de l' octroi de subven-tions ou d'autres aides aux agriculteurs. Cela se traduit inévitablement par un manque de confiance entre les agents de vulgarisation et les agriculteurs. «Il y a de fortes raisons pour soutenir la création de systèmes pluralistes de prestation, qui soient Les participants à la conférence de Nairobi ont unanimement reconnu la nécessité de fournir des services de vulgarisation entièrement gra-tuits aux petits exploitants. Les agriculteurs commerciaux à part entière (ou «émergents») devraient en revanche payer pour ces services. Il est clair que ces deux groupes ont des besoins différents. Les agriculteurs commerciaux au-ront besoin d'une formation en entrepreneuriat et de conseils qui les aideront à améliorer leur position dans les chaînes de valeur (en transfor-mant le cacao en chocolat ou en proposant desparticipatifs et orientés vers la demande», a dé-claré M. Hoffmann. Deux règles doivent être suivies : «éviter les conflits de rôles» et «pas de vulgarisation sans contenu». Selon M. Hoff-mann, l'État devrait continuer de jouer son rôle dans la détermination des politiques, la réglementation sur la façon dont les services de vulgarisation opèrent, tout en s'assurant que de bons conseils soient prodigués aux agriculteurs. Il devrait toutefois réduire son engagement di-rect dans la fourniture de services ou d'intrants aux agriculteurs. D'autres prestataires de ser-au lendemain.» a-t-il précisé. « On ne peut y parvenir du jour charger. «Cela doit être un processus graduel», sations non gouvernementales, pourraient s' en vices, tels que des sociétés privées et des organi-  "},{"text":"devons renforcer les capacités à tous les niveaux, améliorer le niveau de formation des agri- culteurs, investir davantage dans la formation des agents de vulgarisation et renforcer la capacité des établissements  développeMent des capacités Un certain nombre de facteurs sont responsables de la faible productivité agricole, notamment le manque de connaissances techniques, la faiblesse des compétences entrepreneuriales et un accès limité aux technologies de la communication qui permettraient aux agriculteurs, aux vulgarisateurs et autres de partager leurs informations. En sur-montant ces problèmes et en améliorant l'accès aux marchés, il serait possible d'accroître la pro-ductivité et les revenus agricoles. D' où l'impor-tance du développement des capacités. «Autrefois, lorsqu' on parlait de développement des capacités, cela faisait essentiellement réfé-rence à la fourniture de connaissances et d'infor-mations techniques aux agriculteurs », a déclaré Kristin Davis, coprésidente de la conférence et animatrice du groupe de travail thématique sur le développement des capacités. « Aujourd'hui, le changement est engagé, et lors de la conférence nous avons examiné les possibilités de dévelop-pement des capacités dans la perspective des sys-tèmes d'innovation. » Cela signifie que les vulgarisateurs du futur -ou «nouveaux agents de vulgarisation» -auront une responsabilité qui va au-delà de la fourniture aux agriculteurs d'informations techniques, notam-ment sur le type de variétés de semences à uti-liser, la façon de lutter contre les maladies et les ravageurs ou de produire un meilleur compost. Ils devront aussi acquérir des compétences « trans-versales », non techniques, qui leur permettront Le regain d'intérêt et les engagements pris pour de générer et de promouvoir des innovations, d'améliorer la gestion des associations paysannes et des entreprises agroalimentaires, de former des alliances et des réseaux à partir des différents groupes et individus opérant tout au long des chaînes de valeur. Le développement et le renforcement des capa-cités -entendues au sens de capacités du système humain à produire des résultats, à se maintenir et à s'auto-renouveler -est important à de nom-breux titres. Les agriculteurs, les agents de vulga-risation des secteurs public et privé, les chercheurs et les journalistes doivent aussi améliorer leurs connaissances et leurs compétences. Outre l'ap-port de conseils et l'acquisition de nouvelles com-pétences et connaissances destinées à accroître la productivité, le développement des capacités peut aider les agriculteurs à tirer parti des opportunités de marché, à s'adapter au changement climatique, à forger de nouveaux partenariats et à apprendre comment utiliser au mieux les technologies de l'information et de la communication (TIC). On n'insistera jamais assez sur l'importance de l'innovation. Les agriculteurs et autres acteurs impliqués dans la chaîne alimentaire doivent promouvoir l'innovation dans les domaines de la production, de la transformation, de la com-mercialisation et de la distribution. Cela devrait conduire à une augmentation de la production agricole, à des revenus plus élevés et à une gestion plus durable des ressources naturelles. Cela néces-sitera de nouvelles manières de penser et de gérer les choses, et une réelle volonté d'appréhender le changement. outils et approches accroître les investissements dans l'agriculture constituent une opportunité qui vient à point et orientés vers la performance. participatifs, bien financés, guidés par la demande et de conseil axés sur les besoins des agriculteurs, nommé pour offrir des services de vulgarisation Le troisième groupe de travail thématique, pré- développeMent des capacités Un certain nombre de facteurs sont responsables de la faible productivité agricole, notamment le manque de connaissances techniques, la faiblesse des compétences entrepreneuriales et un accès limité aux technologies de la communication qui permettraient aux agriculteurs, aux vulgarisateurs et autres de partager leurs informations. En sur-montant ces problèmes et en améliorant l'accès aux marchés, il serait possible d'accroître la pro-ductivité et les revenus agricoles. D' où l'impor-tance du développement des capacités. «Autrefois, lorsqu' on parlait de développement des capacités, cela faisait essentiellement réfé-rence à la fourniture de connaissances et d'infor-mations techniques aux agriculteurs », a déclaré Kristin Davis, coprésidente de la conférence et animatrice du groupe de travail thématique sur le développement des capacités. « Aujourd'hui, le changement est engagé, et lors de la conférence nous avons examiné les possibilités de dévelop-pement des capacités dans la perspective des sys-tèmes d'innovation. » Cela signifie que les vulgarisateurs du futur -ou «nouveaux agents de vulgarisation» -auront une responsabilité qui va au-delà de la fourniture aux agriculteurs d'informations techniques, notam-ment sur le type de variétés de semences à uti-liser, la façon de lutter contre les maladies et les ravageurs ou de produire un meilleur compost. Ils devront aussi acquérir des compétences « trans-versales », non techniques, qui leur permettront Le regain d'intérêt et les engagements pris pour de générer et de promouvoir des innovations, d'améliorer la gestion des associations paysannes et des entreprises agroalimentaires, de former des alliances et des réseaux à partir des différents groupes et individus opérant tout au long des chaînes de valeur. Le développement et le renforcement des capa-cités -entendues au sens de capacités du système humain à produire des résultats, à se maintenir et à s'auto-renouveler -est important à de nom-breux titres. Les agriculteurs, les agents de vulga-risation des secteurs public et privé, les chercheurs et les journalistes doivent aussi améliorer leurs connaissances et leurs compétences. Outre l'ap-port de conseils et l'acquisition de nouvelles com-pétences et connaissances destinées à accroître la productivité, le développement des capacités peut aider les agriculteurs à tirer parti des opportunités de marché, à s'adapter au changement climatique, à forger de nouveaux partenariats et à apprendre comment utiliser au mieux les technologies de l'information et de la communication (TIC). On n'insistera jamais assez sur l'importance de l'innovation. Les agriculteurs et autres acteurs impliqués dans la chaîne alimentaire doivent promouvoir l'innovation dans les domaines de la production, de la transformation, de la com-mercialisation et de la distribution. Cela devrait conduire à une augmentation de la production agricole, à des revenus plus élevés et à une gestion plus durable des ressources naturelles. Cela néces-sitera de nouvelles manières de penser et de gérer les choses, et une réelle volonté d'appréhender le changement. outils et approches accroître les investissements dans l'agriculture constituent une opportunité qui vient à point et orientés vers la performance. participatifs, bien financés, guidés par la demande et de conseil axés sur les besoins des agriculteurs, nommé pour offrir des services de vulgarisation Le troisième groupe de travail thématique, pré-  "},{"text":"Dans le monde des affaires, le client est roi, mais, dès lors que l'on parle d'agriculteurs, le « client » a tendance à être manipulé. il convient d'avoir un comportement plus respectueux vis-à-vis des agricul- teurs et de leur famille, et nous devons reconnaître l'importance de leur rôle en tant que producteurs de denrées alimentaires et créateurs de richesses du secteur privé.\" Mamadou Cissokho, membre du Comité de la sécurité alimentaire mondiale (CFs), sénégal  \" dérante dans la plupart des pays en développe-ment. En outre, les services de vulgarisation et de conseil peuvent et doivent jouer un rôle important pour améliorer l'accès des agriculteurs et des entre-preneurs aux connaissances, au crédit, aux intrants et aux marchés tout au long des chaînes de valeur, et ils ont le potentiel pour aider les agriculteurs à améliorer leur productivité et leurs revenus. Il est urgent d' établir une coalition de groupes issus de la société civile et des secteurs privé et public pour faire campagne en faveur d'une revitalisation des services de vulgarisation et de conseil agricoles. Si, au cours des dernières décennies, les associa-tions paysannes, les chercheurs, les agences de vulgarisation ainsi que d'autres acteurs ont tenté d' élaborer des solutions imaginatives pour redon-ner vie aux services de vulgarisation, les résultats obtenus sont mitigés. Nombre de politiques, stra-tégies et approches en matière de vulgarisation n' ont pas permis d'accroître la production agri-cole ni d'améliorer les moyens de subsistance des communautés rurales. Il est urgent d' engager une réforme politique et institutionnelle, d'augmenter les investissements et de créer des services de vul-garisation participatifs, orientés vers la demande et axés sur la performance. La Déclaration de Nairobi appelle tous ceux qui sont impliqués dans des services de vulgarisation et de conseil agricoles -gouvernements nationaux, agents de vulgarisation, associations paysannes et donateurs internationaux -à travailler ensemble pour réaliser un certain nombre d' objectifs. Premièrement, ils devront développer de ma-nière participative des politiques et des straté-gies claires en matière de vulgarisation. Deu-xièmement, ils devront plaider en faveur d'un financement accru des services de vulgarisation et de conseil, et promouvoir des mécanismes qui assurent la prestation durable et efficace de ser-vices interreliés de qualité. Troisièmement, les partenaires de la coalition devront promouvoir et faciliter un processus continu de renforcement des capacités et d'apprentissage, et encourager une utilisation plus large des TIC et des médias. Quatrièmement, les partenaires devront élaborer et mettre en oeuvre des processus participatifs de suivi-évaluation des services de vulgarisation et de conseil. La Déclaration de Nairobi vaudra-t-elle plus que le prix du papier sur lequel elle est écrite ? C' est du moins ce que croient les organisateurs de la conférence. « Mon organisation, le Forum pour la recherche agricole en Afrique (FARA), ainsi que d'autres organisations telles que le Forum afri-cain des services de conseil agricole (AFAAS), utiliseront cette Déclaration pour promouvoir les réformes », affirme Myra Wopereis-Pura. « La Déclaration propose une approche commune et donne des orientations claires sur ce qui doit être fait pour améliorer les services de vulgarisation. » Kristin Davis, secrétaire exécutive du Forum leur famille\". » productivité des petits exploitants agricoles et de oeuvre si nous voulons améliorer le bien-être et la et ce sont de telles mesures qu'il faut mettre en leur dire : \"Regardez, c' est un problème important envoyer la Déclaration aux décideurs politiques et rera être un document précieux. « Nous pouvons également que la Déclaration de Nairobi s'avé-mondial pour le conseil rural (GFRAS), pense \"dérante dans la plupart des pays en développe-ment. En outre, les services de vulgarisation et de conseil peuvent et doivent jouer un rôle important pour améliorer l'accès des agriculteurs et des entre-preneurs aux connaissances, au crédit, aux intrants et aux marchés tout au long des chaînes de valeur, et ils ont le potentiel pour aider les agriculteurs à améliorer leur productivité et leurs revenus. Il est urgent d' établir une coalition de groupes issus de la société civile et des secteurs privé et public pour faire campagne en faveur d'une revitalisation des services de vulgarisation et de conseil agricoles. Si, au cours des dernières décennies, les associa-tions paysannes, les chercheurs, les agences de vulgarisation ainsi que d'autres acteurs ont tenté d' élaborer des solutions imaginatives pour redon-ner vie aux services de vulgarisation, les résultats obtenus sont mitigés. Nombre de politiques, stra-tégies et approches en matière de vulgarisation n' ont pas permis d'accroître la production agri-cole ni d'améliorer les moyens de subsistance des communautés rurales. Il est urgent d' engager une réforme politique et institutionnelle, d'augmenter les investissements et de créer des services de vul-garisation participatifs, orientés vers la demande et axés sur la performance. La Déclaration de Nairobi appelle tous ceux qui sont impliqués dans des services de vulgarisation et de conseil agricoles -gouvernements nationaux,agents de vulgarisation, associations paysannes et donateurs internationaux -à travailler ensemble pour réaliser un certain nombre d' objectifs. Premièrement, ils devront développer de ma-nière participative des politiques et des straté-gies claires en matière de vulgarisation. Deu-xièmement, ils devront plaider en faveur d'un financement accru des services de vulgarisation et de conseil, et promouvoir des mécanismes qui assurent la prestation durable et efficace de ser-vices interreliés de qualité. Troisièmement, les partenaires de la coalition devront promouvoir et faciliter un processus continu de renforcement des capacités et d'apprentissage, et encourager une utilisation plus large des TIC et des médias. Quatrièmement, les partenaires devront élaborer et mettre en oeuvre des processus participatifs de suivi-évaluation des services de vulgarisation et de conseil. La Déclaration de Nairobi vaudra-t-elle plus que le prix du papier sur lequel elle est écrite ? C' est du moins ce que croient les organisateurs de la conférence. « Mon organisation, le Forum pour la recherche agricole en Afrique (FARA), ainsi que d'autres organisations telles que le Forum afri-cain des services de conseil agricole (AFAAS), utiliseront cette Déclaration pour promouvoir les réformes », affirme Myra Wopereis-Pura. « La Déclaration propose une approche commune et donne des orientations claires sur ce qui doit être fait pour améliorer les services de vulgarisation. » Kristin Davis, secrétaire exécutive du Forum leur famille\". » productivité des petits exploitants agricoles et de oeuvre si nous voulons améliorer le bien-être et la et ce sont de telles mesures qu'il faut mettre en leur dire : \"Regardez, c' est un problème important envoyer la Déclaration aux décideurs politiques et rera être un document précieux. « Nous pouvons également que la Déclaration de Nairobi s'avé-mondial pour le conseil rural (GFRAS), pense  "},{"text":"Déclaration de Nairobi sur les services de vulgarisation et de conseil J 28 nous, plus de 400 participants comprenant des professionnels de la vulgarisation des secteurs public et privé et des organisations de la société civile, des des décideurs politiques et des représentants de la communauté de recherche et de développement, du milieu universitaire, du secteur privé, des organismes donateurs, des institutions financières et des médias de 75 pays, avons participé à Nairobi, au Kenya, du 15 au 18 novembre 2011, à une conférence internationale intitulée « Innovations dans les services de vulgarisation et de conseil : Mettre les connaissances au service des politiques et des actions en faveur de l'alimentation et des moyens de subsistance». • que l'agriculture à petite échelle et l'agriculture familiale sont les contributeurs principaux à la production agricole dans la plupart des pays en développement et ont, par conséquent, un rôle essentiel à jouer dans la réalisation des objectifs de sécurité alimentaire et nutritionnelle, dans la réduction de la pauvreté et l'amélioration des moyens de subsistance, et dans la la lutte contre le changement climatique ; • que dans des systèmes d'innovation dynamiques, la vulgarisation joue un rôle indispensable de facilitateur et d'intermédiaire entre, d'une part, les prestataires de services et les organismes d'appui et, d'autre part, les petits exploitants agricoles et les autres entrepreneurs, notamment les femmes et les jeunes ;• que des services de vulgarisation et de conseil efficaces contribuent à renforcer la capacité des petits exploitants agricoles à tirer profit des opportunités réalistes et rémunératrices à travers l'accès aux connaissances, au crédit, aux marchés et autres services connexes ; • qu'une coalition d'acteurs du secteur privé, du secteur public et de la société civile au niveau national, régional et international s'avère nécessaire pour revitaliser et moderniser les services de vulgarisation et de conseil en vue d'appuyer le processus d'innovation dans le secteur de l'agriculture. notant : notant : • que la conférence a suscité beaucoup d'intérêt, mobilisé de nombreux acteurs et démontré la néces-sité de développer davantage les services de vulgarisation et de conseil dans le cadre de l'agenda du développement agricole mondial ; • que, en réponse au désarroi causé par le sous-investissement dans les services de vulgarisation et de conseil, les professionnels de la vulgarisation, les associations paysannes, les chercheurs, les décideurs politiques et les partenaires du développement tentent d' élaborer des solutions imaginatives pour redonner vie à la vulgarisation ; • qu'une pléthore de politiques, de stratégies et d'initiatives orientées vers la demande, spécifiques au contexte, prenant en compte l' équité hommes-femmes et intelligentes face au climat, sont en train de voir le jour ; • que ces multiples politiques, stratégies et approches ne sont pas encore parvenues à l'impact souhaité sur les secteurs agricole et rural ; • que des changements politiques et institutionnels s'avèrent plus que jamais nécessaires afin d' offrir des opportunités réalistes et rémunératrices aux petits exploitants agricoles ; • que la conférence a suscité beaucoup d'intérêt, mobilisé de nombreux acteurs et démontré la néces-sité de développer davantage les services de vulgarisation et de conseil dans le cadre de l'agenda du développement agricole mondial ; • que, en réponse au désarroi causé par le sous-investissement dans les services de vulgarisation et de conseil, les professionnels de la vulgarisation, les associations paysannes, les chercheurs, les décideurs politiques et les partenaires du développement tentent d' élaborer des solutions imaginatives pour redonner vie à la vulgarisation ; • qu'une pléthore de politiques, de stratégies et d'initiatives orientées vers la demande, spécifiques au contexte, prenant en compte l' équité hommes-femmes et intelligentes face au climat, sont en train de voir le jour ; • que ces multiples politiques, stratégies et approches ne sont pas encore parvenues à l'impact souhaité sur les secteurs agricole et rural ; • que des changements politiques et institutionnels s'avèrent plus que jamais nécessaires afin d' offrir des opportunités réalistes et rémunératrices aux petits exploitants agricoles ;  "}],"sieverID":"63fdfe7d-a59f-4db2-a448-e39422184df5","abstract":"Mettre les connaissances au service de l'action politique pour une Meilleure production aliMentaire Vulgarisation agricole Le temps du changement repères politiques Il s'agit de changer la manière de travailler et de s'assurer que les réformes engagées sont rentables et durables.\" \" Michael Hailu,"}

data/part_2/06f71969e9718f49e323914a576597d4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06f71969e9718f49e323914a576597d4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c51263ee-722a-40b1-bdaf-4ebc542309da/retrieve"},"pageCount":21,"title":"November 23 | Co-diseñando innovaciones en las cadenas de valor de frijol y maíz en Honduras, para su crecimiento inclusivo y sostenible 0 Co-diseñando innovaciones en las cadenas de valor de frijol y maíz en Honduras, para su crecimiento inclusivo y sostenible Informe de taller con actores del sector","keywords":[],"chapters":[{"head":"Antecedentes","index":1,"paragraphs":[{"index":1,"size":92,"text":"La Iniciativa \"Transformando los mercados alimentarios y las cadenas de valor para la inclusión y la sostenibilidad\" tiene como objetivo proporcionar evidencia sobre el tipo de innovaciones, estructuras de incentivos y políticas que son más efectivas para crear una distribución más equitativa de los ingresos y las oportunidades de empleo en los mercados de alimentos en crecimiento, al tiempo que se reduce la huella ambiental del sector alimentario, en países como Honduras, Guatemala, Nigeria, Uganda, Etiopía, Uzbekistán, y Bangladesh. El trabajo de la iniciativa se divide en cuatro grupos, con distintos enfoques."},{"index":2,"size":179,"text":"Uno de los grupos de trabajo tiene como objetivo mejorar la participación y rentabilidad de productores pequeños y de pequeñas y medianas empresas (PYMES) en cadenas de valor domésticas, enfocándose en granos básicos. En dicho grupo de trabajo se pretende evaluar la efectividad y sinergias entre innovaciones en la cadena doméstica de granos básicos, contribuyendo a eliminar las barreras que enfrentan los productores pequeños (incluyendo mujeres y jóvenes) para participar y beneficiarse de éstas. Para cumplir con este objetivo, este grupo de trabajo de la iniciativa divide sus actividades en tres etapas. Durante la primera etapa, el interés se centra en conocer la situación actual de las cadenas en el país, identificando retos y oportunidades para innovar en los distintos eslabones de la cadena. En la segunda etapa, se diseñará e implementará un estudio piloto para evaluar innovaciones identificadas durante la primera etapa, y que tienen potencial de impacto. Finalmente, en la tercera etapa se definirán estrategias de escalamiento para promover el uso de las innovaciones evaluadas y que mostraron un impacto positivo en los actores de la cadena."},{"index":3,"size":167,"text":"Entre las actividades principales realizadas en la primera etapa del trabajo de la iniciativa están las siguientes. Primero, se hizo un evento con actores clave en junio de 2022 en Tegucigalpa, Honduras, para inaugurar la iniciativa (junto a otras iniciativas promovidas por el Grupo Consultivo Internacional de Investigación Agrícola -CGIAR). Durante este evento los participantes opinaron sobre los temas más relevantes para el sector de granos básicos en el país, información que sirvió para enfocar el trabajo de la iniciativa. Luego, se diseñó un estudio de alcance 1 para identificar los desafíos y las oportunidades de innovación para hacer las cadenas de valor de frijol y maíz más inclusivas y rentables. Para esto, se hizo una revisión de literatura y se realizaron entrevistas semiestructuradas con actores en los distintos eslabones de las cadenas de valor de estos cultivos. Finalmente, se presentaron los resultados de este estudio de alcance a actores de las cadenas de valor, en un taller realizado en diciembre de 2022 en Tegucigalpa (Foto 1)."},{"index":4,"size":104,"text":"Este informe presenta los resultados de dicho taller, enfocado en los resultados del trabajo grupal realizado para priorizar innovaciones, y se encuentra estructurado de la siguiente manera. La sección 2 describe los objetivos del taller y mecanismo de implementación. La sección 3 resume los hallazgos principales del estudio de alcance que se presentó a los participantes. La sección 4 presenta los aportes de los participantes sobre los resultados presentados. La sección 5 describe los resultados de un ejercicio de co-diseño y priorización de innovaciones realizado con los participantes. Finalmente, la sección 6 incluye las conclusiones del taller. Los anexos están en la sección 7."}]},{"head":"Objetivos e implementación del taller","index":2,"paragraphs":[{"index":1,"size":26,"text":"El taller se llamó \"Taller con Actores Clave: oportunidades y retos para innovaciones en maíz y frijol en Honduras\". La implementación del taller tuvo tres objetivos:"},{"index":2,"size":70,"text":"1. Presentar los resultados preliminares del estudio de alcance realizado mediante consultas a actores clave de las cadenas de valor de frijol y maíz. 2. Validar los resultados preliminares del estudio de alcance. 3. Identificar prioridades de investigación y co-diseñar posibles innovaciones a incluir en un estudio piloto de evaluación, orientado a resolver los cuellos de botella que se presentan en el sector y que se relacionan con la iniciativa."},{"index":3,"size":245,"text":"Al taller se invitaron a 52 actores clave, incluyendo actores entrevistados y no entrevistados, pero con incidencia en las cadenas de valor de interés. Para extender las invitaciones (Anexo 1) se empleó varios medios de contacto, incluyendo llamadas telefónicas, correo electrónico, y mensajes por WhatsApp. Del total de invitados, 25 personas (8 mujeres) representando a 14 organizaciones participaron (Anexo 2). Además, 6 investigadores de la iniciativa (3 mujeres) participaron como organizadores y expositores. El taller tuvo una duración de cuatro horas, durante la mañana y parte de la tarde. La agenda (Anexo 3) para lograr los objetivos planteados fue estructurada con sesiones plenarias y grupales de la siguiente forma:  Durante las sesiones plenarias se presentaron los resultados preliminares del estudio de alcance y se validaron los mismos con los participantes. Además, se organizó el trabajo grupal. Inicialmente se tenía planeado agrupar a los participantes, según su preferencia, en tres grupos de trabajo: (i) innovaciones en el sector productivo, comercialización y servicios de apoyo (investigación, financiero, etc.); (ii) innovaciones para el sector de la industria alimentaria; y (iii) innovaciones políticoinstitucionales. Sin embargo, luego de preguntar las preferencias de los participantes, la mayoría estuvo interesado en los grupos (i) y (iii), con una proporción ligeramente mayor interesada en el grupo (i). Esto se presentó debido a la escasa participación de actores del sector de la industria alimentaria en el taller. Por ende, se fusionaron los participantes interesados en el grupo (ii) con el grupo (iii) (Foto 2)."},{"index":4,"size":66,"text":"Para estructurar el trabajo de los grupos, se les pidió que respondan dos preguntas: (1) ¿entre los retos e innovaciones presentadas (del estudio de alcance), se ha malinterpretado alguno, o cuáles hicieron falta? Y (2) ¿qué innovaciones se deben priorizar para incluir en un estudio piloto de evaluación en 2023-2024? Al finalizar la sesión, cada grupo presentó los resultados de su trabajo, en una sesión plenaria."}]},{"head":"Foto 2. Trabajo de grupos i (izquierda) y ii (derecha)","index":3,"paragraphs":[{"index":1,"size":9,"text":"Tomada por Mirian Colindres (izquierda) y Byron Reyes (derecha)"}]},{"head":"Resumen de los resultados del estudio de alcance","index":4,"paragraphs":[{"index":1,"size":111,"text":"En esta sección discutimos brevemente 2 los resultados del estudio de alcance presentados durante el taller, los cuales se enmarcaron en tres grandes áreas: sector productivo, de comercialización y servicios de apoyo (componente I); sector de la industria del procesamiento de alimentos (componente II); y sector de políticas y regulaciones (componente III). Estas áreas fueron definidas con base en resultados de una revisión bibliográfica, la cual se realizó para entender la situación del sector, qué investigaciones y evaluaciones de tecnologías se han realizado, y en qué áreas falta hacer investigación. Esta información permitió definir un marco conceptual para el estudio, y siguiendo este marco conceptual se identificó los actores a entrevistar."},{"index":2,"size":68,"text":"Como se observa (Tabla 1), la revisión de información secundaria (literatura) se enfocó principalmente en literatura gris (reportes), seguido por artículos científicos revisados por pares, y libros. Los resultados de este proceso fueron clave para definir un marco conceptual para el estudio y orientar el diseño de las guías de entrevistas para el estudio de alcance, especialmente para enfocarnos en los temas estratégicos más relevantes para el sector."},{"index":3,"size":118,"text":"El marco conceptual ilustrado en la Figura 1 se usó de guía para identificar tipos de actores en cada eslabón de la cadena de valor, cantidad de actores, e información de contacto disponible, para identificar una muestra para entrevista. Como se observa, el marco conceptual incluye actores que proveen servicios de apoyo en la parte superior, el entorno político-legal y regulatorio (en la parte inferior) que influencia el accionar de los actores de la cadena de valor (ilustrados en el centro). En cada uno de estos tres niveles se puede identificar limitaciones y oportunidades para innovar. Siguiendo este marco conceptual, identificamos los eslabones más relevantes de la cadena de valor de frijol y maíz, y actores para entrevistar."},{"index":4,"size":186,"text":"Para realizar las entrevistas, y debido a la cantidad de eslabones (y actores) de interés para la iniciativa, el trabajo se organizó siguiendo los tres componentes mencionados arriba, de la siguiente manera: la ABC entrevistó a siete tipos de actores (componente I del estudio de alcance), el Centro Internacional del Maíz y Trigo (CIMMYT) entrevistó actores en el eslabón de la industria de procesamiento de alimentos (componente II), y el Centro Agroforestal Mundial (ICRAF) lideró las actividades relacionadas al marco político-legal del sector (componente III). En la Tabla 2 se presenta la cantidad de actores entrevistados por la ABC en 2022, relacionado al componente I. En total, la ABC realizó 33 entrevistas en noviembre de 2022, a 49 personas. Adicional a esto se hicieron 5 entrevistas a actores relacionados al componente II y 18 entrevistas a actores gubernamentales y otro tipo de actores relacionados al componente III (Tabla 3). Para analizar la información se realizó un proceso de síntesis de los retos y las innovaciones identificadas, permitiendo clasificar los retos más frecuentes mencionados por los entrevistados, y que fueron los que se presentaron en el taller. "}]},{"head":"Sector privado 2","index":5,"paragraphs":[{"index":1,"size":2,"text":"Gobierno 5"}]},{"head":"Agencias de desarrollo 5","index":6,"paragraphs":[{"index":1,"size":2,"text":"Total 18"}]},{"head":"Fuente: Autores","index":7,"paragraphs":[]},{"head":"Resultados preliminares del componente I","index":8,"paragraphs":[{"index":1,"size":218,"text":"A los participantes del taller se les presentó los resultados detallados en la Tabla 4. Para el taller, los resultados se enfocaron en los cuellos de botella más comunes mencionados por los entrevistados, y posibles innovaciones para aliviar dichos cuellos de botella. Como se observa, hay cuellos de botella (o retos) que son comunes entre eslabones, y que fueron reportados por más de un tipo de actor. Uno de los principales retos es la falta de asistencia técnica, que fue reportada como una limitante por los representantes de las asociaciones de productores, de investigación, agencias de desarrollo, e intermediarios y mayoristas. Estos actores consideran que se necesita más asistencia para ayudar al sector a enfrentar sus retos. Otro reto mencionado de manera frecuente por los encargados de compras institucionales de grano, los representantes de las agencias de desarrollo, y los intermediarios y mayoristas se relaciona a la baja calidad del grano. Esto se debe principalmente a la baja adopción de prácticas de manejo del cultivo y postcosecha, que favorezcan la calidad de lo que se produce, además de las limitaciones en la disponibilidad de infraestructura de procesamiento (o acondicionamiento). De manera similar, tres tipos de actores entrevistados reportaron que el acceso a crédito es un reto que los actores en la cadena de valor de granos básicos enfrentan."},{"index":2,"size":58,"text":"Otros retos reportados incluyen la falta de mano de obra, la (falta de) trazabilidad del grano, la inconsistencia en la oferta de grano (e.g., pérdidas, incumplimiento de contratos), y la falta de acceso a tecnologías modernas (e.g., variedades, infraestructura de secado, herramientas digitales, servicios mecanizados), limitaciones que fueron mencionadas por lo menos por dos tipos de actores entrevistados."},{"index":3,"size":21,"text":"Entre las innovaciones identificadas para ayudar a resolver estas limitantes se encontraron las siguientes, en orden de importancia (más reportadas primero):"},{"index":4,"size":360,"text":"1. Proveer información y asistencia técnica a productores y asociaciones de productores, en diversos temas, según el actor al que se atiende. Por ejemplo, a nivel productivo se mencionó la necesidad de capacitar en prácticas de manejo, uso eficiente de insumos, etc. A nivel organizativo se mencionó la necesidad de entrenamiento en gestión de grupos, desarrollo empresarial, manejo de información, entre otros. 2. Gestionar cambios en la normatividad mediante la generación de evidencia que pueda ser usada por tomadores de decisiones. 3. Aumentar la vinculación con servicios financieros especializados, para incrementar el acceso a crédito, y facilitar el cumplimiento de las garantías requeridas por algunos proveedores de estos servicios. 4. Fomentar inversión en infraestructura productiva y de almacenamiento. 5. Promover y capacitar en el uso de tecnologías orientadas a incrementar la productividad, o que reduzcan la demanda de mano de obra. 6. Mejorar la vinculación de la demanda por mercados especializados (e.g., compras institucionales) con los ciclos productivos. 7. Promover el uso de tecnologías para la inclusión digital en los distintos eslabones. Esto además contribuiría a mejorar la trazabilidad de los productos y el acceso a información (agroclimática, precios, mercados) por parte de los actores. Durante el taller se vincularon los cuellos de botellas con posibles innovaciones, dado que una misma innovación podría contribuir a aliviar más de un cuello de botella y en eslabones distintos. Por ejemplo, el proveer información y asistencia técnica a productores y asociaciones de productores aliviaría el cuello de botella relacionado al limitado acceso de información y falta de asistencia técnica, reportado por las asociaciones de productores (que afecta tanto a los productores como las asociaciones) y agencias de desarrollo; los problemas de calidad de grano reportados por representantes de compras institucionales, agencias de desarrollo e intermediarios y mayoristas; y la falta de servicio de extensión para transferir conocimientos generados por la investigación a los usuarios, reportado por actores del sector de investigación. Algo similar se hizo con tres innovaciones adicionales identificadas en el estudio de alcance. Además, se identificó que algunas de las innovaciones se pueden implementar con el trabajo que se está haciendo en el componente III (e.g., evidencia para tomadores de decisiones)."},{"index":5,"size":19,"text":"Tabla 4. Retos reportados por tipo de actor en las cadenas de valor de frijol y maíz en Honduras "}]},{"head":"Asociaciones de productores","index":9,"paragraphs":[]},{"head":"Compras institucionales","index":10,"paragraphs":[]},{"head":"Resultados preliminares del componente II","index":11,"paragraphs":[{"index":1,"size":49,"text":"Los resultados preliminares presentados a los participantes del taller, relacionados a los avances realizados en la industria del procesamiento de alimentos, se enmarcaron en dos temas: el uso de maíz nacional para la industria de harina, y el procesamiento de maíz y frijol por pequeñas y medianas empresas (PyMEs)."},{"index":2,"size":225,"text":"Con respecto al uso de maíz nacional para la industria de harina, los resultados indican que existe un convenio tripartito de compraventa entre la Secretaría de Agricultura y Ganadería del gobierno, empresas procesadoras de harina (DEMAHSA, INDECASA, IMSA y MATURAVE), y asociaciones de productores para la compra de maíz blanco. Por medio de este convenio, la industria de la harina compra a organizaciones de productores una proporción que puede variar de 3:1 a 3:3 dependiendo la disponibilidad de grano en el país. La razón principal por la que este convenio sigue vigente es porque da acceso a la industria a cuotas de maíz importado y porque debido a la importancia que el cultivo tiene en el país, está protegido con un arancel del 45%. Lo contrario pasa en la industria de alimentos balanceados para animales, que hasta hace pocos años también era un importante mercado para el maíz blanco de producción nacional, pero debido a que el maíz amarillo alcanzó una desgravación total, esta industria redujo significativamente la compra de maíz nacional, al preferir el maíz amarillo importado, ya que a su punto de vista es de mejor calidad y con mejor precio. Según los representantes de las organizaciones de productores, esto provocó una reducción de la producción nacional y que las asociaciones buscaran innovar en la producción propia de alimentos balanceados, utilizando grano nacional."},{"index":3,"size":70,"text":"Con respecto al procesamiento de maíz y frijol por PyMEs, se observó que, aunque hay empresas legalmente constituidas, hay muchas empresas informales procesando maíz. Entre los productos elaborados hay poca diversidad y limitada sofisticación (e.g., frijol molido y empacado en bolsas, harina de maíz, tortillas de maíz y pan). En general, el enfoque de estos actores está centrado en satisfacer mercados locales, y en menor escala los nacionales o internacionales."},{"index":4,"size":54,"text":"En 2023 se pretende hacer un análisis más profundo en: evaluar las capacidades, necesidades y estrategias de innovación de las empresas procesadoras y priorizar innovaciones que se pueden pilotear en una evaluación en 2024. Además, se entrevistarán más actores para aumentar la información disponible para identificar innovaciones que se deben estudiar con mayor detalle."}]},{"head":"Resultados preliminares del componente III","index":12,"paragraphs":[{"index":1,"size":45,"text":"Entre los retos e innovaciones político-institucionales, se presentó información de avance sobre los retos e innovaciones identificadas a este nivel, enmarcado en tres áreas y sobre las cuales se pretende profundizar el análisis en 2023 y 2024: políticas de semilla, políticas comerciales y políticas agroalimentarias."},{"index":2,"size":99,"text":"En el tema de políticas de semilla, los resultados preliminares resaltaron que, en la actualidad, mucha de la semilla mejorada se distribuye a través del bono tecnológico productivo y ONG. Sin embargo, todavía hay mucho uso de 'semilla' nativa o criolla, lo que sugiere que hay una demanda insatisfecha de semilla. Además, la producción de semilla mejorada se hace principalmente a través de cuatro entes (DICTA, Zamorano, Red de Productores Agrícolas de Semilla de Honduras (RED-PASH) y Hondugenet), y aunque DICTA tiene el mandato de mejorar la calidad de la semilla para aumentar los rendimientos, cuenta con recursos limitados."},{"index":3,"size":116,"text":"En esta área también se encontró que el Instituto Hondureño de Mercadeo Agrícola (IHMA), encargado de la reserva estratégica de granos del país, no realiza sus compras distinguiendo entre variedades, sino que compra por clase comercial (e.g., frijol rojo). Se podría estudiar la factibilidad e impacto de que este proceso distinga entre materiales (e.g., variedades), en la demanda de semilla de variedades específicas, para satisfacer esta demanda. Otro resultado encontrado es que el Gobierno de Honduras ha preparado un anteproyecto para la nueva Ley de Semillas (promovida por SINASEM), lo que permitiría realizar un análisis sobre el impacto en derechos intelectuales, y el posible rol que podrían desempeñar las PyMEs en la producción de semilla certificada."},{"index":4,"size":87,"text":"Con respecto a las políticas comerciales, se encontró que algunos componentes del DR-CAFTA (acuerdo de comercio libre entre Centroamérica-República Dominicana y los Estados Unidos) va a tener efectos ambivalentes, los cuales no están tan claros y merecen más atención. También se encontró que las compras del IHMA para la reserva estratégica solo representan el 4% del volumen producido, pero al definir un precio de garantía, afecta al mercado nacional. Además, estas reservas se dan a nivel nacional, y no hay una estrategia para reservas a nivel local."},{"index":5,"size":155,"text":"Otros resultados resaltan que, aunque hay acuerdos de compraventa (de maíz) entre la industria y asociaciones de productores, hay pocos incentivos para la industria para abastecerse con maíz doméstico, por razones de calidad y precio. Esto presenta una oportunidad para investigar si hay innovaciones que pudiesen contribuir a mejorar la calidad del grano al mismo tiempo de reducir costos, para hacer al sector más competitivo. Finalmente, otros resultados se relacionaron a las compras institucionales para el programa de alimentación escolar, dado que estas compras pudieran tener potencial para estimular la demanda de semilla de frijol y establecer vínculos directos con productores, pero en la actualidad hay un problema con la constancia de dichas compras. Además, el Programa Mundial de Alimentos (PMA), podría tener un rol mayor al tener una demanda significativa de grano, el cual se paga con sobreprecio comparado con el precio de garantía, lo que es un incentivo para los productores de grano."},{"index":6,"size":87,"text":"Con respecto a las políticas agroalimentarias, se encontró que existe una política del Estado sobre el Sector Agro-alimentario a largo plazo (2022-2042), y que se encuentra en la fase de anteproyecto. Esta política se ha preparado con amplias consultas a las diferentes partes interesadas y se enfoca en cinco pillares: la seguridad alimentaria; la soberanía alimentaria; la productividad, procesamiento y valor agregado; las familias campesinas; y el fortalecimiento institucional. Esta política tiene potencial para incentivar la producción, procesamiento y comercialización de maíz y frijol en el país."},{"index":7,"size":122,"text":"En 2023 se pretende profundizar en algunos de los siguientes temas: (i) realizar un análisis de la política crediticia del Estado, desde la perspectiva de los pequeños productores, asociaciones y cooperativas; (ii) la consideración de semillas nativas y criollas en el anteproyecto de la nueva Ley de Semillas y qué oportunidades habría para la inclusión de PyMEs en la producción de semilla, en el marco de esta ley; (iii) estudiar oportunidades para el apalancamiento de inversiones públicas y privadas en el desarrollo de las cadenas de maíz y frijol; y (iv) evaluar las capacidades para incrementar la producción de semilla en respuesta al aumento presupuestario para el bono tecnológico, así como los riesgos asociados con la posible inconstancia de los presupuestos estatales."}]},{"head":"Validación y retroalimentación de los resultados preliminares del estudio de alcance y las áreas de innovación propuestas","index":13,"paragraphs":[{"index":1,"size":126,"text":"La dinámica definida con los participantes del taller consistió primero en escuchar las presentaciones de los resultados preliminares del estudio de alcance, y al finalizar se invitó a todos los asistentes a participar, para expresar sus opiniones sobre los resultados presentados, específicamente qué tan alineados estaban con sus expectativas y lo que saben del sector, y proveyendo sugerencias sobre temas faltantes. Además, durante el trabajo de grupos respondieron a la siguiente pregunta: ¿entre los retos e innovaciones presentadas (del estudio de alcance), se ha malinterpretado alguno, o cuáles hicieron falta? A continuación, presentamos esta información, primero para el componente I del estudio de alcance (con insumos del grupo de trabajo 1), y después para los componentes II y III (con insumos del grupo de trabajo 2)."}]},{"head":"Consideraciones adicionales para el componente I del estudio de alcance","index":14,"paragraphs":[{"index":1,"size":211,"text":"En términos generales, los participantes confirmaron que los resultados presentados se alineaban a los cuellos de botella que enfrenta el sector. Sin embargo, proveyeron información adicional de dos maneras. Primero, algunos proveyeron más detalles sobre los cuellos de botella ya mencionados. Por ejemplo, un participante mencionó que \"hay una baja inversión en el sector frijolero, y que se requiere un cambio en las políticas para el sector productivo\" para reducir el riesgo enfrentado por este sector. Al analizar este comentario deducimos que estas inversiones podrían mejorar la productividad y la calidad del grano que se comercializa, además de los beneficios que conllevarían para el sector productivo y de comercialización. Los participantes también mencionaron que el acceso al mercado de compras públicas requiere fuertes inversiones, que los grupos de productores no pueden cumplir (por ejemplo, garantías bancarias), y que dicho mercado es menos flexible que en etapas anteriores (e.g., Programa Purchases for Progress-P4P). Sobre el acceso a crédito, mencionaron que algunas fuentes que antes daban crédito a productores de granos básicos (Banadesa) están descontinuadas (con incertidumbre sobre cuándo volverán a proveer crédito). 3 Finalmente, otros detalles mencionados fueron la necesidad de información agroclimática (que en otros sectores sí se provee este servicio), y sobre la cadena de valor (e.g., censo de productores)."},{"index":2,"size":56,"text":"Segundo, los participantes mencionaron otros cuellos de botella (el mal estado o ausencia de infraestructuras básicas para el transporte y las comunicaciones), que, por estar fuera del alcance de la iniciativa, no mencionamos más en este documento. Con respecto a las innovaciones identificadas, los participantes estuvieron de acuerdo con las mismas, y no proveyeron más detalles."}]},{"head":"Consideraciones adicionales para el componente III del estudio de alcance","index":15,"paragraphs":[{"index":1,"size":52,"text":"Aunque se quiso obtener retroalimentación sobre el componente II de la industria de procesamiento de alimentos, y las políticas y regulaciones (componente III), debido a que no hubo representantes del primer sector, solo se obtuvo retroalimentación para el componente III, y la información en esta sección solo se relaciona a dicho componente."},{"index":2,"size":47,"text":"Al igual que para el componente I, los participantes estuvieron de acuerdo con los resultados presentados. Sin embargo, al igual que para el componente I, hicieron sugerencias más detalladas sobre algunos de los temas presentados (primeros cuatro puntos) y sugirieron nuevos temas (últimos dos puntos), según detallamos:"},{"index":3,"size":49,"text":"• Es necesario que se evalúen las políticas de regulación de precios de granos básicos del país. En este sentido, no solamente se debe revisar la política que orienta el establecimiento del precio de garantía de compras del IHMA, sino que la política de precios de venta al consumidor."}]},{"head":"•","index":16,"paragraphs":[{"index":1,"size":35,"text":"Un tema adicional que sugirieron considerar es el buscar estrategias (o definir una política) para el fortalecimiento de las cadenas de valor operadas por empresas estatales, como el caso de las compras institucionales de grano."}]},{"head":"•","index":17,"paragraphs":[{"index":1,"size":31,"text":"Se debe estudiar la necesidad de una política de digitalización, dado que en el sector rural aún hay retos importantes por mejorar, no solo en la digitalización, sino en la conectividad."}]},{"head":"•","index":18,"paragraphs":[{"index":1,"size":31,"text":"Los participantes confirmaron la necesidad de estudiar el efecto a largo plazo del tratado de libre comercio (DR-CAFTA), incluyendo las implicaciones que puede llegar a tener más allá de lo comercial."}]},{"head":"•","index":19,"paragraphs":[{"index":1,"size":42,"text":"Los participantes consideraron que las políticas vinculadas al sector de granos básicos no tienen integrado aspectos relacionados al manejo y la conservación de recursos naturales, como el agua, suelo, y la biodiversidad. Esto es importante, dado el creciente enfoque hacia sistemas alimentarios."}]},{"head":"•","index":20,"paragraphs":[{"index":1,"size":44,"text":"Se debe fomentar una mejor coordinación interinstitucional, no solo entre instituciones del estado, sino con otros actores (BANADESA, SAG, IHMA, organizaciones de productores). Para esto, se necesita identificar mecanismos que faciliten esta coordinación, lo cual puede ser un tema de estudio para la iniciativa."}]},{"head":"Co-diseño y priorización de innovaciones","index":21,"paragraphs":[{"index":1,"size":209,"text":"Dado que la iniciativa tiene planeado implementar evaluaciones rigurosas de innovaciones con potencial de impacto en el país y la región, en el taller se organizó una sesión para realizar un trabajo conjunto de diseño de innovaciones, y de priorización de innovaciones que se podrían evaluar en un estudio piloto. Esto fue necesario para enfocar el trabajo de la iniciativa, y para hacer de este proceso algo participativo. Como se mencionó anteriormente, inicialmente se planeó realizar este ejercicio dividido en tres grupos, siguiendo el marco conceptual definido para el estudio de alcance. Para esto, se pidió a los participantes que alzaran la mano si tenían interés en participar en cada uno de los grupos. De este proceso se identificó que no hubo interés en el grupo sobre innovaciones para la industria agroalimentaria (principalmente porque no hubo representantes de dicho sector en el taller), por lo que se decidió dividir a los participantes en dos grupos, teniendo en mente mantener un balance en el número de participantes por grupo. Debido a esto, uno de los grupos de trabajo se enfocó en las innovaciones para el sector productivo, de comercialización y servicios (componente I), y el otro grupo de trabajo se enfocó en innovaciones en políticas y regulaciones (componente III). 4"},{"index":2,"size":79,"text":"Para estructurar el trabajo de los grupos, a los participantes se les pidió que respondan dos preguntas: (1) ¿entre los retos e innovaciones presentadas (del estudio de alcance), se ha malinterpretado alguno, o cuáles hicieron falta? Y (2) ¿qué innovaciones se deben priorizar para incluir en un estudio piloto de evaluación en 2023-2024? Dado que las respuestas a la primera pregunta ya se discutieron en la sección anterior, a continuación, nos enfocamos en las respuestas a la segunda pregunta."}]},{"head":"Innovaciones para el sector productivo, de comercialización y servicios de apoyo","index":22,"paragraphs":[{"index":1,"size":75,"text":"En este grupo participaron representantes de Zamorano, TechnoServe, la Cadena de Frijol, varias dependencias de la Secretaría de Agricultura y Ganadería (SAG), IHMA, PMA, FIPAH, Agrobolsa, ARSAGRO, y UNOPROL. Este grupo enfocó la identificación de innovaciones según los cuatro temas presentados en la sesión plenaria, como parte de los resultados del estudio de alcance. Además, identificaron posibles socios para la implementación del estudio de evaluación que se tiene planeado en el marco de la iniciativa."},{"index":2,"size":70,"text":"El trabajo de este grupo se enfocó específicamente en la identificación de innovaciones para: a) aumentar la productividad, b) tecnologías para la inclusión digital, c) servicios financieros especializados, y d) asistencia técnica. El orden de estos temas no necesariamente refleja su importancia, y para cada tema se priorizaron áreas en las que se podría innovar y enfocar la evaluación piloto, además de posibles estrategias y mecanismos de difusión (Figura 2)."}]},{"head":"Figura 2. Carteles del ejercicio de co-diseño del grupo 1","index":23,"paragraphs":[{"index":1,"size":108,"text":"Aumento de la productividad Sobre este tema, los participantes indicaron que, aunque lo que se quiere conseguir es que los rendimientos aumenten, esto se debe conseguir de manera simultánea a reducir costos de producción (e.g., mano de obra), para que las ganancias para los productores sean mayores. Esto seguramente se recomendó debido a los efectos macroeconómicos causados por la pandemia del COVID 19 y la guerra entre Rusia y Ucrania, que han conllevado a una subida generalizada de los costos de los insumos y productos, y al problema social de migración que enfrenta el país, donde es muy frecuente que los jóvenes migren por falta de oportunidades. 5"},{"index":2,"size":15,"text":"Entre las alternativas para aumentar la productividad se identificaron las siguientes (orden no refleja importancia):"},{"index":3,"size":46,"text":"• La promoción y uso de variedades resistentes a enfermedades y en general más adaptadas a factores abióticos y bióticos. Esta innovación además conlleva a la reducción de costos de producción, por el menor uso de pesticidas y a una menor demanda de mano de obra."}]},{"head":"•","index":24,"paragraphs":[{"index":1,"size":64,"text":"Fomentar y fortalecer la asociatividad. Esto conllevaría a muchos beneficios, y uno de ellos es la compra colectiva de insumos y equipos, lo que permitiría un mayor poder de negociación, para obtener insumos a menor costo. Aunque no se mencionó en el taller, otro beneficio sería el acceso a asistencia técnica y otros insumos (semilla, fertilizantes, crédito) que pueden ser provistos por las asociaciones."}]},{"head":"•","index":25,"paragraphs":[{"index":1,"size":27,"text":"Aumentar la disponibilidad de capital para inversiones en el sector. Esto contribuiría a mejorar las ventas, dado que inversiones a nivel productivo conllevarían a una mayor producción."}]},{"head":"•","index":26,"paragraphs":[{"index":1,"size":88,"text":"Mejorar las políticas, especialmente las relacionadas al establecimiento del precio base que define el gobierno, para las compras de granos. Esto se debe a que, en ocasiones, se pueden presentar diferencias importantes en cuanto a los costos reales de producción y las estimaciones empleadas para calcular el precio. Además, el precio base se actualiza con menos frecuencia que los cambios que enfrenta el sector, hecho que en ocasiones puede afectar mayormente a los productores porque en el mercado se toma como referencia dicho precio para pagar el grano."}]},{"head":"•","index":27,"paragraphs":[{"index":1,"size":145,"text":"Proveer incentivos para aumentar la inversión en el sector. Esto aumentaría la producción y rentabilidad de los cultivos. Además, se mencionó la necesidad de un análisis de riesgo para ayudar a mitigar efectos adversos que podrían enfrentar los actores, especialmente a nivel productivo. En este sentido, también se mencionó la producción bajo contrato como un mecanismo que contribuiría a mitigar el riesgo que enfrentan los productores. • Uso de equipo que demanda menos mano de obra. Un ejemplo mencionado fue una sembradora manual para frijol, con la que una persona puede llegar a sembrar hasta 90 libras en un día (comparado con la situación actual en que para sembrar 60 libras se necesitan 10 personas en un día). Sin embargo, los participantes reconocieron que estas tecnologías no se pueden generalizar, dado que, por ejemplo, la sembradora no se puede usar en terrenos inclinados (de ladera)."}]},{"head":"•","index":28,"paragraphs":[{"index":1,"size":75,"text":"Aumentar la diseminación de variedades mejoradas, ya que se liberan, pero no se adoptan a gran escala por falta de diseminación. En este sentido, mencionaron que la red de comités de investigación agrícola local (CIALEs) pueden tener un papel importante en contribuir a aumentar la difusión de materiales con adaptabilidad local, regional y nacional, y por ende la productividad del sector. Esto debido a que el mecanismo actual de difusión de tecnologías (variedades) es deficiente."}]},{"head":"•","index":29,"paragraphs":[{"index":1,"size":58,"text":"Fomentar un mecanismo nacional para aumentar la colaboración en el proceso de desarrollo y liberación de variedades, lo que también contribuiría a una mayor diseminación (porque las variedades se dan a conocer en diversas regiones). Esto debido a que, en la actualidad, los programas de mejoramiento llevan 3 años intentado liberar una variedad mejorada de frijol, sin éxito."},{"index":2,"size":80,"text":"De todas estas alternativas, los participantes sugirieron enfocar nuestro trabajo en las primeras dos áreas mencionadas arriba: promoción y uso de variedades mejoradas, y asociatividad. Específicamente sobre las variedades mejoradas, se sugirió que se deben identificar, de los materiales existentes, los que son más adaptados a las principales zonas productoras del país. Algunos de los actores que se pueden considerar para colaborar en la evaluación planeada están las asociaciones de productores, los CIALEs, y ONGs proveyendo asistencia técnica a productores."}]},{"head":"Tecnologías para la inclusión digital","index":30,"paragraphs":[{"index":1,"size":41,"text":"En este tema hubo menor discusión, pero los participantes concordaron en que se necesitan establecer mecanismos para compartir información, tanto para la oferta de granos como la demanda. Aunque el tipo de información necesita es diverso, los participantes mencionaron los siguientes:"},{"index":2,"size":16,"text":"• Información clima: específicamente, información agroclimática que permita tomar decisiones más informadas. • Información de mercados."}]},{"head":"•","index":31,"paragraphs":[{"index":1,"size":15,"text":"Información sobre precios, no solamente precios de insumos, sino también precio de los productos (grano)."}]},{"head":"•","index":32,"paragraphs":[{"index":1,"size":16,"text":"Información técnica que pueda ser usada por técnicos que proveen servicios de extensión a los productores."},{"index":2,"size":76,"text":"• Información sobre oferta de grano. Por ejemplo, aunque hay productores organizados y que producen volúmenes considerables de grano, los compradores no saben qué oferta (volumen) podrían conseguir. En este sentido, un portal electrónico donde se inscriban proveedores de grano, que permita una actualización regular de información (contacto, ubicación, volumen, variedad, etc.), y donde los compradores potenciales puedan obtener información sobre la oferta (pronosticada y real), podría ser un mecanismo útil para este intercambio de información."}]},{"head":"•","index":33,"paragraphs":[{"index":1,"size":39,"text":"Videos sobre prácticas de manejo de cultivos, para usar durante la asistencia técnica. Esto facilitaría el trabajo de los técnicos, dado que los productores con menor nivel educativo podrían entender más fácilmente ciertas prácticas de manejo que se promueven."},{"index":2,"size":46,"text":"De todas estas opciones, los participantes sugirieron enfocar nuestros esfuerzos en los primeros dos tipos de información. Además, específicamente para información agroclimática y de mercados, se identificó a los siguientes actores como posibles socios de interés para la iniciativa: Iniciativa AgriLAC, SIMPAH, Infoagro, y casas comerciales."},{"index":3,"size":118,"text":"Con respecto a las casas comerciales, algunos participantes mencionaron que algunas casas comerciales tienen grupos de WhatsApp donde comparten información, pero que su alcance es limitado, ya que esta información no llega a los productores. Sin embargo, no se ahondó en este tema, y no está claro si la información no llega a los productores porque ellos tienen dificultades de red en sus comunidades, o porque no saben de la existencia de estos grupos, o porque vendedores y técnicos son los principales miembros de estos grupos y usan la información para desarrollar sus actividades (e.g., un vendedor de insumos podría querer tener esta información para sí mismo, para poder obtener un mayor margen de ganancias en sus ventas)."}]},{"head":"Servicios financieros especializados","index":34,"paragraphs":[{"index":1,"size":14,"text":"Con respecto a innovaciones en este sector, los participantes mencionaron dos áreas de interés:"},{"index":2,"size":193,"text":"• Convenios tripartitos: este tipo de convenios no se han generalizado en el sector frijolero, pero sí en otros sectores como el de arroz. En el caso de arroz, el convenio involucra a productores, Banadesa (Banco Nacional de Desarrollo Agrícola) y compradores. Sin embargo, este tipo de convenios solo han sido usados para ventas a mercados formales. Otro ejemplo mencionado es el que involucra una casa comercial en un departamento del país, una ONG y productores. En este caso, la casa comercial provee crédito a los productores hasta por 120 días, y el acompañamiento técnico se da en conjunto entre técnicos de la casa comercial y una ONG (no se detalló en qué cultivo se está implementando este modelo). Un tercer modelo mencionado es el que se da entre el supermercado La Colonia, FUNDER (Fundación para el Desarrollo Empresarial Rural) y proveedores, aunque no proveyeron detalles sobre este mecanismo. Además mencionaron que incluso se podría explorar la posibilidad de convenios tetra partitos (con 4 actores), aunque lo importante es que independientemente del tipo de convenio, los mismos incluyan condiciones de compra claras y que beneficien a los productores, y crédito a tasas competitivas."}]},{"head":"•","index":35,"paragraphs":[{"index":1,"size":38,"text":"Fuentes de crédito para compra colectiva de insumos a una tasa competitiva. Esto es relevante dado el alto costo de los insumos, y la limitada oferta de insumos al momento en que se realizó el taller (diciembre 2022)."},{"index":2,"size":64,"text":"Los participantes mencionaron que, si se quisiera investigar en este sector, nos enfoquemos en los convenios tripartitos, especialmente para frijol. Entre los socios que podría colaborar en el estudio de evaluación están FUNDER, ONGs (TechnoServe), casas comerciales (AgroGaitán en el departamento de El Paraíso), supermercado La Colonia, y Banadesa. Sin embargo, qué actor involucrar depende del tipo de convenio que se identifique para estudiar."}]},{"head":"Asistencia técnica","index":36,"paragraphs":[{"index":1,"size":77,"text":"En esta área los participantes mencionaron que se necesita transmitir información y proveer asistencia técnica, tanto a nivel productivo como a nivel de asociaciones de productores. Los retos que el sector enfrenta en esta área se deben a que muchas veces los productores no llegan a los entrenamientos a los que se los invita, por lo que se necesita identificar incentivos para aumentar su participación. Debido a esto, la asistencia técnica que reciben los productores es limitada."},{"index":2,"size":102,"text":"Otro aspecto para considerar es la importancia de la continuidad en la asistencia técnica. Esto porque en la actualidad, no hay un servicio nacional de asistencia técnica en el país, y las organizaciones de desarrollo no gubernamentales están cubriendo esta demanda con proyectos, los cuales una vez finalizados, dejan de proveer este servicio. Para esto, se requiere un ente coordinador que pueda cumplir esta función, y con el cual se compartiría información sobre el trabajo que se está haciendo en el país. También, se requiere mayor coordinación entre organizaciones existentes, para no duplicar esfuerzos y poder alcanzar un mayor número de beneficiarios."},{"index":3,"size":71,"text":"Dado que el generar información sobre los cultivos de manera contínua requiere recursos, algunos participantes mencionaron que se podría seguir el modelo de café, donde a los productores se les hace una retención para financiar investigación para generar información útil de manera regular. Sin embargo, una decisión en este aspecto necesita un análisis más profundo sobre los beneficios y costos, y la distribución de éstos entre los distintos actores del sector."},{"index":4,"size":131,"text":"Finalmente, los participantes mencionaron que es necesario priorizar la asistencia técnica por zonas, aunque reconocieron que esto no es fácil, dado que se podría decidir enfocar la asistencia técnica a regiones donde la producción es mayor (e.g., departamentos de Olancho, Yoro y El Paraíso), o a regiones donde más se necesita (por haber más retos), que no necesariamente coincide con las zonas donde más se produce. Aunque no se identificaron actores específicos para considerar para el estudio de evaluación, se mencionó que se debe hacer un inventario de organizaciones que proveen este servicio (ONGs, Asociaciones, etc.) para decidir a quiénes involucrar. Debido a la falta de tiempo, no se pudo ahondar en este tema, dado que mucha de la discusión se enfocó en identificar innovaciones para el aumento de la productividad."}]},{"head":"Innovaciones político-institucionales","index":37,"paragraphs":[{"index":1,"size":142,"text":"En este grupo participaron representantes de varias dependencias de la SAG, IHMA, Zamorano, PMA, IICA, ComRural, un consultor, y PRR. En contraste con el grupo 1, este grupo no usó rotafolios para enfocar su discusión, sino que la información provista se fue incorporando directamente en una presentación, la cual se usó en la sesión plenaria final de retroalimentación. Además, dado que no hubo representantes del sector de procesamiento de alimentos, la discusión de este grupo se enfocó solo en el componente de políticas y regulaciones. Aunque se siguió la misma metodología, y se respondió a las mismas preguntas que en el grupo 1, debido a la naturaleza del tema, la discusión se enfocó mayormente en qué estudios priorizar, y no se definió qué actores se deben involucrar en dichos estudios, o cómo se pueden pilotear estos temas en un estudio de evaluación."},{"index":2,"size":26,"text":"Los participantes sugirieron priorizar los esfuerzos de la iniciativa para los próximos dos años en la implementación de los siguientes estudios (temas), en orden de importancia:"},{"index":3,"size":89,"text":"• Efectos del tratado de libre comercio y de los programas nacionales existentes (bono tecnológico, precio de garantía del IHMA, programas de agricultura familiar): Los participantes mencionan la importancia de estudiar qué tan efectivos son los programas que desde hace varios años se han implementado para impulsar al sector de granos básicos. Ellos indicaron que es importante analizarlos porque se necesita saber si realmente son efectivos o si es necesario implementar mejoras y actualizarlos a la realidad actual, de tal forma que generen cambios graduales positivos en el sector."}]},{"head":"•","index":38,"paragraphs":[{"index":1,"size":67,"text":"Análisis de políticas de tratados comerciales: El tratado de libre comercio fue uno de los temas que más se discutió durante el taller. Desde el punto de vista de los participantes, es un tratado en el que el gobierno ya debería estar buscando la forma de evaluarlo y actualizarlo, de tal forma que sea más inclusivo y beneficie más claramente al sector de granos básicos del país."}]},{"head":"•","index":39,"paragraphs":[{"index":1,"size":18,"text":"Política de donación de bienes del estado. Aunque relevante, esta sugerencia está fuera del alcance de la iniciativa."}]},{"head":"•","index":40,"paragraphs":[{"index":1,"size":8,"text":"Política de monitoreo y ajuste de precios (productor-IHMA-consumidor)."}]},{"head":"•","index":41,"paragraphs":[{"index":1,"size":14,"text":"Políticas de uso de semillas, para incrementar el uso de semillas por los productores."}]},{"head":"•","index":42,"paragraphs":[{"index":1,"size":6,"text":"Estudio de políticas de las cooperativas."},{"index":2,"size":70,"text":"Debido a la complejidad del marco político y regulatorio, en la siguiente fase nuestra investigación se explorará la relevancia del entorno institucional para el crecimiento y desarrollo de las cadenas de valor del frijol y el maíz en Honduras. Se elaborará un marco conceptual que presente conceptos clave sobre qué es el entorno institucional y cómo moldea los caminos para el desarrollo de la cadena de valor. El estudio considerará:"},{"index":3,"size":37,"text":"• Tratados (por ejemplo, DR-CAFTA), leyes, políticas, normas y regulaciones en apoyo de las cadenas de valor de granos básicos y en respuesta a emergencias (desastres naturales, crisis mundial de precios de los alimentos, pandemia de Covid-19)."}]},{"head":"•","index":43,"paragraphs":[{"index":1,"size":8,"text":"Inversiones públicas e incentivos para agricultores y PyMEs."}]},{"head":"•","index":44,"paragraphs":[{"index":1,"size":17,"text":"Instituciones, infraestructura y servicios públicos, incluido el apoyo a los insumos, la asistencia técnica y la capacitación."}]},{"head":"•","index":45,"paragraphs":[{"index":1,"size":14,"text":"Modelos de negocio que involucran a entidades públicas (por ejemplo, reservas nacionales de alimentos)."}]},{"head":"•","index":46,"paragraphs":[{"index":1,"size":14,"text":"Normas para la producción y el procesamiento, incluidas medidas fitosanitarias y de seguridad alimentaria."},{"index":2,"size":31,"text":"La investigación será de naturaleza cualitativa y se basará en entrevistas a informantes clave, debates en grupos focales y revisión de literatura científica y gris, y estadísticas de producción y comercio."}]},{"head":"Conclusiones","index":47,"paragraphs":[{"index":1,"size":91,"text":"Durante el taller se presentaron los resultados del estudio de alcance realizado en 2022 en Honduras, para lo cual se siguió un marco conceptual definido específicamente para este estudio, y que se enfocó en tres componentes: sector productivo, de comercialización y servicios de apoyo (componente I); sector de la industria del procesamiento de alimentos (componente II); y sector de políticas y regulaciones (componente III). Debido a que no hubo representantes relacionados al componente II, la validación de resultados y priorización y co-diseño de innovaciones no se pudo realizar para este componente."},{"index":2,"size":101,"text":"En general, los resultados preliminares encontrados en el estudio de alcance fueron validados por los participantes del taller. Sin embargo, recibimos sugerencias de dos maneras: primero, los participantes ahondaron con detalles algunos de los temas (cuellos de botella e innovaciones) presentados, para enriquecer la discusión y agregar consideraciones que debemos tener en mente para la implementación del estudio de evaluación que se tienen planeado. Segundo, se sugirieron nuevos temas para consideración para estudios, los cuales no salieron a relucir en el estudio de alcance. A pesar de esto, algunos de los temas nuevos sugeridos estaban fuera del alcance de la iniciativa."},{"index":3,"size":147,"text":"Los participantes en el taller contribuyeron a priorizar algunos temas de investigación para los componentes I y III. Específicamente, para el componente I, sugirieron enfocar el trabajo de la iniciativa en cuatro áreas, y en cada área resaltaron uno o dos temas prioritarios. En el área relacionada al incremento de la productividad, resaltaron la importancia de trabajar en la promoción y uso de variedades mejoradas, y en asociatividad. En el área de tecnologías para la inclusión digital sugirieron que es importante identificar herramientas y mecanismos para transmitir información climática e información de mercados. En el área de servicios financieros especializados sugirieron trabajar en la identificación y validación de convenios tripartitos, con enfoque en frijol. Finalmente, en el área de asistencia técnica sugirieron que hay muchas necesidades, pero que es recomendable priorizar la asistencia en determinadas geografías, y para cada una, determinar qué tipo de asistencia se necesita."},{"index":4,"size":70,"text":"Para el componente III, sugirieron seis temáticas para estudios (una de ellas fuera del alcance de la iniciativa). Aunque no se priorizaron innovaciones para el componente II (por no haber representantes de dicho sector en el taller), en general se comentó que en la medida en que la iniciativa desarrolle algunas temáticas de investigación relacionadas a innovaciones agroindustriales, se deberá realizar el ejercicio con actores clave relacionados a dicha área."},{"index":5,"size":113,"text":"Aunque para los componentes I y III se identificaron actores para considerar para el estudio de evaluación, la conclusión final es que la identificación de actores debe hacerse una vez se hayan definido más claramente las innovaciones a evaluar, y la zona geográfica, dado que hay actores que tienen un alcance nacional, otros con alcance regional, y otros con alcance local, cada uno con distintos recursos y objetivos, por lo que el involucramiento de actores específicos dependerá del alcance del estudio de evaluación. La iniciativa se comprometió a compartir la información presentada en el taller, y a organizar talleres futuros para presentar avances sobre el trabajo que se estará realizando en el país. "}]},{"head":"Anexos","index":48,"paragraphs":[]}],"figures":[{"text":" Contenido Antecedentes ............................................................................................................... 2 Objetivos e implementación del taller ...................................................................... 2 Resumen de los resultados del estudio de alcance ................................................. 4 Validación y retroalimentación de los resultados preliminares del estudio de alcance y las áreas de innovación propuestas ........................................................ 10 Co-diseño y priorización de innovaciones .............................................................. 11 Conclusiones ............................................................................................................. 15 Anexos ........................................................................................................................ 17 "},{"text":"  "},{"text":"  "},{"text":"Tipo de documento Cadena de valor Políticas Bioforti- ficados Semillas Industria Agricultura por contrato Pérdidas Otros temas Total Reporte  Tabla 2. Marco de muestreo, muestra y entrevistas realizadas a actores clave (componente I) en Honduras   Tabla 2. Marco de muestreo, muestra y entrevistas realizadas a actores clave (componente I) en Honduras Tabla 1. Tipos de referencias bibliográficas revisadas en preparación al estudio de alcance sobre las cadenas de valor de frijol y Tabla 1. Tipos de referencias bibliográficas revisadas en preparación al estudio de alcance sobre las cadenas de valor de frijol y maíz en Honduras          maíz en Honduras  5 4 1 1 1 1  25 38 5411112538 Artículo 4 2 3 1 1 1 3 6 21 Artículo4231113621 científico          científico Libro 1 2  1    9 13 Libro121913 Página web   2 2  1  1 6 Página web22116 Tesis   2  3    5 Tesis235 Blog        2 2 Blog22 Presentación        4 4 Presentación44 Total 10 8 8 5 5 3 3 47 89 Total108855334789 Fuente: Autores          Fuente: Autores Figura 1. Marco conceptual definido para el estudio de alcance de Honduras     Figura 1. Marco conceptual definido para el estudio de alcance de Honduras Fuente: Elaborado por los autores         Fuente: Elaborado por los autores  "},{"text":"Tipo de actor Marco de muestra (#) Muestra identificada (#) Actores entrevistados (#) Personas entrevistadas (#) Asociaciones de productores   132 9 9 17 1329917 Compradores Institucionales 3 3 3 7 Compradores Institucionales3337 Instituciones Financieras 6 7 5 8 Instituciones Financieras6758 Investigación 8 4 4 5 Investigación8445 Intermediarios y Mayoristas 0 10 6 6 Intermediarios y Mayoristas01066 Gobierno* 14 0 0 0 Gobierno*14000 Agencias de desarrollo 9 6 6 6 Agencias de desarrollo9666 Total 172 39 33 49** Total172393349** * Actores gubernamentales entrevistados según su rol (por ejemplo, comprador institucional, investigación). * Actores gubernamentales entrevistados según su rol (por ejemplo, comprador institucional, investigación). ** # personas entrevistadas es más alto que los # actores entrevistados porque más de una persona participó en ** # personas entrevistadas es más alto que los # actores entrevistados porque más de una persona participó en algunas entrevistas     algunas entrevistas Fuente: Autores     Fuente: Autores Tabla 3. Entrevistas realizadas a actores clave (componente III) en Honduras   Tabla 3. Entrevistas realizadas a actores clave (componente III) en Honduras  "},{"text":"Tipo de actor Actores entrevistados (#) Asociaciones de productores 4 Investigación 2   "},{"text":"Iniciativa Transformando los Mercados y Cadenas de Valor para la inclusión y la Sostenibilidad WP2-Innovación para el crecimiento inclusivo y sostenible de las cadenas de valor nacionales Agenda para Taller con Actores Clave de los Sectores Maíz y Frijol Hotel Clarión, Col. Alameda, calle principal, Avenida Juan Manuel Galvez, Tegucigalpa, Honduras 13 de diciembre de 2022 Anexo 3. Agenda del taller   Anexo 3. Agenda del taller Anexo 1. Invitación al taller   Anexo 1. Invitación al taller Objetivos:    Objetivos: 1. Presentar los resultados preliminares del estudio de alcance  1. Presentar los resultados preliminares del estudio de alcance 2. Validar los resultados preliminares del estudio de alcance  2. Validar los resultados preliminares del estudio de alcance 3. Identificar prioridades de investigación para 2023  3. Identificar prioridades de investigación para 2023   Programa  Programa Hora Temas Dinámica Responsables HoraTemasDinámicaResponsables 8:30 -9:00  Registro de participantes  8:30 -9:00Registro de participantes 9:00-9:15 Bienvenida e Se revisará la agenda, presentarán Byron Reyes 9:00-9:15Bienvenida eSe revisará la agenda, presentaránByron Reyes  introducción al taller detalles sobre la iniciativa y objetivo  introducción al tallerdetalles sobre la iniciativa y objetivo   del taller  del taller 9:15 -10:00 Presentación de los Retos e Innovaciones en el sector Mirian Colindres & 9:15 -10:00Presentación de losRetos e Innovaciones en el sectorMirian Colindres &  resultados productivo, comercialización y Carlos Rodríguez- resultadosproductivo, comercialización yCarlos Rodríguez-  preliminares del servicios de apoyo CIAT preliminares delservicios de apoyoCIAT  estudio de alcance y Resultados preliminares del sector Meliza Peña- estudio de alcance yResultados preliminares del sectorMeliza Peña-  planes para 2023 agroindustrial CIMMYT planes para 2023agroindustrialCIMMYT   Retos e Innovaciones político- Dietmar Stoian- Retos e Innovaciones político-Dietmar Stoian-   institucionales ICRAF institucionalesICRAF 10:00 -10:30 Validación de los Debate en plenaria, con Todos, moderador 10:00 -10:30 Validación de losDebate en plenaria, conTodos, moderador  resultados retroalimentación de los B. Reyes resultadosretroalimentación de losB. Reyes  preliminares participantes  preliminaresparticipantes 10:30 -10:45  Refrigerio  10:30 -10:45Refrigerio 10:45 -11:45 Trabajo en grupo Grupo 1: Innovaciones en el sector Modera: Mirian y 10:45 -11:45 Trabajo en grupoGrupo 1: Innovaciones en el sectorModera: Mirian y  Identificación de productivo, comercialización y Carlos Identificación deproductivo, comercialización yCarlos  prioridades de servicios de apoyo  prioridades deservicios de apoyo  investigación Grupo 2: Innovaciones Modera: Meliza investigaciónGrupo 2: InnovacionesModera: Meliza   agroindustriales  agroindustriales   Grupo 3: Innovaciones político- Modera: Dietmar Grupo 3: Innovaciones político-Modera: Dietmar   institucionales  institucionales 11:45-12:30 Plenaria 5 minutos de presentación + 10 Relatadores 11:45-12:30 Plenaria5 minutos de presentación + 10Relatadores  Presentación de los minutos de clarificación/preguntas, designados Presentación de losminutos de clarificación/preguntas,designados  resultados del trabajo por grupo  resultados del trabajopor grupo  en grupo y siguientes   en grupo y siguientes  pasos   pasos 12:30 -12:40 Agradecimientos y  Byron, Meliza y/o 12:30 -12:40 Agradecimientos yByron, Meliza y/o  cierre  Dietmar cierreDietmar 12:40 -13:30  Invitación a almuerzo  12:40 -13:30Invitación a almuerzo  "},{"text":"Byron Reyes, Scientist, b [email protected] CGIAR is a global research partnership for a food-secure future. CGIAR science is dedicated to transforming food, land, and water systems in a climate crisis. Its research is carried out by 13 CGIAR Centers/Alliances in close collaboration with hundreds of partners, including national and regional research institutes, civil society organizations, academia, development organizations and the private sector. www.cgiar.orgWe would like to thank all funders who support this research through their contributions to the CGIAR Trust Fund: www.cgiar.org/funders.To learn more about this Initiative, please visit this webpage.To learn more about this and other Initiatives in the CGIAR Research Portfolio, please visit www.cgiar.org/cgiar-portfolio © 2023 CIAT. Some rights reserved. This work is licensed under a Creative Commons Attribution-Noncommercial 4.0 International License (CC BYNC 4.0). International License (CC BYNC 4.0). | | | | ||  "}],"sieverID":"b71c775d-eead-4fb4-8e71-30e61c7b0c85","abstract":""}

data/part_2/07595db04a552287e3b50c7fc2c5304a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07595db04a552287e3b50c7fc2c5304a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5a22dfed-2c99-427c-b25c-a9b358784e34/retrieve"},"pageCount":28,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]},{"head":"Introduction","index":2,"paragraphs":[{"index":1,"size":89,"text":"The success of any program breeding for resistance to diseases and/o r insects depends large ly on the development of suitable and reliable scree ning techn iques. Such techniques also have to be simple and relatively inexpensive. Field screening under natural infestations is often unsuccessful because the incidence of pests is erratic. To overcome this problem and to minimize the chance of 'escapes' in screening, it is necessary to infest a large number of plants artificially every season. For that purpose , rearing of the target insect is necessary."},{"index":2,"size":41,"text":"Mass rearing of Cicadulina leafhoppers was begun at the International Institute ofTropical Agriculture (IITA) , Ibadan, Nigeria, in 1976. Over the yea rs, a number of modifications and improvements have been made (Leuschner et al.l 980;Soto et al. 1982;Alam 1983;Dabrowski 1983)."},{"index":3,"size":42,"text":"This handbook prese nts the techniques developed and experiences accumu lated at liT A over the past 15 yea rs for mass re aring and infestation of Cicadulina leafhoppe rs in screen ing for resistance to maize streak vi ru s (MSV)."}]},{"head":"Maize streak virus","index":3,"paragraphs":[{"index":1,"size":160,"text":"Maize streak virus (MSV) is one of the most economically damaging diseases of maize in sub-Saharan Africa. It is found on ly in Africa and surrounding islands, whe re it is widely distri buted and transmitted by leafhoppers in the genus Cicadulina. MSV is found in both forest and savanna zones and in varying altitudes (0-2000 m). Damage to maize from MSV can be insignificant in some years but epid emics of the disease in other years can devastate crops with yield losses of 100% (Fajemisin and Shoyinka 1976). The severity of the disease is usually re lated to the age of the plant at the time of infection , as well as to the relative suscepti bi lity of the varie ty. The you ng er the plant, the greater the severity of symptoms. At IITA, yield losses under artificially induced infestation of four varieti es with differing levels of resistance/susceptibility were found to range from 10 to 72%."},{"index":2,"size":89,"text":"Symptoms of MSV consist of broken to almost continuous , narrow, white ch lorotic stripes which develop ove r and along the vein on most of the leaf surface (Fig . 1). The density of striping depends on varietal susceptibility. Maize plants are vuln erable to MSV from emerge nce to tasseling . a Figure 1 Maize plant with streak virus symptoms 2 Susceptible plants infected at the seedling stage become stunted and may die or produce small and poorly filled ears (Fajemisin et al. 1976;Rossel and Thottappilly 1985)."}]},{"head":"Biology of Cicadulina leafhoppers","index":4,"paragraphs":[{"index":1,"size":31,"text":"Twenty-two species of Cicadulina leafh oppers have been reported ; 18 of th ese occur in Africa (Webb 1987). Only eight species are known to be vectors of MSV (Table 1)."}]},{"head":"Morphology","index":5,"paragraphs":[{"index":1,"size":213,"text":"The Cicadulina leafhoppers vary in length from 2.2 mm to 3.8 mm (Rose 1978). Coloration of the insects varie s but is generally pale to golden yellow. Some species have black markings on the forewings, pronotum, and venter. The dorsal side of the abdomen is usually brown. Most species have a pair of round, brown spots on the frontal margin of the forehead (Ruppel 1965). The fema le Cicadulina is distinguished from the male by its long ovipositor.  Dabrowski 1987Okoth & Dabrowski 1987Dabrowski 1987a Th e identification of Cicadulina species is somewhat difficult. Species differ marked ly in mal e genital characters. The shape and size of the aedeagus and th e shape of th e pygophore processes are use ful characte rs for differentiating between species of Cicadulina (Ruppel 1965;van Rensburg 1983;Webb 1987). Figure 2 illustrates genital characters fo r two of the most common species of Cicadulina in Afri ca: C. mbila and C. storeyi (= C. triangula). Webb (1987) mentioned that care should be taken in distinguishing Arrican species of Cicadulina from a leafh oppe r of th e ge nus Afrosteles. Extern ally, both genera are similar. However, Afrosteles distans is slightly larger than Cicadulina and it lacks the dark apex of the ovipositor which is present in Cicaduliha.  "}]},{"head":"Distribution","index":6,"paragraphs":[{"index":1,"size":71,"text":"The distribution pattern s of Cicadulina leafh oppers also vary conside rabl y across Africa.C. mbila and C. storeyi (Fi g. 3) are wide ly distribu ted in Africa. C. mbila is th e most important vector species (Nielson 1968;Okoth and Dabrowski 1987). Both C. mbila and C. storeyi are presently bein g used fo r mass rea ring purposes in various African co untries. b \\ . \"., . .,"}]},{"head":"Life history","index":7,"paragraphs":[{"index":1,"size":50,"text":"Knowledge of an insect's life history is important for a successful mass rearing program . Cicadulina species differ in Iheir life history and ability to transmit MSV. The life histories of C. mbila and C. storeyi have been studied extensively (Table 2). Their developmental periods (egg to adult) (Fig. 4)    "}]},{"head":"Collecting the leafhoppers Time","index":8,"paragraphs":[{"index":1,"size":46,"text":"To start a new colony of Cicadulina leafhoppers, collect the live leafhoppers from the field. The optimal time for collection of Cicadulina leafhoppers is at the end of the rainy season, when leafhopper population density is high and they migrate from old plants to young ones."}]},{"head":"Sites","index":9,"paragraphs":[{"index":1,"size":50,"text":"Grass species of the genera Pennisetum, Digitaria, Eleusine, Brachiaria, Paspalum, Setaria, and Panicum are preferred by Cicadulina; so you should sample them for col lection (Rose 1978;Okoth and Dabrowski 1987) . In addition, you could sample irrigated wheat and grasses growing near rivers , lakes , or in valley bottoms."}]},{"head":"Methods","index":10,"paragraphs":[{"index":1,"size":63,"text":"There are various ways by which you can collect Cicadulina leafhoppers from the field, but most suitable is a method that uses a cubical frame made of iron or steel rods, covered by a dark green or black cotton cloth-with transparent netting or fine mosquito net on one side (Fig. 5) (Dabrowski 1983). The iron frame and the cloth are handy and portable."},{"index":2,"size":67,"text":"To construct a frame, you require four 140-150 cm pieces of iron or steel rod 10. -15 mm in diameter. Sharpen the lower ends of the rods so that they can be easily pushed into the soil. Bend the top end of the rod into a short 20-25 cm arm to give corner support. At the sampling site, follow the following steps for collection of Cicadulina leafhoppers."},{"index":3,"size":33,"text":"1. Place the iron rods at the four corners of the sampling site in such a way that they will form a cage size 1.25 x 1.25 m. Do not disturb the site."}]},{"head":"2.","index":11,"paragraphs":[{"index":1,"size":24,"text":"Once the rods are fixed , place the dark cloth quickly over them so that the Cicadufina leafhoppers within the cage cannot escape ."},{"index":2,"size":39,"text":"3. Enter the cage and disturb the grasses, so that insects within the cage will be attracted to the light on the side with transparent netting (Fig. 6). From there, selectively collect the Cicadulina leafhoppers, using a mouth aspirator."},{"index":3,"size":32,"text":"4. Cage the fema le leafhoppers singly with young millet or maize seed lings, using polyvinyl chloride (PVC) tubes (about 8 cm in diameter and 25 to 30 cm long) (Fig. 7)."},{"index":4,"size":161,"text":"Alternati ve ly release the Cicadulina leafhoppers co llected into a cage (approx. 40 x 40 x 60 cm) (Fig. 8) with young, potted, insect-free millet or maize plants and transport back to the laboratory or screenhouse.  3. When the nymphs become adults, collect samples of males separately from each cage for species identification , and keep the samples in 75% alcohol (ethanol). Before identification, place the specimens in 10% potassium hydroxide (KOH) solution for 24 hours. Take out a specimen and place it under a dissecting microscope. Dissect the last abdominal segment to look for the male genitalia-the pygophore processes and aedeagus. See Figure 2 for an illustration of the genitalia of two common Cicadulina species. Follow Webb's (1987) key for identification of other species. 10 4. Once species identification is completed, put together adults belonging to the same species and release them into larger cages to build up the population (Fig. 9). Use only one species for mas& rearing."},{"index":5,"size":55,"text":"Select Cicadulina species with a high reproductive potential and high transmission ability of MSV for mass rearing and resistance screening. As explained, this would mean you use either C. mbila or C. storeyi for rearing. An added advantage is that ample information and experience exist on mass rearing these two species in various African countries."},{"index":6,"size":23,"text":"The standard procedure for mass rearing of Cicadulina leafhoppers at IITA is illustrated in Figure 10. The various steps involved are described next."}]},{"head":"Oviposition","index":12,"paragraphs":[{"index":1,"size":55,"text":"The best host for egg laying by Cicadulina females is pearl millet, Pennisetum americanum (= typhoides). Up to 220 eggs per female have been obtained at IITA on this host (Dabrowski 1987b). Millet has the additional advantage over maize of tolerating large leafhopper populations without suffering severe damage. Use potted 14-day old plants for oviposition."},{"index":2,"size":22,"text":"For egg laying, keep adults on open oviposition tables (0.75 m high) (Fig. 11) or in metal framed cages (1.25 x 1.25"},{"index":3,"size":11,"text":"Figure 11 Open table for egg-laying by leafhoppers on millet plants"}]},{"head":"Figure 12","index":13,"paragraphs":[{"index":1,"size":3,"text":"Nymphal rearing cage"}]},{"head":"Figure 13","index":14,"paragraphs":[{"index":1,"size":13,"text":"The cage is covered with dark cloth prior to collection of leafhoppers 12"},{"index":2,"size":11,"text":"x 1.50 m) covered with fine insect proof mesh (Fig. 12)."},{"index":3,"size":113,"text":"Sew the mesh to form a cage that will fit over the metal frame; a zipper on one side of the mesh cage allows easy access to the plants and insects inside. Place cages over tables about 0.75 m high. Our experience at IITA is that adu lts kept on open tables do not escape from the screen house. This could be partly a result of adaptation to rearing conditions (i.e. , se lection for short-distance flyers), likely to occur in any large colony. We thus recommend using a combination of both methods (open tables and close cages) for oviposition until you obtain a large enough colony of leafhoppers adapted to open tables."},{"index":4,"size":138,"text":"After a one-week oviposition period , transfer the potted plants to nymphal rearing cages (1.25 x 1.25 x 1.50 m) for egg hatching and nymphal development (Fig. 12). Add fresh plants to the tables, so that females can continue layi ng eggs. Coll ect the adu lts and release them onto oviposition tables at least every 3-4 weeks. The duration of the oviposition period might vary , according to species and environmental conditions. Th erefore , carry out experiments to determine the most appropriate length of time for any given location. This period , however, shou ld not be very long , so as to avoid a corresponding ly long nymphal emergence period that will resu lt in a mixture of nymphs of different ages. Plant millet weekly to ensure avai labi lity of host plants for rearing."}]},{"head":"Nymphal rearing","index":15,"paragraphs":[{"index":1,"size":62,"text":"Once eggs hatch, nymphs wi ll start to feed on the millet plants. Add fresh plants to the cages regularly to ensure an adequate supp ly of food. Cut the older plants, on which nymphs have been feeding, with a sharp knife, and shake gently to dislodge the nymphs onto the fresh plants. Nymphs will take about 3 weeks to become adults."},{"index":2,"size":45,"text":"A nymphal rearing cage can hold 20-24 pots. However, it is advisable to reduce this number to 16 during the rainy season when high relative humidity prevai ls. This will ensure air flow and will help reduce problems of fungal growth on the millet plants."}]},{"head":"Collecting adults","index":16,"paragraphs":[{"index":1,"size":201,"text":"Em ergence of all the adults in a nymphal rearing cage shou ld ideally occur within one week. COllect the ad ults by covering the cage with a dark cotton cloth , leavin g a small portion of the cage uncovered (Fig. 13). Th e leafhoppers will respond to the light and move to the portion of the cage left uncovered. A person can then move into the cage and use a mouth aspirator or a modified vacuum cleaner (200-500 W) for collection . The rubber tube of th e vacuum cleaner is attached to a thick rubbe r tube (15 cm long x 6 cm diam) and the latter connected to a small plastic co ll ecting vial (9 cm long x 5 cm diam) (Fig. 14). The collecti ng vial shou ld have one end cove red by fine mesh ; the other end shou ld be a narrow tube that will be used to collect the insects (see inset in Fig. 14). After you have collected th em , transfer leafhoppers to vi ru s acquisition feeding cages or to oviposition tables , according to your rearing needs at th at time . Using Cicadulina in resistance screening"}]},{"head":"Obtaining virus-carrying leafhoppers","index":17,"paragraphs":[{"index":1,"size":87,"text":"Use young potted MSV-infected maize plants of a streaksusceptible variety for virus acquisition feeding. Plant maize on a regular basis and infect it with MSV, 7-10 days before it is needed. Keep the plants in a cage the same size as the nymphal rearing cages. A period of 48 h is optimal for virus acquisition. After this period , col lect the viruliferous leafhoppers again, using the vacuum cleaner, and transfer to leafhopper dispensing vials (9 cm long x 5 cm diam) for transport to the field."}]},{"head":"Infesting the field","index":18,"paragraphs":[{"index":1,"size":24,"text":"The leafhopper dispensing vial is made of PVC , covered with fine mesh at one end and with a plastic lid at the other."},{"index":2,"size":60,"text":"The plastic lid of the dispensing vial is removable, to allow transfer of leafhoppers from the collecting \\i.ial into it. The lid has a small orifice (3 mm diam) to allow the leafhoppers to pass when they are dispensed. This orifice is covered with a small plug of cotton wool or grass, to prevent the leafhoppers from escaping during transport."},{"index":3,"size":73,"text":"If the field is far from your rearing facilities, collect the viruliferous leafhoppers from the virus acquisition cage and place them in a smaller cage (approx. 40 x 40 x 60 cm) with a few healthy potted maize or millet plants, so that they can be easily transported to the field. Prior to infesting the field, collect the leafhoppers from the cage with a mouth aspirator and transfer them to leafhopper dispensing vials."},{"index":4,"size":104,"text":"Alternatively, after collecting the leafhoppers from the virus acquisition cage, transfer them to the dispensing vials and transport these to the field in a cooler. At low temperatures (10 to 12°C) the leafhoppers wi ll sUNive for several hours. While humidity should be high to prevent dessication, water condensing in the vial will kill the insects. Therefore, cover the inner wall of the vial with absorbent paper (i .e., paper towel or filter paper) to collect the excess moisture resulting from condensation. If the field is close to your rearing facilities, you can take the leafhoppers directly to the field in the dispensing vials."},{"index":5,"size":94,"text":"To ease infestation, anesthetize leafhoppers with carbon dioxide (C0 2 ) immediately before you dispense them. Carry the CO 2 to the fie ld in a rubber inner tube , to which a thin rubber hose with a valve is attached (Fig. 15) (Leuschner et al. 1980). The CO 2 immob ilizes the leaihoppers, preVenting their escape. Next, dispense the insects into the leaf whorl at a rate of 3-4 leafhoppers per plant (Fig. 16). The leafhoppers wi ll become active shortly after release , and they wi ll start feeding on the plant."},{"index":6,"size":78,"text":"If necessary, use CO 2 a second time to inactivate the wakening leafhoppers in the vial. Excessive use of CO 2 , however, wi ll kill some insects and result in nonuniform MSV infestati ons. C02 can be bought from commercial establi shments, such as soft drink bottling companies , or it can be obtained from fire extinguishe rs. Ca rry out field infestations when plants are at the three-leaf stage (approx. 8-10 days after planting) (Fig. 16)."},{"index":7,"size":31,"text":"Figure 15 Anesthetizing leafhoppers with carbon dioxi de (C0 2 ) in the field before infestation of maize seedlings. Notice the inner tube used to carry CO 2 to the field"}]},{"head":"Figure 16","index":19,"paragraphs":[{"index":1,"size":22,"text":"Anesthetized leafhoppers are shaken out of the vial onto a maize seedling (3-4 per plant) showing MSV symptoms three weeks after infestation"}]},{"head":"Rating for MSV","index":20,"paragraphs":[{"index":1,"size":58,"text":"Viral symptoms will appear in 5-1 0 days and th ey will be cl early visible 2-3 weeks afte r infestati on (Fig. 17). The following visual rating scale of 0 to 5 (Tabl e 3) has been developed based on Soto et al. (1982) fo r evaluating resistance to maize stre ak virus (Fig . 18) ."}]},{"head":"Selecting for MSV resistance","index":21,"paragraphs":[{"index":1,"size":46,"text":"Selecti on for MSV resistance is done by first thinning out susceptible plants 3-4 weeks after planting. At fl owe rin g, se lect plants com bining adequate levels of resistance (1-3 on th e ratin g scale) with other desirable characters (Efron et al. 1989)."},{"index":2,"size":27,"text":"Figure 18 Reaction to MSV (left to right). Susceptible ( 5), moderately resistant (3), and resistant (1). Ratings are based on the visual rating scale (Table 3)"}]},{"head":"Problems related with mass rearing","index":22,"paragraphs":[{"index":1,"size":118,"text":"The host plants used for rearing shou ld be free from other insects , hence they should be grown inside a screen house to avoid pest infestation. Insects which might be problematic include whiteflies, aphids, leaf beetles, planthoppers, and lepidopterous la rvae . Manual removal of insects is often effective. If an infestation develops, it might be necessary to discard the plant batch or to spray a shortterm action insecticide , such as malathion. Spraying should be done outside the screenhouse, and the plants left for 1-2 weeks prior to their use for Cicadulina rearing. Large populations of aphids on millet seed lings have been effectively controlled in the past, using a coccinellid beetle, Chilomenes sulphureus (IITA 1987)."},{"index":2,"size":10,"text":"Mass production of Cicadulina leafhoppers may be comp licated by:"},{"index":3,"size":9,"text":"(a) presence of natural enemies inside the rearing cages;"},{"index":4,"size":10,"text":"(b) temperature fluctuation during winter months or at high elevation."}]},{"head":"Natural enemies","index":23,"paragraphs":[{"index":1,"size":62,"text":"Like other insects, leafhoppers are attacked by predators and parasitoids . Ants, spiders, and lizards are common predators of Cicadulina nymphs and adults. In addition, there is a mirid bug , which is an egg predator. Ants can be kept off from the rearing cages by placing a water pan with water and kerosine or oil under the legs of the tables."},{"index":2,"size":128,"text":"The common parasitoids of Cicadulina leafhoppers are a hymenopterous wasp (Oryinid ae) and a dipteran fly (Pipunculidae). Sometimes, they can seriously affect mass production. Regular inspections by an entomologist should be carried out. Once it is noticed that a rearing cage has been infested wi th parasitoids or mirid bugs, it is advisable to discard the insects and , if necessary , also the plants and soil in the cages. The cages should be cleaned thoroughly and left empty for some days. If all the cages are severely infested, then it is advisable to discard the entire co lony and start with a new colony as described in Figure 9. Alternatively, 200-300 healthy males and females can be collected from the cages to start a new colony ."}]},{"head":"Temperature","index":24,"paragraphs":[{"index":1,"size":131,"text":"In countries with severe winter, the temperature fluctuation during the winter months may affect the mass rearing of Cicadulina leafhoppers. Where the night temperature drops below 15\"C, special arrangements should be made to increase the temperature in the screen house . Low temperature will affect the leafhoppers as well as the germination and growth of the host plants. To augment the night temperature in the screen house during winter months, the sides of the screenhouse should be covered at night with clear plastiC sheeting. During daytime, the plastic sheeting should be rolled and tied up for cross ventilation. In addition, supplementary heating can be obtained from a kerosine burner or an electric heater (where electric power supply is available). The rearing cages can also be covered with plastic sheets at night."}]},{"head":"Quality control","index":25,"paragraphs":[{"index":1,"size":72,"text":"Cicadulina leafhoppers belong to two categories: active transmitters of MSV and nonactive transmitters (Storey 1932). This character is genetically controlled. When mass rearing Cicadulina leafhoppers, it is important to maintain a high percentage (60-80%)of active transmitters in the colony. This will reduce the number of insects required for infestation of each plant, ultimately resulting in more plants being infested using the same number of leafhoppers. But it will require periodical quality control."},{"index":2,"size":182,"text":"To test the proportion of active transmitters, about 50-100 female leafhoppers should be collected from a nymphal rearing cage and released for 48 h into a small cage with streak-infested maize plants. The females should then be caged singly with 5 to 7-day old potted maize plants susceptible to MSV, using PVC cages (Fig. 7). About 7-10 days later, the numberof plants showing streak symptoms should be observed and the percentage of transmission should be calculated . If the percentage of transmission is below 35 , a new colony of active transmitters should be initiated, by putting together the progeny of those females that transmitted MSV. Also , plants showing MSV symptoms from the transmission test shou ld be placed together in a cage for egg hatching and nymphal development. Within 3 weeks, the nymphs will develop into adults and the new colony of the leafhoppers should have a higher proportion of active transmitters. The new colony can be used to build up the population of active transmitters. The percentage of active transmitters in the colony should be checked twice a year."}]},{"head":"• Figure 19","index":26,"paragraphs":[{"index":1,"size":13,"text":"Trainees listen to liT A scientist (third from left) explaining mass rearing techniques"}]},{"head":"Assisting national programs","index":27,"paragraphs":[{"index":1,"size":21,"text":"To meet the needs and circumstances of national programs and private seed companies, modifications to the described techniques might be needed."},{"index":2,"size":34,"text":"Entomologists setting up Cicadufina rearing facilities should be able to adapt the techniques developed at IITA to fit their own conditions. IITA scientists are available to assist national programs in developing Cicadulina rearing facilities."},{"index":3,"size":89,"text":"The Togolese national program developed leafhopper rearing facilities with assistance from IITA and Centro Internacional de Mejoramiento de Maiz y Trigo (CIMMYT) and modified the infestation method to their needs. The national program of Zaire and CIMMYT's mid-altitude station in Harare , Zimbabwe, were assisted by IITA to develop their rearing facilities. For the latter two countries, modifications were needed to ensure survival of the insect colonies during the cold winter months. IITA is also assisting the national programs of Ghana and Cameroon to develop their leafhopper rearing facilities. "}]}],"figures":[{"text":"Fig Figures 9, 10  Figures 11 , 12, 19  Figure 15  Figures 5, 6, 7,'8, 13, 14, 16, 18  Fig ures 2 , 4  Figu res 1, 3, 17     "},{"text":" Figu re 2 Cicadulina mbila: (a) pygophore processes ; (b) aedeagus, ventral view; (c) aedeagus , lateral view; C. storeyi: (d) pygophore processes ; (e) aedeagus, ventral view; (f) aedeagus, lateral view. "},{"text":" Figu re 3 Two dominant species of Cicadulina: (a) C. mbila (b) C. storeyi (= triangula) "},{"text":" Figure 4 Developmental stages of a leafhopper from egg to adult. There are five nymphal instars; only three are shown . "},{"text":"Figure 6 Entering Figure 6Entering the collection cage after covering it "},{"text":" Fig ure 9 Procedure used to start a new colony of Cicadulina leafhoppers for mass rearing "},{"text":"Figure Figure Attachment of thick rubber tube and Cicadulina collecting vial to vacuum cleaner for collection leafhoppers. Inset: leafhopper collecting vial "},{"text":"  "},{"text":"Table 1 . Species of Cicadulina leafhoppers known to be vectors of maize streak virus in Africa  Species Selected references SpeciesSelected references C. mbila (Naude) Storey 1925 C. mbila (Naude)Storey 1925 C. storeyi (= triangula) Chin a Storey 1936 C. storeyi (= triangula) Chin aStorey 1936 C. bipunctata (Melichar) Storey 1936 C. bipunctata (Melichar)Storey 1936 C. latens Fennah Fennah 1960 C. latens FennahFennah 1960 C. parazeae Ghauri Rose 1962 C. parazeae GhauriRose 1962 C. arachidis China Okoth & C. arachidis ChinaOkoth & C. similis China  C. similis China C. ghaurii Dabrowski  C. ghaurii Dabrowski Identification  Identification  "},{"text":" range between 22 and 45 days, depending on temperature (van der Merwe 1926; van Rensburg 1982). Under 20' C, the developmental period is prolonged. Tem- Under 20' C, the developmental period is prolonged. Tem- peratures over 35\"C are detrimental to th e insect, especially peratures over 35\"C are detrimental to th e insect, especially to C. mbila. The suitable temperature for mass rearing C. to C. mbila. The suitable temperature for mass rearing C. mbila is 25-30 o e (van der Merwe 1926; van Rensburg mbila is 25-30o e (van der Merwe 1926; van Rensburg 1982) , and for C. storeyi 30-35°e (Dabrowski 1985). 1982) , and for C. storeyi 30-35°e (Dabrowski 1985).  "},{"text":"Table 2 . Biology of two species of Cicadulina leafhoppers Parameters Parameters Egg incubation period (days) Egg incubation period (days) Nymphal developmental period (days) Nymphal developmental period (days) Preoviposition period (days) Preoviposition period (days) Longevity of adults (days) Longevity of adults (days) Fecu ndity (mean no. eggs/fema le) Fecu ndity (mean no. eggs/fema le) Suitable temperature for mass rearing ee) Suitable temperature for mass rearing ee)  "},{"text":"confine single leafhoppers to obtain progeny or to carry out virus transmission tests Mass rearing Initiating the colonies  Figure 7 Polyvinyl chloride (PVC) tube used potted-mill et plants , using PVC tube cages. You can also use plastic bottles , or soft drink or mineral water bottles. Cove r one side and the top ope ning of the cage with fine netting. 2. The gravid females wi ll lay eggs, which wi ll hatch in about one week. First allow the nymphs to feed inside the cages. It is important to ensure the young nymphs have access to fres h millet or maize plants for feeding ; thu s, transfer the nymphs to wooden or metal framed cages (approx. 40 x 40 x 60 cm) covered with fin e netting . Do not place nymphs originating fro m different females together in the same cage, to avo id mixing to 1. Cage abou t 150-200 fem ale leafhoppers si ngly on youn g different species. Figure 7 Polyvinyl chloride (PVC) tube used potted-mill et plants , using PVC tube cages. You can also use plastic bottles , or soft drink or mineral water bottles. Cove r one side and the top ope ning of the cage with fine netting. 2. The gravid females wi ll lay eggs, which wi ll hatch in about one week. First allow the nymphs to feed inside the cages. It is important to ensure the young nymphs have access to fres h millet or maize plants for feeding ; thu s, transfer the nymphs to wooden or metal framed cages (approx. 40 x 40 x 60 cm) covered with fin e netting . Do not place nymphs originating fro m different females together in the same cage, to avo id mixing to 1. Cage abou t 150-200 fem ale leafhoppers si ngly on youn g different species.  "},{"text":"Table 3 . MSV visual rating scale  Rating Rating  "},{"text":" During 1990, liT A offered an intensive two-week training course on Cicadulina leafhopper rearing. It was attended by participants from four African countries. This course can be offered again in the future if there is sufficient need or demand. National program scientists should contact I IT A to express interest and seek further information.  "}],"sieverID":"3bdeb4a7-2c1f-4fd7-bb03-92fc21144f11","abstract":"Maize streak virus is generally considered the most important and widespread disease of maize grown in sub-Saharan Africa. Occasionally reaching epidemic proportions, it is a chronic problem for small-scale farmers who lack the labor or equipment to ensure that their entire crop is planted early in the season. The later they plant, the greater the risk of virus damage.IITA's best-known accomplishment in maize improvement has been the development of a practical resistance screening system for large-scale field use against the streak virus. The system has been used to produce a wide rarlQe of resistant germ plasm fitting the various agroecologies of sub-Saharan Africa.The system enables th e identification of durable , oligogenic resistance. Since streak resistance carries no yield penalty or other undesirable side effects, and a practical screening technique exists, the effort now is to incorporate streak resistance into any variety before it is released in the region. To help achieve this goal, IITA has assisted national research programs to incorporate the screening method for streak resistance into their routine breeding practice. This booklet carries that assistance one step further. We hope the national programs in the region wil l use it profitably. We welcome their feedback on the usefulness of this publication."}

data/part_2/0786ea0429af7c82b029e1c67fa2191e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0786ea0429af7c82b029e1c67fa2191e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f3f057c4-4537-4285-a141-fb9cca467341/retrieve"},"pageCount":16,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":26,"text":"Evaluación de productos de lluvia de alta resolución para representar la canícula en el corredor seco de Honduras Carlo Montes, Camilo Barrios, Irma Ayes, Julian Ramirez"}]},{"head":"Diciembre de 2023","index":2,"paragraphs":[{"index":1,"size":307,"text":"La sequía de verano o canícula es un fenómeno hidrometeorológico estacional que da forma a múltiples actividades sociales en Honduras, pero especialmente a la producción primaria de cultivos y ganadería. Este estudio evalúa el desempeño de cuatro productos de lluvia grillados de alta resolución espacial (AgERA5, CHIRPS, IMERG, MSWEP) para su uso en el monitoreo de la canícula en el corredor seco de Honduras. Se utilizaron datos de 27 pluviómetros para el período 2001-2020. Para la evaluación del desempeño se utilizaron las fechas de inicio, momento de mayor caída de la lluvia (peak) pico y término, además de la duración e índices de intensidad. Junto a lo anterior, se utilizó la evapotranspiración de referencia (ET0) y el índice de sequía de demanda evaporativa (EDDI, por su sigla en inglés). Los resultados muestran diferencias notables en la representación de la extensión espacial del corredor seco por los productos grillados. En cuanto al momento de ocurrencia de la canícula, los resultados indican una representación similar de los productos grillados evaluados, con un error medio de aproximadamente una semana. Los cuatro productos muestran intensidades de la canícula más bajas en relación a los pluviómetros, aunque con patrones espaciales climatológicos similares. Todos los productos muestran una mayor intensidad de la canícula en las áreas centro-sur de Honduras; IMERG y CHIRPS generalmente muestran intensidades más bajas que AgERA5 y MSWEP. Los cuatro productos grillados capturan categorías de sequía EDDI similares en cuanto a intensidad. A pesar de las ventajas de utilizar conjuntos de datos cuadriculados, especialmente en relación con una mayor cobertura y consistencia, ningún conjunto de datos coincidió consistentemente con las mediciones de pluviómetros para todas las características y áreas de la canícula en Honduras. En consecuencia, la elección de un producto de lluvia debe hacerse con base en el propósito de aplicación de los datos en el contexto de Honduras."}]},{"head":"AgriLAC Resiliente","index":3,"paragraphs":[{"index":1,"size":90,"text":"Type of report eg Technical Report Introducción Honduras, ubicado en Centroamérica, está altamente expuesta a los impactos de eventos meteorológicos y climáticos extremos, así como a los impactos del cambio climático (Kreft et al., 2013). Las sequías recurrentes, los ciclones tropicales, las inundaciones y las olas de calor afectan gravemente los medios de vida y la economía de la población agrícola dominante (Aguilar et al., 2005). Fenómenos globales del clima como El Niño-Oscilación del Sur (ENOS), modulan en gran medida la intensidad y frecuencia de los eventos extremos en Honduras."},{"index":2,"size":278,"text":"El clima de Honduras es altamente estacional y está regulado principalmente por los vientos alisios y el curso estacional de la Zona de Convergencia Intertropical. Una vasta zona adyacente al Océano Pacífico se caracteriza por una interrupción del período húmedo que conduce a un mínimo local de precipitaciones. Este período se conoce como sequía de verano o canícula, generando una distribución anual bimodal de las precipitaciones (Magaña et al., 1999). Esta zona forma parte de una unidad geográfica que se extiende desde el sur de México hasta Panamá, conocida regionalmente como corredor seco, la que ha sido descrita como una de las regiones más vulnerables a la variabilidad climática en el mundo (Huber et al., 2023). El ciclo estacional típico de lluvia en el corredor seco de Honduras muestra un peak entre mayo y junio, seguido de un mínimo de lluvia entre julio y agosto, y un segundo peak entre septiembre y octubre. La canícula surge de la interacción de múltiples factores. El primer máximo de precipitaciones se debe al calentamiento del Océano Pacífico oriental y al consiguiente aumento de la convección, siguiendo un debilitamiento de los vientos del este y un aumento de la nubosidad. El mínimo de precipitaciones es causado por una reducción de la radiación solar incidente y un enfriamiento del océano, lo cual suprime la convección, una intensificación de los vientos alisios que, junto con el efecto orográfico, generan un máximo de precipitaciones en la costa Caribe y un mínimo en la vertiente del Pacífico (la canícula). El calentamiento posterior del océano da lugar a una convección húmeda profunda y, en consecuencia, al segundo máximo de precipitaciones (Magaña et al., 1999;Maldonado et al., 2016)."},{"index":3,"size":338,"text":"Si bien la canícula es un fenómeno estacional recurrente que no necesariamente representa un período de ausencia absoluta de lluvias, la fuerte disminución en las precipitaciones y su variabilidad interanual en cuanto a fechas de inicio, término, y su intensidad, son de gran importancia para la población rural dominante del corredor seco. Las variaciones en las fechas de inicio o en la intensidad de la disminución de la lluvia y la duración de la canícula afectan la toma de decisiones en cuanto a actividades de los pequeños agricultores, con consecuencias en la productividad de los cultivos, la economía local y la seguridad alimentaria (Maurer et al., 2022). Por lo tanto, se necesitan acciones anticipatorias para reducir los impactos estacionales de la canícula en la seguridad alimentaria e hídrica y los medios de vida rurales (Alianza Bioversity-CIAT, INSIVUMEH y MAGA, 2022). Tales acciones se basan en sistemas confiables de monitoreo y pronóstico que ayuden a anticipar los problemas asociados con una aparición temprana de la canícula en cultivos de secano como frijoles y maíz, o la incidencia de plagas y enfermedades, y las opciones de adaptación correspondientes para mitigar los riesgos inducidos por la canícula (Maurer et al., 2017). Desafortunadamente, el acceso a datos y pronósticos de calidad sobre la canícula y sus impactos, así como la identificación de patrones en cuanto a proyecciones futuras está fuertemente limitado por la escasez de datos en Honduras y, más ampliamente, en Mesoamérica (Quesada-Montano et al., 2019). La mayoría de los estudios que intentan delimitar el corredor seco centroamericano (ej., Quesada-Hernández et al., 2019;Stewart et al., 2022) o caracterizar la canícula (ej., Zhao et al., 2021Zhao et al., , 2022;;Maurer et al., 2022), se basan en datos meteorológicos grillados como reanálisis o productos de precipitación satelital. La mayoría de estos estudios son regionales y, por lo tanto, no captan las especificidades internas de los países. Además, el uso de productos cuadriculados generalmente se realiza sin una evaluación comparativa adecuada con pluviómetros o registros de estaciones meteorológicas debido a la escasez de datos."},{"index":4,"size":127,"text":"El objetivo general de este estudio es evaluar el desempeño y comparar cuatro productos de lluvia de reanálisis y satelitales de alta resolución en cuanto a la representación de la extensión espacial del corredor seco y un conjunto de métricas del tiempo (inicio, término, duración) y la intensidad de la canícula en Honduras. Los resultados de este trabajo pueden potencialmente contribuir a mejorar el conocimiento de las áreas de Honduras afectadas por la canícula, sus principales características y diferencias, además de la implementación de sistemas de monitoreo que permitan enfocar y priorizar acciones de adaptación y mitigación. El estudio también contribuye a comparar productos cuadriculados con registros observados, ayudando así a científicos y profesionales a realizar selecciones sobre qué productos utilizar para su aplicación específica de interés."}]},{"head":"Datos y metodología","index":4,"paragraphs":[]},{"head":"Productos de lluvia grillados y de superficie","index":5,"paragraphs":[{"index":1,"size":86,"text":"Se evaluaron cuatro productos de lluvia grilados derivados de satélites y reanálisis en cuanto a la representación del corredor seco y la canícula en Honduras. Estos productos proporcionan series temporales lo suficientemente extensas para una climatología regional, y con resoluciones espaciales que pueden considerarse adecuadas para capturar las principales características geográficas del país. El conjunto de datos corresponde a la lluvia diaria de AgERA5, CHIRPS, IMERG y MSWEP. Las características principales de los productos utilizados se presentan a continuación y se resumen en la Tabla 1."},{"index":2,"size":342,"text":"Tabla 1. Características principales de los productos de lluvia evaluados. Desarrollado por el European Centre for Medium-Range Weather Forecasts (ECMWF), AgERA5 corresponde a una versión diaria y de mayor resolución espacial del reanálisis ERA5. Proporciona datos a una resolución espacial de 0,1º  0,1º, abarcando el período desde enero de 1979 hasta el presente, con una latencia de 8 días.. El segundo producto evaluado corresponde a CHIRPS versión V.2, el cual es desarrollado por el Climate Hazards Group de la Universidad de California-Santa Bárbara. CHIRPS corresponde a un producto generado por la fusión de datos de mediciones satelitales y terrestres, proporcionado a una resolución espacial de 0.05º  0.05º y 0.25º  0.25º, y a una escala temporal horaria, diaria, mensual y anual, para el período desde enero de 1981 hasta la actualidad, con una latencia de alrededor de tres semanas. El tercer producto evaluado es el Global Precipitation Measurement (GPM) Integrated Multisatellite Retrievals for the Global Precipitation Measurement (IMERG) de la National Aeronautics and Space Administration's (NASA). IMERG corresponde a un producto de lluvia casi global (60 ºN-60 ºS) que se deriva de una constelación de satélites de radar y microondas pasivos e infrarrojos. Lanzado en 2014 y extendiendo la cobertura temporal de la Tropical Rainfall Measuring Mission (TRMM), IMERG está disponible desde junio de 2000 hasta el presente, proporcionando datos de lluvia a una resolución espacial de 0,1º  0,1º para tres versiones (temprana, tardía y final), las que difieren en la latencia y la calidad de los datos. Se utilizó el producto de lluvia diaria de corrida Final Nivel 3, el cual es producido utilizando datos de pluviómetros para su calibración, siendo recomendado para estudios climatológicos. Finalmente, se evaluó la precipitación del producto Multi-Source Weighted-Ensemble Precipitation (MSWEP), el cual corresponde a un producto de lluvia global subdiario y diario de última generación, proporcionado a una resolución espacial de 0,1º  0,1º para el período desde enero de 1979 hasta el presente. MSWEP se genera con una latencia de tres horas, combinando lluvia satelital, reanálisis y datos diarios de pluviómetros."}]},{"head":"Producto","index":6,"paragraphs":[{"index":1,"size":77,"text":"Además de los cuatro productos de grilla, se utilizaron datos de lluvia diaria proporcionados por el Centro de Estudios Atmosféricos, Oceanográficos y Sísmicos (CENAOS), el Servicio Meteorológico Nacional de Honduras. Este set de datos consta de precipitaciones diarias de 27 pluviómetros, para el período comprendido entre enero de 2001 y diciembre de 2020, el período común para los cuatro productos de lluvia grillados evaluados. La distribución espacial de los pluviómetros utilizados se presenta en la Figura 1."},{"index":2,"size":42,"text":"Figura 1. Mapa de elevaciónd de Honduras (m sobre el nivel medio del mar) y distribución espacial de los pluviómetros utilizados (círculos). Los datos de elevación se obtuvieron del modelo de elevación digital Shuttle Radar Topography Mission (SRTM) de 90 m: https://www2.jpl.nasa.gov/srtm/."}]},{"head":"Algoritmo de detección de la canícula y métricas para su caracterización","index":7,"paragraphs":[{"index":1,"size":104,"text":"Se utilizó el algoritmo de detección de la canícula desarrollado por Zhao et al. (2020), el cual se adapta a la implementación de servicios de información y monitoreo de la canícula, y ha sido descrito como adecuado para su caracterización en relación a otros métodos (Zhao y Zhang, 2021). Este método se basa en el uso de lluvia diaria para detectar patrones de lluvia bimodal de acuerdo a los siguientes criterios: (1) la serie de tiempo presenta un primer máximo entre el 15 de mayo y el 15 de julio, y un segundo máximo entre el 15 de agosto y el 15 de octubre;"},{"index":2,"size":294,"text":"(2) uno de esos dos máximos corresponde al máximo de precipitación anual; y (3) es posible realizar un ajuste lineal estadísticamente significativos entre el 1 de enero y la fecha del primer máximo, y otro entre la fecha del segundo máximo y el 31 de diciembre, los cuales representan la forma bimodal de la serie de tiempo. Cuando se cumplen esos tres criterios, el período entre el primer y el segundo máximo de lluvia corresponde a la canícula. Previo a aplicar el método, se aplicó un filtro ponderado gaussiano a cada serie temporal diaria de lluvia anual. Asimismo, el algoritmo se aplicó en dos etapas; en primer lugar, para la detección del área correspondiente al corredor seco en Honduras, y, en segundo lugar, para caracterizar la variabilidad de la canícula. Para delinear el corredor seco, los tres pasos descritos anteriormente se aplican al ciclo anual promedio diario de lluvia a largo plazo (20 años en el presente estudio), de modo que cada punto de grilla donde se cumplen los tres criterios corresponda a un punto en el corredor seco. Para caracterizar la canícula, se obtuvo una serie de métricas temporales: fecha de inicio (fecha del primer máximo), fecha de término (fecha del segundo máximo), duración (número de días entre las fechas de inicio y término) y fecha peak (fecha de la precipitación mínima en la canícula). Además, la intensidad de la canícula se caracterizó mediante el índice de intensidad IMSD (Zhao et al., 2020), el que se calcula como \uD835\uDC3C \uD835\uDC40\uD835\uDC46\uD835\uDC37 = (\uD835\uDC43 \uD835\uDC5A\uD835\uDC4E\uD835\uDC65 − \uD835\uDC43 \uD835\uDC5A\uD835\uDC56\uD835\uDC5B ) \uD835\uDC43 \uD835\uDC5A\uD835\uDC4E\uD835\uDC65 ⁄ , donde Pmax es el valor mayor entre el primer y el segundo máximo de precipitación de la distribución bimodal de lluvia, y Pmin la precipitación media en el período de la canícula."}]},{"head":"Evapotranspiración de referencia e índice de sequía de demanda evaporativa (EDDI)","index":8,"paragraphs":[{"index":1,"size":124,"text":"Se utilizó la evapotranspiración total de referencia (ET0), un indicador de la demanda hídrica atmosférica, integrada entre el inicio y el término de la canícula. Para esto, se utilizó el producto de ET0 diaria, a 0,125º  0,125º de resolución espacial, de cultivo largo (0,5 m de altura), desarrollado por la División de Ciencias Físicas de la Administración Nacional Oceánica y Atmosférica (NOAA PSL, 2023; https://psl.noaa.gov/eddi/globalrefet/). Este producto es generado utilizando datos del Modern-Era Retrospective Analysis for Research and Applications version 2 (MERRA2) y la formulación Penman-Monteith de la Sociedad Estadounidense de Ingenieros Civiles (ASCE; Allen et al., 1998). Los datos de ET0 fueron remuestreados bilinealmente a la resolución espacial de cada producto de lluvia, es decir, 0,05º  0,05º y 0,1º  0,1º."},{"index":2,"size":179,"text":"Se utilizó también el índice de sequía de demanda evaporativa (EDDI; Hobbins et al., 2016) para evaluar posibles condiciones de estrés relacionadas con la sequía en cultivos. EDDI es un índice no paramétrico diseñado para evaluar la ocurrencia y severidad de la sequía basándose únicamente en la demanda hídrica atmosférica. Este índice fue elegido dada su flexibilidad en términos de períodos de agregación (diario, mensual, estacional), a diferencia de otros índices comúnmente utilizados como el Índice Estándar rizado de Precipitación (SPI, por su sigla en inglés) o el Índice Estandarizado de Precipitación y Evapotranspiración (SPEI, por su sigla en inglés), que se basan en métodos paramétricos ajustados a escalas de tiempo específicas (ej., 1, 3, 6 meses). EDDI se calcula a partir de ET0, por lo que representa la ocurrencia de sequía sobre una superficie con vegetación (ver Hobbins et al., 2016 para detalles sobre el cálculo de EDDI). Valores positivos (negativos) de EDDI representan condiciones más secas (más húmedas) de lo normal. Además, se definen categorías de sequía en base a los percentiles de percentiles EDDI (Tabla 2)."},{"index":3,"size":46,"text":"Tabla 2. Categorías de sequía y su descripción para diferentes percentiles de EDDI. Figura 2. Mapas del corredor seco obtenidos de los cuatro productos grillados de lluvia cuadriculados en Honduras. Los puntos negros corresponden al área del corredor seco de van der Zee et al. (2012)."}]},{"head":"Categoría de sequía","index":9,"paragraphs":[]},{"head":"Caracterización espacial, temporal, y de la intensidad de la canícula","index":10,"paragraphs":[{"index":1,"size":315,"text":"Los cuatro productos de lluvia se compararon en términos de la temporalidad de la canícula (inicio, término, duración). La Figura 3 muestra los mapas de las fechas promedio (2001-2020) de inicio, peak y término, además de la duración de la canícula. Estos índices se calcularon sobre el corredor seco obtenido para cada uno de los cuatro productos de lluvia (Figura 2). Los mapas de la Figura 3 muestran que, en cuanto a fechas de inicio (Figura 3a-3d), los cuatro productos reproducen un patrón de fechas más tempranas en las áreas centro-sur de su correspondiente delimitación del área del corredor seco, y en general más tardías hacia el occidente del país, lo que concuerda con las observaciones de los pluviómetros. Las fechas medias de inicio de la canícula son similares para los cuatro productos, con una fecha promedio del 20 de junio (día del año DOY =172), variando entre el 18 al 22 de junio. En cuanto a la fecha peak de la canícula, los mapas de la Figura 5e-5h muestran fechas promedio que van del 6 al 10 de agosto y, a diferencia de las fechas de inicio, el peak de la canícula muestra una distribución espacial de fechas más tempranas hacia el oeste del país. De manera similar, los mapas climatológicos de las fechas de término de la canícula muestran fechas más tardías en el área centro-sur de Honduras y más tempranas en el oeste y el este (Figura 5i-5l). Los resultados anteriores tienen un impacto en la duración de la canícula, la cual se observa mucho más larga en las zonas centro-sur de Honduras, con una duración promedio de alrededor de 3 meses (~100 días), patrón que es capturado de manera relativamente similar por los cuatro productos de lluvia (Figura 5m-5p).   4. Climatología (20014. Climatología ( -2020) ) del índice de intensidad de la canícula (IMSD) para los cuatro productos de lluvia cuadriculados."}]},{"head":"Demanda evaporativa durante la canícula y potenciales condiciones de estrés para los cultivos","index":11,"paragraphs":[{"index":1,"size":212,"text":"En la Figura 5a se presentan las series de tiempo promedio a nivel de país de la ET0 acumulada durante la canícula. La ET0 promedio para los cuatro productos y durante los 20 años considerados es de 427 mm, variando desde un promedio mínimo entre productos de 360 mm en 2010, hasta un máximo de 497 mm en 2015, muy cerca de los 495 mm de 2019. Estos totales representan alrededor del 70% del total durante la temporada de lluvias (Figura 5d). AgERA5 e IMERG representan la ET0 total más alta y más baja, respectivamente, lo que puede explicarse por la duración media de MSD más larga y más corta capturada por esos dos productos, respectivamente (Fig. 3). De manera similar, la Fig. 5b muestra la serie de tiempo de EDDI agregada durante la canícula, capturada por los cuatro productos de lluvia. Como era de esperar, teniendo en cuenta su cálculo basado en rangos, las series de tiempo de EDDI se observan muy similares entre sí, excepto en algunos años (2006,2017) cuando se observan algunas diferencias. Además, dada su autocalibración, los valores de EDDI varían de negativos a positivos, lo que es indicativo de condiciones más húmedas o más secas de lo normal, respectivamente, dentro del período más seco de la canícula."},{"index":2,"size":178,"text":"La Figura 6 muestra la distribución espacial de las categorías de sequía descritas para EDDI (Tabla 2), en este caso para los años 2015 y 2019, los cuales aparecen particularmente secos en la Fig. 5b. Durante estos dos años, la ET0 fue mayor que la precipitación (Fig. 5d), y el índice EDDI indica condiciones que van desde anormalmente secas (D0) hasta sequía excepcional (D4). Una diferencia importante entre ambos años es el gradiente espacial que muestran las categorías de sequía, el cual, en general, se observa con orientación noreste-suroeste en 2015, mientras que en 2019 las áreas más secas se distribuyen hacia el norte del correspondiente dominio del corredor seco. En todos los casos, la clase de sequía excepcional D4 es dominante en términos de su extensión espacial, lo que es indicativo de condiciones de sequía con altos impactos potenciales para los cultivos. Figura 6. Mapas de categorías de sequía EDDI (Tabla 2) para los cuatro productos de lluvia en 2015 (columna izquierda) y 2019 (columna derecha). También se muestra el área porcentual de la categoría de sequía."}]},{"head":"Conclusiones","index":12,"paragraphs":[{"index":1,"size":189,"text":"Se presenta una evaluación de cuatro productos grillados de lluvia de alta resolución derivados de reanálisis y satélite (AgERA5, CHIRPS, IMERG y MSWEP) en cuanto al cómo representan la extensión espacial del corredor seco, así como un conjunto de métricas de caracterización de la canícula en Honduras, utilizando una metodología basada en el procesamiento de datos diario de lluvia. Estos conjuntos de datos de lluvia representan una oportunidad para el monitoreo y análisis de un fenómeno de gran importancia, como lo es la canícula, en un país con una cobertura espacial de pluviómetros y estaciones meteorológicas deficiente. La comparación con los datos de los pluviómetros sugiere que los diferentes algoritmos y datos de entrada utilizados para generar esos productos conducen a diferencias importantes. En este sentido, si bien el desempeño general de AgERA5 puede considerarse el más pobre, este corresponde a un producto generado a partir del downscaling estadístico del reanálisis ERA5, el que, además de precipitación, proporciona múltiples variables de interés para el seguimiento y análisis de fenómenos de relevancia en agricultura. Por el contrario, tanto CHIRPS, IMERG como MSWEP son productos que proporcionan únicamente datos de precipitación."},{"index":2,"size":218,"text":"El área delimitada como corredor seco en Honduras varía considerablemente para los cuatro productos. Si bien éstos logran identificar la ubicación del corredor seco hacia la mitad sur del país, su forma y proporción del área del país difieren considerablemente. Estos resultados sugieren que la delimitación del corredor seco y el área afectada por la canícula en Honduras es muy sensible a la elección de un producto de lluvia. Además, es probable que el uso de la precipitación media diaria interanual no necesariamente capture el patrón de precipitaciones que caracteriza a la canícula, ya que al filtrar los datos ser podría eliminar la señal de disminución de lluvias en verano. Como consecuencia, el uso exclusivo de datos de lluvia puede no ser una opción adecuada, ya que los resultados se verían afectados por los errores sistemáticos y aleatorios inherentes a los productos. Por lo tanto, el uso de métodos de corrección de sesgos junto con información auxiliar tales como mapas de uso de suelo o series de tiempo de índices de vegetación puede representar una mejor opción para la delimitación del corredor seco en Honduras. Lo anterior con el objetivo de combinar la identificación de la señal de lluvia durante la canícula y las propiedades de superficie resultantes tales como la caída en el verdor de la vegetación."},{"index":3,"size":275,"text":"Los resultados muestran que todos los productos reproducen el patrón espacial de fechas de inicio/término más temprano/tardío hacia la zona centro-sur del país, con patrones relativamente similares en cuanto a fechas de inicio, peak, término y duración de la canícula, con diferencias del orden de una semana. A nivel país, la canícula en Honduras se extiende en promedio entre el 20 de junio y el 26 de septiembre, con una fecha peak el 9 de agosto. Estos resultados, que son similares a estudios anteriores (ej., Magaña et al., 1999;Maldonado et al., 2016;Zhao et al., 2020), son consistentes con las observaciones (Figura 3), y muestran que los productos proporcionan resultados más homogéneos al capturar las fechas de inicio de la canícula. En cuanto a la intensidad de la canícula, los cuatro productos reproducen el patrón de mayor intensidad, representado por el índice IMSD, hacia las zonas centro-sur de Honduras. Sin embargo, la comparación con los pluviómetros indica que los cuatro productos tienden a subestimar la intensidad de la canícula. Esta subestimación, que parece acentuarse más hacia las zonas occidentales del país (Figura 4), puede ser relevante a la hora de diseñar servicios climáticos centrados en el impacto potencial de la canícula en los sistemas agrícolas o hídricos, lo que llevaría a la necesidad de implementar un método de corrección de sesgo. Sin embargo, la similitud en los patrones espaciales de temporalidad e intensidad de la canícula, sugiere la idoneidad del método utilizado para monitorear la canícula, y que los conjuntos de datos podrían ser, por lo tanto, adecuados para el monitoreo de la canícula, lo cual es particularmente importante para áreas no cubiertas por estaciones meteorológicas."},{"index":4,"size":153,"text":"Los resultados obtenidos al utilizar EDDI como índice de sequía representan una oportunidad para el desarrollo de herramientas de monitoreo y caracterización de la canícula y la agricultura utilizando datos de lluvia de corta latencia y ET0. Por ejemplo, EDDI es capaz de discriminar áreas con mayor intensidad de la canícula, lo que podría usarse para el monitoreo y potencialmente el pronóstico, junto con las precipitaciones, ya que se ha demostrado que EDDI es más adecuado para evaluar eventos de sequía de rápida aparición (Ramseyer y Miller, 2023). En este sentido, si bien el algoritmo de detección de la canícula utilizado proporciona una aproximación adecuada, un enfoque multivariado que considere las relaciones entre lluvia y EDDI, por ejemplo, podría ayudar a delimitar el corredor seco desde una perspectiva de los impactos para los cultivos, considerando no sólo la forma del ciclo anual de lluvias sino también el cambio en la demanda de agua."}]}],"figures":[{"text":" Para la evaluación de la delimitación del corredor seco, se utilizó el producto de van der Zee et al. (2012) como referencia, según el cual el corredor seco corresponde al área de Centroamérica cuya estación seca se extiende por al menos cuatro meses consecutivos. La delimitación del corredor seco por los cuatro productos grillados de lluvia utilizando el métodode Zhao et al. (2020)  se presenta en la Fig.2. Se observan diferencias en la proporción del país clasificado como corredor seco como en su forma. Un 70,6% del área de Honduras fue identificada como corredor seco por AgERA5, un 47,6% por CHIRPS, un 45,1% por IMERG y un 63,1% por MSWEP (calculado como el porcentaje de puntos de la grilla clasificados como corredor seco). Además, AgERA5 captura un corredor seco espacialmente muy regular en su límite norte (Fig.2a). Por otro lado, IMERG parece capturar un área menor en relación con los otros productos (Figura 2c). CHIRPS y MSWEP muestran similitudes en la forma en que capturan el área del corredor seco en Honduras, el cual es más similares a van der Zee et al.(2012), extendiéndose el área representada por MSWEP más hacia el oriente del país. "},{"text":"Figura 3 . Figura 3. Mapas de fechas medias (2001-2020) de inicio, pico, fin (día del año, DOY) y duración (número de días) de MSD para los tres productos de lluvia cuadriculados y pluviómetros en Honduras. También se proporcionan estadísticas espaciales. "},{"text":"Figura Figura4. Climatología (20014. Climatología ( -2020) )  del índice de intensidad de la canícula (IMSD) para los cuatro productos de lluvia cuadriculados. "},{"text":"Figura 5 . Figura 5. Series de tiempo de (a) ET0 total, (b) EDDI, (c) lluvia total y (d) relación entre ET0 y lluvia total entre 2001 y 2020 durante la canícula para los cuatro productos de lluvia. Los valores entre paréntesis en (a) y (c) corresponden a los valores promedio. "},{"text":"  "},{"text":"  "}],"sieverID":"cab2d708-4d11-467f-a2e4-56b3cbd7fd42","abstract":"Productos de lluvia grillados y de superficie ."}

data/part_2/078917fa00cf2ac4a2b40cce8e8ded73.json

@@ -0,0 +1 @@
+{"metadata":{"id":"078917fa00cf2ac4a2b40cce8e8ded73","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/679037a5-fb3c-49cf-8c8c-1ca3c98e6d3b/retrieve"},"pageCount":2,"title":"Model Species Distributions by Estimating the Probability of Occurrence Using Presence-Only Data","keywords":["P801 -1. Restoration (forest and landscape restoration)","D11494 -1.18 Maintenance and update current and new decision-support tools. Africa Tree Finder, The Species Switchboard, The Agroforestree Database, The Vegan Community Ecology Package, ResTool, others. (Not disseminated) Contributing CRPs/Platforms:","FTA -Forests, Trees and Agroforestry"],"chapters":[],"figures":[],"sieverID":"4e52841b-a741-4f64-8fe5-1466b4a17c1b","abstract":"A species' distribution can be characterized by the probability that it occurs at some location in space. Estimating occurrence probability can be easily accomplished using presence-absence data, but often researchers only have presence locations and environmental data for the study area. MAXENT is a popular software program for modeling species distributions, but it does not estimate the probability of occurrence. Rather, it returns various indices that are not easy to interpret . The package \"maxlike\" provides a simple likelihood-based alternative."}

data/part_2/07fbe6a5b2a2633c4f9f7fed6ce131de.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07fbe6a5b2a2633c4f9f7fed6ce131de","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c206ef29-925c-4d71-a6ed-41f8564b5139/retrieve"},"pageCount":5,"title":"Mainstreaming Agricultural Biological Diversity across sectors through NBSAPs Missing Links to Climate Change Adaptation, Dietary Diversity and the Plant Treaty","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":123,"text":"The tenth Meeting of the Conference of the Parties (COP-10) to the Convention on Biological Diversity (CBD) called upon countries to implement the Strategic Plan for Biodiversity 2011-20, including the Aichi Biodiversity Targets, and invited parties to review their national biodiversity strategies and action plans accordingly. National biodiversity strategies and action plans (NBSAPs) are a key instrument for translating the CBD into national action and for integrating biodiversity across sectors. The CBD calls for parties to 'integrate, as far as possible and as appropriate, the conservation and sustainable use of biological diversity into relevant sectoral or cross-sectoral plans, programmes and policies' (Article 6(b)). Mainstreaming biodiversity will be critical to the implementation of the 2030 Agenda for Sustainable Development and its Sustainable Development Goals."},{"index":2,"size":44,"text":"This Information Note presents a summary of an analysis of the revised NBSAPs that were submitted by 119 countries to the CBD Secretariat prior to 20 November 2016 1 . The study focused on how agrobiodiversity has been mainstreamed across sectors through the NBSAPs."},{"index":3,"size":112,"text":"Most of the revised NBSAPs address this theme in the context of reporting on their plans linked to Aichi Biodiversity Target 7 (according to which, by 2020, areas under agriculture, aquaculture and forestry are to be managed sustainably, ensuring the conservation of biodiversity) and Target 13 (according to which, by 2020, the genetic diversity of cultivated plants, farmed and domesticated animals and wild relatives, including other socio-economically as well as culturally valuable species, are to be maintained, and strategies are to be developed and implemented for minimizing genetic erosion and safeguarding their genetic diversity). It is for this reason that this Information Note is divided into sections corresponding to these two targets."},{"index":4,"size":105,"text":"On one hand, it is not surprising that countries have focused most of their NBSAP development on the conservation and use of biological diversity in agriculture under these two targets, since they alone explicitly mention biological diversity linked to agriculture. On the other hand, as our analysis shows, it is possible that by 'sticking too closely to the text' of these two targets, NBSAPs have not capitalized on opportunities to mainstream agrobiodiversity in other sectoral activities. In particular, they have missed opportunities to define a role for agrobiodiversity in broader development planning, poverty reduction strategies, food security and nutrition planning, and climate change adaptation planning."},{"index":5,"size":48,"text":"The evidence of disjuncture between sectors is underscored by the fact that very recently, the United Nations Food and Agriculture Organization's Commission on Genetic Resources for Food and Agriculture endorsed two sets of guidelines to support countries integrating GRFA diversity into national nutrition and climate change policy plans."},{"index":6,"size":35,"text":"3 And of course the UN FAO ITPGRFA provides a framework specifically designed for conservation and sustainable use of PGRFA. Yet these guidelines and the ITPGRFA are rarely mentioned or reflected across the 119 NBSAPs."}]},{"head":"Conservation strategies for genetic resources for food and agriculture (Aichi Biodiversity Target 13)","index":2,"paragraphs":[{"index":1,"size":50,"text":"Ninety-two per cent of the NBSAPs make reference to Aichi Biodiversity Target 13, but only 32 per cent contain specific targets and actions.   . Mainstreaming GRFA is also considered in conjunction with agrarian subsidies in other countries in Europe with programs that promote conservation agriculture, organic agriculture, agroecology and agroforestry."},{"index":2,"size":94,"text":"Sudan explicitly mainstreams GRFA in national development plans and as part of strategies for social and economic development. Finland considers mainstreaming GRFA in relation to its rural development program. Myanmar considers mainstreaming agrobiodiversity in conjunction with land policies that support communal tenure for agrobiodiversity conservation. Philippines suggests that land planning should incorporate agrobiodiversity concerns in its comprehensive land use plans; and Italy, Japan and Laos suggest mainstreaming agrobiodiversity be included in its rural landscape policies. Only Brazil, Nauru, Nicaragua, Sri Lanka and Tuvalu highlight mainstreaming agrobiodiversity in food and nutrition security policies and programs."},{"index":3,"size":33,"text":"Finally, some countries' NBSAPs mention the need to mainstream agrobiodiversity under other national regulatory instrumentsfor example, environmental impact assessments and risk assessments certification and labelling schemes, and geographical indications and ecosystem valuation processes."}]},{"head":"Conclusion: the main gaps of the NBSAPs in mainstreaming agrobiodiversity","index":3,"paragraphs":[{"index":1,"size":65,"text":"Overall, ex situ conservation, and, to a lesser extent, in situ conservation are fairly well integrated into NBSAPs (though on farm conservation gets less attention). In addition, GRFA are widely considered in the promotion of sustainable agriculture practices as an important component of agroforestry, conservation agriculture and organic agriculture. Most NBSAPs emphasize the urgent need to confront the erosion local plant and livestock genetic diversity."},{"index":2,"size":27,"text":"Most NBSAPs do not address a range of opportunities for mainstreaming agrobiodiversity in different sectors. In this Information Note, we draw attention to three such missed opportunities."},{"index":3,"size":83,"text":"First, very few NBSAPs consider the role and potential importance of the International Treaty on Plant Genetic Resources for Food and Agriculture (ITPGRFA) as a framework for supporting the conservation and sustainable use of agrobiodiversity, and the equitable sharing of benefits. Only 10 per cent of the NBSAPs make any reference to the ITPGRFA, and only 4 per cent mention the importance of implementing the multilateral system of access and benefit-sharing, and how that needs to complement the implementation of the Nagoya Protocol."},{"index":4,"size":14,"text":"10 Only two countries make reference to Farmers' Rights under the ITPGRFA 11 ."},{"index":5,"size":18,"text":"Second, very few NBSAPs describe plans for integrating GRFA diversity into their strategies for adapting to climate change."},{"index":6,"size":123,"text":"12 Third, few countries consider the role of varieties and breeds of plants and animals, as well as wild, neglected and underutilized species and their unique nutrient composition, in addressing food security and nutrition issues 13 . This is somewhat surprising given the existence of the CBD Cross Cutting Initiative on Biodiversity for Food and Nutrition and the fact that we are in the midst of both the UN Decade of Action on Nutrition and the UN Decade on Biodiversity. Just 5 per cent of NBSAPs anticipate use of underutilized crops and indigenous varieties that are relevant for food security 14 . However, only four NBSAPs specifically integrate and mainstream biodiversity for food and agriculture into nutrition securityrelated policies, programs and action plans."},{"index":7,"size":35,"text":"In this regard, the authors recommend including the above mentioned issues as suggested elements for the draft decisions that will be adopted at COP-13 to the CBD and submitting them for consideration in the Updated "}]},{"head":"Notes","index":4,"paragraphs":[{"index":1,"size":179,"text":"1 The national biodiversity strategies and action plans (NBSAPs) reviewed are from Afghanistan, Albania, Antigua and Barbuda, Armenia, Australia, Austria, Bahrain, Bangladesh, Belarus, Belgium, Benin, Bhutan, Bosnia and Herzegovina, Botswana, Brazil, Brunei Darussalam, Burkina Faso, Burundi, Cabo Verde, Cambodia, Cameroon, Chad, China, Colombia, Comoros, Congo, Côte d'Ivoire, Cuba, Czech Republic, Democratic Republic of the Congo, Denmark, Democratic People's Republic of Korea, Dominica, Dominican Egypt, El Salvador, Equatorial Guinea, Eritrea, Estonia, Ethiopia, European Union, Finland, France, Gambia, Georgia, Germany, Greece, Grenada, Guatemala, Guinea, Guinea Bissau, Guyana, Hungary, India, Iraq, Ireland, Italy, Japan, Jordan, Kyrgyzstan, Lao People's Democratic Republic, Lebanon, Liechtenstein, Madagascar, Malawi, Malaysia, Maldives, Mali, Malta, Mauritania, Mexico, Mongolia, Morocco, Mozambique, Myanmar, Namibia, Nauru, Nepal, Netherlands, New Zealand, Nicaragua, Niger, Nigeria, Niue, Norway, Peru, Philippines, Poland, Qatar, Republic of Korea, Republic of Moldova, Russian Federation, Saint Kitts and Nevis, Samoa, Senegal, Serbia, Seychelles, Slovakia, Solomon Islands, Somalia, South Africa, Spain, Sri Lanka, Sudan, Suriname, Sweden, Switzerland, Tajikistan, Timor-Leste, Togo, Tuvalu, Uganda, Ukraine, United Kingdom of Great Britain and Northern Ireland, United Republic of Tanzania, Uruguay, Venezuela, Vietnam, Zambia and Zimbabwe."},{"index":2,"size":371,"text":"2 Updated Compilation of Draft Decisions for the Thirteenth Meeting of the Conference of the Parties to the Convention on Biological Diversity: Annex, Generic and Specific Indicators for Assessing Progress in the Attainment of the Aichi Biodiversity Targets, Including an Assessment of Their Main Characteristics, Doc. UNEP/CBD/COP/13/2/Rev.1 (25 October 2016), which establishes indicators in relation to agricultural biological diversity related to the Aichi Biodiversity Targets. Regarding the attainment of Aichi Biodiversity Target 7 on sustainable agriculture, the indicators are: on areas of agricultural land under organic production, on areas of agricultural land under conservation agriculture; on the proportion of agricultural area under productive and sustainable agriculture (indicator for SDG Target 2.4) and on the Wild Bird Index for farmland birds / Living Planet Index (farmland specialists). For Aichi Biodiversity Target 13 on the conservation of genetic resources for food and agriculture, the following indicators are established: the number of plant and animal genetic resources for food and agriculture secured in either medium-or long-term conservation facilities (indicator for SDG Target 2.5); the number of plant genetic resource for food and agriculture surveyed/inventoried; the percentage of plant genetic resources for food and agriculture threatened out of those surveyed/inventoried; the number of standard material transfer agreements, as communicated to the Governing Body of the International Treaty on Plant Genetic Resources for Food and Agriculture; the proportion of local breeds classified as being at risk, not-at-risk or unknown level of risk of extinction (indicator for SDG Target 2.5); the Red List Index (wild relatives); the Species Habitat Index (wild relatives); the Species Protection Index (wild relatives) and the level of implementation of global plan of actions on genetic resources for food and agriculture. 4 Eritrea, Georgia, Nepal, Sudan, Philippines, China, Morocco, Peru, Hungary, Sri Lanka, Italy, Uganda, Vietnam, Malaysia, Jordan and Venezuela are the countries that included more comprehensive commitments pertaining to Aichi Target 13 (in this order). Those countries providing a lower level of detail included Bangladesh, Bosnia and Herzegovina, Brazil, Burkina Faso, Cambodia, Comoros, Cote d´Ivoire, Cuba, Ethiopia, Finland, Greece, Japan, Kyrgyzstan, Lebanon, Malawi, Mexico, Myanmar, Nauru, Nicaragua, Poland, Republic of Korea and Serbia. These countries also included specific actions pertaining to the conservation and use of genetic resources for food and agriculture."},{"index":3,"size":39,"text":"5 Commission to the European Parliament, the Council, the Economic and Social Committee and the Committee of the Regions, Our Life Insurance, Our Natural Capital: An EU Biodiversity Strategy to 2020, Doc. COM(2011)244, http://ec.europa.eu/environment/nature/biodiversity/strate gy/index_en.htm#stra (accessed 27 November 2016)."},{"index":4,"size":25,"text":"6 China, Georgia, Greece, Hungary, Mexico, Republic of Korea, Sudan and Uganda are the countries that included more specific chapters dedicated to ex situ conservation."},{"index":5,"size":94,"text":"7 China, Georgia, Japan are the countries that have developed more in detail GRFA in situ conservation. 8 Hungary, Italy, Malaysia, Morocco, Myanmar, Nepal, Nicaragua, Sudan, Peru, Philippines and Venezuela are among the countries that have developed more in detail GRFA on-farm conservation.  vember 2016). In some cases, NBSAPs have neither complemented nor incorporated the advances made at the regional level in this regard. For example, Bioversity International, Strategic Action Plan to Strengthen Conservation and Use of Mesoamerican Plant Genetic Resources in Adapting Agriculture to Climate Change 2014-2024 (2014), http://www.planttreaty.org/content/strategicaction-plan-strengthen-conservation-and-usemesoamerican-plant-genetic-resources-a (accessed 27 November 2016)."}]},{"head":"13","index":5,"paragraphs":[{"index":1,"size":158,"text":"Despite the 2016 FAO Commission on Genetic Resources for Food and Agriculture's Voluntary Guidelines for Mainstreaming Biodiversity into Policies, Programmes and National and Regional Plans of Action on Nutrition and despite the previous Convention on Biological Diversity's Programme of Work on Agricultural Biological Diversity, which was endorsed by the fifth Conference of the Parties' Decision V/5, which included the Cross-cutting Initiative on Biodiversity for Food and Nutrition and incorporated as a proposal for action the mainstreaming of the conservation and sustainable use of biodiversity into agendas and programs related to nutrition and agriculture and poverty reduction, in particular, its integration into programs concerning food-based dietary guidelines, a food composition analysis and dietary assessments, relevant regulatory frameworks and legislation at the national and international levels, national plans of action for nutrition, national poverty reduction strategy papers, the right to food, food security projects and programs (household food security projects, school programs, home gardens) and emergency response and preparedness programs."}]}],"figures":[{"text":" Establish a national benefit-sharing fund to support to ex situ conservation projects  Promote private-public sector cooperation to maintain collections  Forge linkages between national gene banks and community seed or gene banks  Ensure that genetic material is provided expeditiously to indigenous peoples, traditional communities and family farmers Regarding the in situ conservation of GRFA, most NBSAPs include activities within protected areas focussing primarily on crop wild relatives. The Philippines NBSAP includes the declaration of sites for nationally important agricultural heritage systems. Other countries have plans to declare in situ conservation sites and to elaborate management plans for prioritized crops and their wild relatives. A few NBSAPs explicitly state these areas should be managed by indigenous peoples or local governments. "},{"text":" Compilation of Draft Decisions for the Thirteenth Meeting of the Conference of the Parties to the Convention on Biological Diversity, Doc. UNEP/CBD/COP/13/2/Rev.1, under the Agenda's Item 10: Strategic Actions to Enhance the Implementation of the Strategic Plan for Biodiversity 2011-2020 and the Achievement of the Aichi Biodiversity Targets, including with Respect to Mainstreaming and the Integration of Biodiversity within and across Sectors and under Item 13: Cooperation with Other Conventions and International Organizations. "},{"text":"  "},{"text":"  "},{"text":"agrobiodiversity conservation. Nineteen per cent of the NBSAPs mention plans to survey and inventory species. Most countries address the conservation of GRFA through ex situ 6 and in situ 7 measures. Only a few    Regarding ex situ conservation the NBSAPs include Regarding ex situ conservation the NBSAPs include   the following measures: the following measures:    New or improved facilities for ex situ conservation  New or improved facilities for ex situ conservation   should be enhanced for plants, animals, should be enhanced for plants, animals,   microorganisms microorganisms    Creation of a national genetic resources institute;  Creation of a national genetic resources institute;    Development of information systems, including bar  Development of information systems, including bar   code systems code systems    Support the creation or maintenance of regional  Support the creation or maintenance of regional   gene banks; continued support for the Svalbard gene banks; continued support for the Svalbard   Global Seed Vault Global Seed Vault    Collection of landraces and crop wild relatives in  Collection of landraces and crop wild relatives in   national collections national collections    Reintroduction and repatriation of conserved  Reintroduction and repatriation of conserved   materials materials    Development of registers and databases of local plant  Development of registers and databases of local plant   varieties and animal breeds, including through varieties and animal breeds, including through   participatory processes. participatory processes. Nepal, Sudan and Philippines revised their NBSAPs to include specific chapters dedicated to agrobiodiversity conservation. Most European countries followed the  Characterization of landraces and their use in breeding programs Nepal, Sudan and Philippines revised their NBSAPs to include specific chapters dedicated to agrobiodiversity conservation. Most European countries followed the Characterization of landraces and their use in breeding programs European Union Biodiversity Strategy to 2020. 5 Five of  Molecular research to identify and use beneficial European Union Biodiversity Strategy to 2020. 5 Five of Molecular research to identify and use beneficial the 19 European countries' NBSAPs include specific genes of wild relatives and traditional varieties; the 19 European countries' NBSAPs include specificgenes of wild relatives and traditional varieties; targets and actions on Aichi Biodiversity Target 13. develop systems for identifying the locations of genes targets and actions on Aichi Biodiversity Target 13.develop systems for identifying the locations of genes As highlighted in figure 1 below, the NBSAPs focus mainly on plant genetic resources for food and agriculture, followed by animal genetic resources. on genetic maps and analyzing the properties of genes; molecular level characterization of native breeds of livestock As highlighted in figure 1 below, the NBSAPs focus mainly on plant genetic resources for food and agriculture, followed by animal genetic resources.on genetic maps and analyzing the properties of genes; molecular level characterization of native breeds of livestock Twenty-seven per cent of NBSAPs include actions for the Twenty-seven per cent of NBSAPs include actions for the preservation of farmers' associated traditional knowledge, preservation of farmers' associated traditional knowledge, innovations and practices. Twenty-two per cent of innovations and practices. Twenty-two per cent of NBSAPs mention habitat and ecosystem conservation as NBSAPs mention habitat and ecosystem conservation as necessary measures for NBSAPs include plans for on-farm conservation necessary measures for NBSAPs include plans for on-farm conservation activities 8 . activities8 . Figure 1. Biota included in scope of NBSAPs concerning Figure 1. Biota included in scope of NBSAPs concerning conservation conservation  "},{"text":" for seed saver networks and community/village seed banks; enhancement of genetic diversity through the production, multiplication and diffusion of traditional varieties; increasing the distribution of seed of landraces; support of community networks in the use and exchange of local seeds; use of registers for custodian farmers; documentation of associated traditional farmers; documentation of associated traditional knowledge; enhancement and encouragement of the knowledge; enhancement and encouragement of the farmers as biodiversity actors; development of collabora- farmers as biodiversity actors; development of collabora- tive research projects and participatory plant breeding; tive research projects and participatory plant breeding; economic incentives for farmers to preserve native spe- economic incentives for farmers to preserve native spe- cies or breeds; creation of value chains and markets for cies or breeds; creation of value chains and markets for biodiverse products, and documentation of farmers' ac- biodiverse products, and documentation of farmers' ac- tions to conserve PGRFA.  tions to conserve PGRFA. Few NBSAPs include plans to integrate in situ and ex situ Few NBSAPs include plans to integrate in situ and ex situ conservation measures. Serbia includes the establish- conservation measures. Serbia includes the establish- ment of on-farm conservation centres and their integration ment of on-farm conservation centres and their integration and coordination with national gene banks. Japan pro- and coordination with national gene banks. Japan pro- motes the creation of networks for GRFA in situ conserva- motes the creation of networks for GRFA in situ conserva- tion that includes the establishment of systematic back-up tion that includes the establishment of systematic back-up systems. Kyrgyzstan includes coordination among on- systems. Kyrgyzstan includes coordination among on- farm and nursery gardens for the conservation of agrobi- farm and nursery gardens for the conservation of agrobi- odiversity.  odiversity. Mainstreaming GRFA in sustainable Mainstreaming GRFA in sustainable agriculture and across sectors (Aichi agriculture and across sectors (Aichi Biodiversity Target 7) Biodiversity Target 7) Approximately 31 per cent of NBSAPs include the Approximately 31 per cent of NBSAPs include the diversification of crops and livestock as a component of diversification of crops and livestock as a component of sustainable agriculture. NBSAPs consider sustainable agriculture. NBSAPs consider agrobiodiversity mainstreaming mainly through agrarian agrobiodiversity mainstreaming mainly through agrarian policies, legislation and creation of new institutional policies, legislation and creation of new institutional arrangements. Some European Union countries report on arrangements. Some European Union countries report on using agrarian subsidies to promote crop diversification using agrarian subsidies to promote crop diversification or favour areas with a traditional mosaic-patterned or favour areas with a traditional mosaic-patterned farming in the framework of the 'greening program' of the farming in the framework of the 'greening program' of the Common Agriculture Policy 9 Common Agriculture Policy9  "},{"text":"9 Articles 43 and 44 and Annex IX of the EU Regulation 1307/2013 establishing rules for direct payments to farm-ers under support schemes within the framework of the common agricultural policy and repealing Council Regulation (EC) No 637/2008 and Council Regulation (EC) No 73/2009, OJ L347 (20 December 2013). 10 Armenia, Eritrea, Greece, Nepal and Uganda. This is perhaps most clearly reflected at the intergovernmental level by the adoption by UN Food and Agriculture Organization (FAO) Commission on Genetic Resources for Food and Agriculture, in April 2013, of a Programme of Work on Climate Change and Genetic Resources for Food and Agriculture and by the endorsement in 2014 of 'voluntary guidelines to support the integration of genetic diversity into national climate change adaptation planning.' See http://www.fao.org/documents/card/en/c/290cd085-98f3-43df-99a9-250cec270867/ (accessed 27 November 2016). In this regard, the NBSAPs have not linked to international processes in the matter as reflected in FAO, Lessons Learned about Ways and Means to Conserve and Use Genetic Diversity to Build Resilience to Climate Change in Food and Agriculture Systems -Survey Report, Doc. CGRFA-15/15/Inf.16 (2015), http://www.fao.org/3/a-mm501e.pdf (accessed 27 No-  "}],"sieverID":"0ded1ad1-dac8-4a1b-ae10-77bb364e0fdd","abstract":"While most of the 119 reviewed NBSAPs make general reference to Aichi Biodiversity Targets 7 and 13, only 30 per cent actually include details of concrete actions for agrobiodiversity conservation and sustainable use. Very few of the reviewed NBSAPs include explicit plans to use genetic resources for food and agriculture (GRFA), for climate change adaptation or for diversified diets and improved nutrition. Furthermore, very few NBSAPs include plans for the implementation of the International Treaty on Plant Genetic Resources (ITPGRFA) which provides a framework for the conservation and sustainable use of plant genetic diversity, for accessing plant genetic resources and equitably sharing benefits associated with their use. The authors urge the COP to recommend that Parties consider, in future NBSAPs, how agricultural biological diversity can be mainstreamed in their climate change adaption, and food security and nutrition action plans."}

data/part_2/07fe3102201f572f9cc50b14f542e697.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07fe3102201f572f9cc50b14f542e697","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8a719be5-2c72-4735-99b2-d460b5517e99/retrieve"},"pageCount":49,"title":"Cuadro 3. Metas de bienestar definidas por las familias rurales de","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":151,"text":"Figura 1. Evolución del área en cultivos Figura 2. Curvas de adopción de frejol Figura 3. Consumo de frejol en el sector urbano y rural de Santa Cruz Figura 4. Distribución de la producción de frejol según destino Figura 5. Estructura del costo de producción de frejol Figura 6. Impacto de cambios en rendimiento de frejol sobre el ingreso del agricultor Figura 7. Cambios en el consumo de frejol Figura 8. Cambios en el consumo de frejol en el ~ector urbano Figura 9. Cambios en el consumo de frejol en el sector rural Figura 10. Indicadores de bienestar Figura 11. Metas y logros en bienestar: San Julián Figura 12. Metas y logros en bienestar: Colonia Berlín Figura 13. Composición de los indicadores de bienestar para el área rural de Santa Cruz Figura 14. Metas de bienestar: porcentaje de cumplimiento Figura 15. Logros en bienestar va. años produciendo frejoI común v I"}]},{"head":"Prefacio","index":2,"paragraphs":[{"index":1,"size":239,"text":"En noviembre de 1979 el entonces Programa de Frijol del CIAT despachó a solicitud de la Universidad Autónoma Gabriel René Moreno (UAGRM) un paquete de 10 kg conteniendo 50 líneas y variedades de frijol que por entonces se ensayaban en el Vivero Internacional de Adaptación y Rendimiento de Frijol (IBYAN) del CIAT. Ese lote de frijol fue el comienzo de un tra~o de investigación con un cultivo nuevo. Fue también el comienzo de una conjunción de esfuerzos de muchas instituciones y personas de Santa Cruz, cada una asumiendo un compromiso y ofreciendo su experiencia y habilidad. No es fácil participar en forma armoniosa en una empresa y menos lo es cuando ésta ofrece más riesgos que oportunidades. La incertidumbre puede ser un elemento que desaliente a muchos pero nunca es un freno para los soñadores o los intrépidos que saben lo que quieren y tienen el valor de emprender la aventura de hacer realidad lo que parece una quimera. Ciertamente empezar un trab~o con frijol en Bolivia fue una aventura pero tanto las instituciones agrícolas de Santa Cruz, lideradas por la UAGRM como los pobladores del Altiplano, la mayoría mineros, que un día partieron para los montes del Oriente ilusionados con la política de colonización del gobierno o simplemente aprovechando la penetración caminera, decidieron embarcarse en esta aventura que felizmente arribó a buen puerto como lo prueban los resultados que muestra este estudio llevado a cabo por el CIAT."},{"index":2,"size":27,"text":"Veamos algunos ejemplos, recogidos en este trab~o, de 10 que ha pasado con el frijol 20 años después de su introducción en el departamento de Santa Cruz."},{"index":3,"size":26,"text":"o Antes de 1979 en el departamento de Santa Cruz no se sembraba frijol; en 1999 el área sembrada está cercana a las 20 mil hectáreas."},{"index":4,"size":21,"text":"• Bolivia ahora exporta frijol a siete países. En 1997 las exportaciones alcanzaron un valor de casi 9 millones de d6lares."},{"index":5,"size":21,"text":"o Gracias al frijol los campesinos entraron a la economia del mercado: el 61% del total de frijol producido se exporta."},{"index":6,"size":52,"text":"• El frijol creó nuevas fuentes de trabajo. Se estima que entre 450 a 500 mil jornales directos por año derivan de la actividad frijolera. o El frijol generó una fuente de trabajo importante para el agricultor y su familia: el 58% de los jornales utilizados son aportados por la familia campesina."},{"index":7,"size":22,"text":"• El 50% de los jornales se emplean en labores de cosecha y el ama de casa aporta la mitad de ellos."},{"index":8,"size":43,"text":"o El frijol se convirtió en la mejor opción de cultivo de invierno para los colonos de escasos recursos ocupando el 86% del área cultivada en invierno en las zonas de colonización, la mayor área comercial de producción de frijol en Santa Cruz."},{"index":9,"size":20,"text":"o Gracias al frijol se redujo sustancialmente la necesidad de emigrar a otras regiones en invierno en busca de trabajo."},{"index":10,"size":24,"text":"o En Santa Cruz no se consumÚl frijol. En 1999 se estima que el consumo alcanza el orden de 9 mil toneladas por año."},{"index":11,"size":41,"text":"o El consumo per cápital año en la poblaci6n rural de Santa Cruz es de 23.5 kg, mayor que el promedio del Brasil. El consumo en el sector urbano es de 6 kg per cápital año, mayor que el de Colombia."},{"index":12,"size":38,"text":"o En el sector rural el frijol aporta una tercera parte de los requerimientos diarios de protetna. En el sector urbano los consumidores más pobres de la poblaCión suplen con frijol un 17% de los requerimientos proteicos diarios."},{"index":13,"size":21,"text":"o El frijol contribuyó al bienestar de las familias rurales ayudándolas a mejorar su caUdad de vida e infraestructura de trabajo."},{"index":14,"size":160,"text":"Lo sucedido con el frijol en Santa Cruz, Bolivia es un modelo de lo que la tecnología y la capacitación, la oferta de CIAT, puede hacer cuando hay participación de otros protagonistas aportando sus talentos y especialidades. La intervención de COSUDE a través de su apoYo financiero y de su proyecto PROFRIZA como el elemento amalgamador de todos estos esfuerzos fue factor decisivo para este acontecimiento que en última instancia tiene como protagonista. principal al colono del Oriente boliviano que tuvo fe en los sueños ajenos. En 1988 el CIAT crea el Proyecto Regional de Frijol para la Zona Andina (PROFRIZA) financiado por la Agencia Suiza para el Desarrollo y la Cooperación (COSUDE). En este mismo año la Asociación Menonita de Desarrollo Económico (MEDA) emprendió en Bolivia la tarea de incentivar asociaciones de productores con el propósito de reducir la vulnerabilidad frente a las fuerzas del mercado. Así nace en Santa Cruz la Asociación Nacional de Productores de Frejol ASOPROF."},{"index":15,"size":44,"text":"El objetivo de introducir el freiol en Santa Cruz fue el de involucrar a Bolivia en la producci6n de un alimento que contribuyera a mejorar los estándares nutricionales de los consumidores y proporcionar al agricultor nuevas opciones de ingreso y de uso del suelo."},{"index":16,"size":143,"text":"Los agricultores a los cuales se enfocó el trab8jo de frejol fueron básicamente aquellos localizados en las áreas de penetración de la selva amazónica, quienes habían emigrado desde el altiplano boliviano hacia la llanura de Santa Cruz buscando oportunidades para su subsistencia. A la fecha se estima un asentamiento de cerca de ocho mil familias emigrantes, con 50 mil personas quienes ocupan unas 300 mil hectáreas de selva. Después de 20 años de iniciada las acciones para introducir el cultivo de frejol en Bolivia, 105 integrantes del Proyecto (PROFRIZA y la UAGRM) contratan un estudio de evaluación de adopción e impacto. La evaluacion busca definir la situación de la producci6n y de los productores antes y después de la introducción del frejol, así como el impacto en el consumo doméstico, en el mercado de exporteción y en algunos indicadores macroecónomicos de la región."}]},{"head":"Marco de Referencia","index":3,"paragraphs":[{"index":1,"size":136,"text":"En la actualidad la llanura de Santa Cruz dispone de 1.2 millones de hectáreas en cultivos de tipo agroindustrial -caña de azúcar, sorgo, soya, algodón, maíz, trigo, eOO.-los cuales muestran una dinámica de expansion alta (Figura 1). En la última década el área agrícola de Santa Cruz se incrementó en 375 por ciento a expensas de la selva. Los cultivos agroindustriales son explotados básicamente por grandes agricultores o empresas. Según un estudio del Centro de Investigación y Manejo de Recursos Naturales Renovables de Bolivia, el 90 por ciento de la tierra en producci6n es explotada por grandes agrícultores que s610 representan el 5 por ciento de los cultivadores. Dentro de este contexto el frejol ocupa sólo un 1.5 por ciento del área pero involucra a gran número de pequeños agricultores situados en las zonas de penetración. "}]},{"head":"Metodología","index":4,"paragraphs":[{"index":1,"size":35,"text":"Se deflnen varios niveles de estudio: producción, consumo urbano y rural y comercialización. A nivel regional se obtiene información secundaria para analizar la participación del frejol en la producción agrícola, su evolución y sus mercados."},{"index":2,"size":59,"text":"A nivel de los productores se captura infonnación primaria para analizar los cambios introducidos por el cultivo del ~ol en el uso de la tierra, de la mano de obra y otros recursos de la producción, así como también trata de identificar y evaluar el impacto en el bienestar de las familias de los agrícultores involucrados en el cultivo."},{"index":3,"size":29,"text":"A nivel de los consumidores se captura información primaria para analizar la incorporación del frejol a la dieta alimenticia y su importancia relativa en la iugasta calórica y proteica."},{"index":4,"size":18,"text":"En el Cuadro 1 se muestran las fuentes consultadas o encuestadas y el tamaño de la muestra manejada."}]},{"head":"Resultados","index":5,"paragraphs":[{"index":1,"size":51,"text":"Una buena parte de la información obtenida para este estudio fue recolectada por tres estudiantes de la UAGRM quienes realizan SUB tesis de grado, todas referentes al frejol en el departamento de Santa Cruz, Bolivia en los siguientes temas: al El comercio y la demanda. b) La producción y sus limitantes."},{"index":2,"size":12,"text":"cl El consumo urbano y rural de frejol, sus perspectivas y retos."},{"index":3,"size":26,"text":"En los informes de tesis se incluirá la información detallada obtenida en las encuestas realizadas a los productores, amas de casa y comerciantes de la región."},{"index":4,"size":63,"text":"En este documento se presenta sólo un resúmen de los resultados obtenidos y se enfatiza en el análisis del impacto del frejol en los diferentes niveles de la economía regional así como en el bienestar de las familias campesinas involucradas en el proceso.  En los casos en que lo requiera el análisis, se consigna información detallada en los cuadros anexos a este documento."},{"index":5,"size":13,"text":"Esta sección se presenta agrupada en cinco temas: Nivel de adopción de frejo!."},{"index":6,"size":4,"text":"Impacto sobre la región."},{"index":7,"size":7,"text":"Impacto sobre la producción y los productores."},{"index":8,"size":4,"text":"-Impacto sobre el consumo."},{"index":9,"size":4,"text":"-Impacto sobre el bienestar."}]},{"head":"Nivel de ado~ión del frejol","index":6,"paragraphs":[{"index":1,"size":52,"text":"Dado que uno de los objetivos de la introducción del frejol en Bolivia fue el mejoramiento de los estándares nutricionales en la región, la adopción se cuantifica tanto en términos de agricultores que incorporaron el frejol como alternativa de cultivo como en términos de consumidores que lo integraron a su dieta alimenticia."},{"index":2,"size":60,"text":"Del lado de la producción se estudiaron las áreas de San Julián y Colonia Berlín, dos de las zonas más importantes en asentamiento de colonizadores emigrantes del Altiplano boliviano. Del lado del consumo se estudió la ciudad de Santa Cruz de la Sierra, principal centro metropolitano de la región y la población rural de las áreas de producción de frejo!."},{"index":3,"size":55,"text":"Las curvas de adopción del !rejol como cultivo muestran un proceso lento en los primeros afios, el cual se intensifica hacia 1990 a 1991. Allí permanece estable hasta 1994, afio a partir del cual la adopción se acelera llegando a un alto nivel de adopción con un 90 por ciento de agricultores cultivándolo (Fignra 2)."},{"index":4,"size":46,"text":"El proceso de adopción es muy estable y se evidencia en el hecho de que un 70 por ciento de los agricultores lleva más de 5 afios cultivando frejol y que el área ha venido creciendo hasta llegar a un promedio de 8 hectáreas por finca."},{"index":5,"size":55,"text":"Del lado de consumo, la adopción del frejol como producto alimenticio es del 50 por ciento en familias del sector urbano y del 75 por ciento en el sector rural de la zona de colonización (Figura 3). Año d. entrado a la producción de !Njol Figura 2. Curvas de adopción de !Njol, Santa CI11<, Bolivia. "}]},{"head":"Porcentaje de Familjas","index":7,"paragraphs":[]},{"head":"Impacto sobre la región","index":8,"paragraphs":[{"index":1,"size":36,"text":"La superficie en frejol se estima para 1998 en cerca de 23 mil hectáreas, con base en los datos de consumo doméstico y exportaciones. El volúmen de produeelón se estima en cerca de 25 mil toneladas."},{"index":2,"size":12,"text":"La presencia del fr'liol en la región ha tenido las siguientes implicaciones:"},{"index":3,"size":31,"text":"al Creó una nueva fuente de divisas para el país. En 1997 las exportaciones alcanzaron un valor de 8.8 millones de dólares y representaron el 61 por ciento del frejol producido."},{"index":4,"size":60,"text":"b) Paralelo a la exportaci6n se generó un consumo doméstico del orden de 9000 toneladas! año que equivalen a un S4 por ciento de la producción (Figura 4 ). e) El consumo doméstico generado ha permitido ubicar los excedentes de exportación, con beneficio para los productores y exportadores al reducir la inestabilidad en los precios que crea un mercado único."},{"index":5,"size":30,"text":"dJ M~oro eficiencia en el uso de la tierra incorporando a la producei6n la estacion de invierno, época para la cual no existían opciones de cultivo para los agricultores pequeños."},{"index":6,"size":27,"text":"e) Amplió la frontera agrícola para el pequeño agricultor sin condicionarla a la tala del bosque como ha sucedido con los otros cultivos introducidos a la región."},{"index":7,"size":48,"text":"f) Creó fuentes de trabajo importantes. Se estima con base en los datos de la encuesta que el frejo! requiere unos 30 jornales por hectárea y que en total la actividad de producir frejol genero entre 450 mil a 500 mil jornales directos por año (ver cuadros anexos)."},{"index":8,"size":76,"text":"Impacto de la A.clopción de Frejol ... g) Como efecto colateral a la actividad económica el !rejol promovi6 a los pequefios agricultores de las áreas de penetración de selva hacia una agricultura comercial, al aglutinarlos alrededor de ASOPROF (Asociación Nacional de Productores de Frejol), entidad que viene ejecutando funciones de mercadeo interno y externo de insumos y productos y realizando alianzas estratégicas con la Universidad y el sector privado para financiar investigación técnica para el cultivo."},{"index":9,"size":17,"text":"h) En 1997 ASOPROF participó con e116 por ciento del valor total de las exportaciones de !rejo!."},{"index":10,"size":52,"text":"i) El frejol redujO los costos de producción de los cultivos de verano al bloquear las malezas que proliferaban durante la estaeión invernal. Se estima que el gasto anual en control de malezas para los cultivos de verano se redujo en 1.6 millones de dólares desde que el frejol entró como rotación."}]},{"head":"Impacto sobre la producción y los productores","index":9,"paragraphs":[{"index":1,"size":25,"text":"La tecnología puede tener efectos positivos en la productividad y en la producción y no traducirse en bienestar de los agricultores involucrados en su adopción."},{"index":2,"size":53,"text":"Uno de los efectos negativos de la tecnología se da cuando el precio del producto baja como consecuencia de los incrementos en la oferta resultantes de la innovación tecnológica. En el caso del frejol, por su característica de producto foráneo sin un mercado doméstico, no se enfrentaron problemas de precio como el referido."},{"index":3,"size":29,"text":"Situaciones de competencia por recursos productivos con otros cultivos no se dieron al cultivar frejol, por que esta actividad se desarrolla en una época marginal para los cultivos tradicionales."},{"index":4,"size":17,"text":"Por estas razones, muchos de los impactos valorados son absolutos y no hacen relación con situaciones predichas."},{"index":5,"size":53,"text":"A continuación se describen las innovaciones y cambios introducidos por el frejol: a) Con base en los datos de la encuesta se estima que en el área de producción comercial de frejol (Provincia Ñuflo de Chavez), un 63 por ciento de jefes de hogar están vinculados al &ejol como agricultores o como jornaleros."},{"index":6,"size":65,"text":"b) La mano de obra representa el 50 por ciento del costo de producción de frejol (Figura 5). el Los pequeños agricultores han encontrado en el (rejol una opción de cultivo para el invierno: un 86 por ciento del área cultivada en esta estación lo es con frejol. Antes de su introducción s610 un 8 por ciento del área cultivable era explotada en el invierno."},{"index":7,"size":41,"text":"d) El frejol redujo sustancialmente la necesidad de emigrar a otras regiones para obtener trabajo en el invierno con evidentes beneficios para la estabilidad familiar y laboral. Un 90 por ciento de los entrevistados ya no emigran en busca de trabajo."},{"index":8,"size":93,"text":"e) El ingreso por (rejol representa un 43 por ciento del ingreso total de los agricultores entrevistados. Este nuevo ingreso debe compararse con el obtenido al emigrar por trabajo, deducidos los costos inherentes a ese desplazamiento. Este ejercicio demanda conocer las condiciones de trabajo en que viajaba el agricultor tales como tarifas, seguridad en la contratación y condiciones de trabajo e implicaciones familiares. No se dispone de dicha información pero es claro que el balance a favor del frajol es bueno, como lo evidencia la baja migración por trabajo que se da actualmente."},{"index":9,"size":42,"text":"1) El (rejol genero una fuente de trabajo importante para el agricultor y su familia: el 58 por ciento de los jornalee utilizados en la explotación son propios, es decir, aportados por la familia campesina lo cual representa cerca de 222.500 jornales/ai'io."},{"index":10,"size":50,"text":"g) El frejol incorporó al ama de casa rural en la actividad de producción. El 50 por ciento de los jornales empleados en el cultivo son debidos a lmpucto <k la Mopci4n de Frejol ... las labores de cosecha y el ama de casa campesina aporta la mitad de ellos."},{"index":11,"size":41,"text":"h) El suministro de alimentos en la jornada laboral, es un pago en especie. La preparación de los alimentos para los jornaleros es realizada por el ama de casa. Este costo no monetario es aportado por el ama de casa campesina."},{"index":12,"size":108,"text":"i) El componente de la mano de obra familiar, que representa un 30 por ciento del costo de producción del frejol, reduce la inversión monetaria en el cultivo y permite al agricultor una protección ante el riesgo de pérdidas monetarias frente a los cambios de precio y de rendimiento. j) Se estima que aún en condiciones de bajo rendimiento, 15 quintalesl ha que equivalen a 750 kilogramoslha, situación en la cual el ingreso neto del agricultor promedio de 8 hectáreas sería negativo, la producción de frejolle significa un ingreso monetario de 549 dólares en la cosecha como consecuencia de vender su mano de obra al cultivo (Figura 6)."},{"index":13,"size":87,"text":"k) El frejol enfrentó a los pequeños agricultores de la región al mereado sacándolos de una producción de subsistencia. El 92 por ciento del total producido va al mercado y un 61 por ciento se exporta.  bl Los habitantes más pobres, urbanos y rurales, se beneficiaron con la introducción del &ejol a Santa Cruz: el 65 por ciento del fn\\jol destinado al mercado doméstico es consumido por los habitantes de los estratos 1 y II en la ciudad y del sector rural en el área de colonización."},{"index":14,"size":82,"text":"el La cobertura más amplia en adopción se dió entre la población más pobre: el 84 por ciento de las familias de los estratos 1 y II consumen fn\\joL dl Se observa que el fn\\jol se ha establecido como una opción en la alimentación de la región. El 82 por ciento de los consumidores lleva más de tres años incorporándolo a su dieta. e) En los estratos bajos de la población urbana el consumo de &ejol alcanza los 14 kg per cápitalaño."},{"index":15,"size":61,"text":"d) Observando en forma desagregada la población que adoptó el nuevo alimento se encuentra que el fr~ol ha sido ampliamente acogido: las cantidades promedias para la población consumidora son del orden de los 31 y 12 kilogramos per eápitalaño en el sector rural y urbano respectivamente, cifras altas aún para países tradicionales en el consumo de fn\\jol como Brasil y México."}]},{"head":"Importancia relativa en la ingesta nutricional","index":10,"paragraphs":[{"index":1,"size":53,"text":"Dado el alto contenido de proteínas del frejol (20 a 22 gramos de proteína por cada 100 gramos de semilla), su incorporación a la canasta familiar ha conllevado efectos positivos en la ingesta nutricional: a) En el sector rural el frajol aporta una tercera parte de los requerimientos diarios de proteína (Cuadro 2)."},{"index":2,"size":25,"text":"b) En el sector urbano los consumidores más pobres de la poblaci6n suplen con el frejol un 17 por ciento de los requerimientos protéicos diarios."},{"index":3,"size":47,"text":"I ... Santa. Cruz, Bolivia e) Para una población joven como la de Santa Cruz, donde más de la mitad de 108 habitantes son menores de lS años, los beneficios de una mejora en la ingesta protéica son obvios (ver composición de la población en cuadros Anexos)."},{"index":4,"size":31,"text":"Cambios ocurridos en el consumo de frejol y de otros alimentos a) El consumo de frejol en Santa Cruz ha venido creciendo desde su introducción en los años SOs (Figura 7)."},{"index":5,"size":23,"text":"para 1992 se encontró que el consumo había alcanzado los 4 y 6 kilogramos per cápita/año en el sector urbano y rural respectivamente."},{"index":6,"size":20,"text":"para 1999 el crecimiento en el consumo rural se cuadruplicó y el urbano se incrementó en un 50 por ciento."},{"index":7,"size":26,"text":"b) El erecimiento en el consumo de frejol no ha significado cambios sustanciales para el otro ftejol consumido, el Camba, Vigna unguiculata (Figuras 8 y 9)."},{"index":8,"size":46,"text":"el El consumo inicial en el departamento de Santa Cruz, anterior a 1988 se estima en cerca de a kilogramos par eápita/año, referido únicamente a frejol Camba. f) En el sector urbano se observan decrecimientos en el consumo de algunos alimentos desde la. entrada del trejo!."},{"index":9,"size":26,"text":"g) Los alimentos identificados como sustitutivos del trejol en el sector urbano son lenteja., carne de res y los fideos de trigo. Como complementsrio el arroz."},{"index":10,"size":26,"text":"h) La disminución máB alta corresponde a la carne de res y la lenteja que disminuyeron en un 8 por ciento con respecto al consumo anterior."},{"index":11,"size":16,"text":"j) En el sector rural no se evidencian cambios significativos en el consumo de otros alimentos."}]},{"head":"Impacto sobre el bienestar de las familias rurales","index":11,"paragraphs":[{"index":1,"size":33,"text":"Para definir las variables o indicadores que se consideran determinantes del bienestar de las familias campesinas, se entrevistaron 90 amas de casa de las dos localidades rurales estudiadas: San Julián y Colonia Berlín."},{"index":2,"size":9,"text":"Las variables más frecuentemente mencionadas por las entrevistadas fueron:"},{"index":3,"size":10,"text":"obtener una educación para los hijos superior a los padres."},{"index":4,"size":5,"text":"obtener una alimentación máB nutritiva."},{"index":5,"size":9,"text":"disponer de un panel solar para obtener energía eléctrica."},{"index":6,"size":5,"text":"tener agua conducida por acueducto."},{"index":7,"size":13,"text":"tener una casa de material con techo de teja y no de palmas."},{"index":8,"size":9,"text":"tener la tierra descepada (libre de troncos de árboles)."},{"index":9,"size":6,"text":"no tener que emigrar por trabajo."},{"index":10,"size":7,"text":"tener un tractor para preparar la tierra."},{"index":11,"size":9,"text":"tener un camión para trillar y sacar la cosecha."},{"index":12,"size":9,"text":"disponer de una fumigadora para las labores de cultivo."},{"index":13,"size":37,"text":"Con base en la frecuencia se determinó un valor para cada variable que iba de cero a uno. El promedio de la suma de todas las variables constituyó la meta de bienestar para cada localidad (Cuadro 3)."},{"index":14,"size":31,"text":"Se encontró que hay similitudes en la definición de las variables que constituyen el bienestar en las dos comunidades estudiadas, sin embargo las expectativas son ligeramente inferiores para la Colonia Berlín."},{"index":15,"size":20,"text":"La Figura 10 ilustra las diferencias entre localidades y el peso relativo de los indicadores de bienestar. .86 Tener camión"}]},{"head":"AS .2S","index":12,"paragraphs":[{"index":1,"size":6,"text":"Valor meta de blenlllltar 9.4 8.8"},{"index":2,"size":46,"text":"Es evidente que hay una búsqueda de mElioras en varios aspectos de bienestar en las localidades estudiadas. Con excepción de la compra del camión y el tractor que tienen indicadores bajos y diferentes las demás variables tienen un peso alto y similar dentro y entra localidades."},{"index":3,"size":55,"text":"Un segundo paso en el análisis fue identificar los logros en bienestar obtenidos en los últimos cinco años por las personas o familias entrevistadas. El logro conseguido en cada familia y para cada variable, se enfrentó con la expectativa promedia de todas las familias de la localidad en dicha variable estableciendo un porcentaje de cumplimiento."},{"index":4,"size":33,"text":"Tres variables obtienen alta calificarión en consecución de logros y son las mismas en las dos localidades: mejorar la nutrición, no tener que emigrar en busca de trabajo y disponer de una fumigadora."},{"index":5,"size":62,"text":"Este último indicador, diponer de una fumigadora, está estrechamente ligado con la actividad de producir frejol ya que el cultivo exige el uso de fungicidas para la roya. Se observa que las dos comunidades trabajan en la búsqueda de soluciones para este problema lo que evidencia también la importancia del cultivo. En las Figuras 11 y 12 se consigna la información pertinente."}]},{"head":"Las búsquedas de bienestar se pueden clasiñcar en dos grupos:","index":13,"paragraphs":[{"index":1,"size":151,"text":"Mejoras en calidad de vida que incluye educación para los hijos mejor a la de los padres, mejoras en la nutrición de la familia, disponer de energía eléctrica con un panel solar, poseer acueducto, poseer una casa de material y no tener que emigrar en busca de trabajo (Figura 13).  \"'\"\"_~~'~f\"~~\"\"\"'~\"\"\"\"\"'\"\"\"\"\"'''-~~''''~_'_''''''' \"\"\"=~_~'.'~'<'~'''''''''\"\".'''',,, ''''~~'''''''''''''''r'r\",_-\"~-,.\"~.-\",~~\",,,,,,,,,,,,'''_\"\"''''''' _ _ '_''''~'' _~\"'\"\"\"\"\"\"\"\"'~'\"''''~''• __ ~_N,,,.,,,V''''''''_\"'.  Es claro que las búsquedas en calidad de vida son más numerosas y le dan mayor peso a este grupo de indicadores de bienestar, Es interesante anotar que los habitantes de estas localidades son casi todos propietarios ya que fueron beneficiados con la asignación de tierras en áreas de penetración de selva, Esto explica el porqué poseer una finca no es un indicativo de bienestar. La bÚSQueda para ellos es la mejora de la tierra que poseen, consistente en eliminar los troncos de los árboles que preceden la agricultura en la región."},{"index":2,"size":36,"text":"También la forma de suministro de agua es la búsqueda y no el agua misma, por que disponen de ésta desde hace muchos afios, extraída con bomba de pozos perforados a unos 90 metros de profundidad."},{"index":3,"size":101,"text":"Se encontró un buen porcentaje de búsquedas de bienestar satisfechas especialmente en calidad de vida y mayormente en San JuJián. En Colonia Berlín los logros en infraestructura de trabajo son menores pero importantes (Figura 14), Durante la entrevista con las amas de casa rurales se buscaron explicaciones para las mejoras en bienestar conseguidas, las cuales pueden resumirse así: al Los logros en nutrición se asocian eon el frejo! por la incorporsción de esta leguminosa en cantidades apreciables a su ingesta alimenticia a miz de las campañas de promoción del consumo que incluyeron formas de preparación e información sobre su calidad nutritiva."},{"index":4,"size":45,"text":"b) La notable reducción en la necesidad de emigrar en búsqueda de trab!\\io es una ganancia que obviamente está relacionada con e! cultivo del frejol que es prácticamente la única opción productiva para estos agricultores en el invierno, época en que se daba la migración."},{"index":5,"size":31,"text":"e) La posibilidad de acceder a infraestructura de producción (maquinaria, equipos y mejoramiento de! terrenol fue facilitada por la disponibilidad de mayor ingreso y mejor flujo de dinero para el agricultor."},{"index":6,"size":47,"text":"d) La posibíbilidad de dar educación a los hijos, mayor que la que ellos recibieron de sus padres se reportó por las amas de casa como una posibilidad muy remota antes de disponer del ingreso que da el frejol por los pagos periódicos que la educación demanda."},{"index":7,"size":26,"text":"e) Igualmente la adquisición del panel solar que implica una erogación mensual se hizo viable al disponer de una actividad en la primera mitad del año."},{"index":8,"size":59,"text":"Estas apreciaciones de las amas de casa son corroboradas con la información recogida con los agricultores de la región sobre el comportemiento económico del cultivo. La encuesta a los productores determin6 que el frejol aporta cerca de la mitad del ingreso del agricultor y genera un ingreso monetario importante en la estación marginal para la agricultura en la región."},{"index":9,"size":48,"text":"En la Figura 15 se puede observar la correlación que existe entre el índice de bienestar alcanzado para cada familia con los años que lleva produciéndose frejol, variable que está relacionada directamente con el área cultivada en frejoL  Figura ¡¡lo Logros en bienestar va. años produciendo trejal común."},{"index":10,"size":19,"text":"Con base en la información de las amas de casa se ajustó una función de bienestar del siguiente tipo:  "}]},{"head":"Resumen y Conclusiones","index":14,"paragraphs":[{"index":1,"size":16,"text":"Para concluir recordemos los objetivos definidos por qnienes trabajaron en la introducción del frejol a Bolivia:"},{"index":2,"size":44,"text":"\"El objetivo de introducir el {rejol en Santa Cruz fue el de involucrar a Bolivia en la producci6n de un alimento que contribuyera a mejorar los estándares nutricionales de los consumidores y proporcionara al agricultor nuevas opciones de ingreso y de uso del suelo'"},{"index":3,"size":8,"text":"Es claro que allí se involucraban varios propósitos:"},{"index":4,"size":13,"text":"• Inducir a la producción de un nuevo cultivo en una región dada"},{"index":5,"size":7,"text":"• Inducir a sus habitantes a consumirlo"},{"index":6,"size":9,"text":"• Ofrecer a los agricultores nuevas alternativas de producción"},{"index":7,"size":7,"text":"• Mejorar el ingreso de los agricultores."},{"index":8,"size":92,"text":"Estos objetivos se cumplieron ampliamente para la región y se haria largo y repetitivo retraer las cifras contenidas a lo largo de este trabajo, que además muestran efectos colaterales no contemplados en los oQjetivos predefinidos y que son importantes para la región y para el país como la generación de divisas, de fuentes de trabajo, de manejo de restricciones a la producción agrícola de verano, de mejoras en el bienestar de los productores, que si bien implícito en cualqnier esfuerzo de mejora en el ingreso de los productores, pocas veces tan significativo."},{"index":9,"size":29,"text":",,,Santa Crin, BoliJJm Más importante que resumir aquí el impacto del frejol parece el tratar de entender la razón del éxito alcanzado con el proyecto en Santa Cruz, Bolivia."},{"index":10,"size":47,"text":"Es conocido que muchas tecnologías buenas han enfrentado tropiezos insalvables al llegar a los usuarios, lo cual las descalifica como buenas y otras han sucumbido en el camino después de un éxito inicial y de aquí la necesidad de entender y analizar las razones de los logros."},{"index":11,"size":27,"text":"Avalar futuras entregas de tecnología es de interés para quienes trabajan en la investigación agrícola máxime cuando los fondos destinados a ella se han venido reduciendo drásticamente."},{"index":12,"size":23,"text":"Además la introducción del frejol CPhaseolus vulgarisl a Bolivia conllevaba quizás más condiciones para el fracaso que para el éxito: Se trataba de:"},{"index":13,"size":25,"text":"Un cultivo desconocido Un mercado doméstico no sólo nulo sino antagónico hacia el consumo de este alimento Un receptor de la tecnología muy sui generis:"},{"index":14,"size":137,"text":"el potencial receptor era un emigrante de una zona del altiplano boliviano con más vocación minera que agrícola un emigran te con la tendencia a conservar una organización social basada en la asociación sindical, sin norte real para su nueva actividad la agricultura en tierra propia, donde ya no existe el patrono con todo lo que esto presupone de positivo y negativo trabajando en una región dificil, de selva con una condiciones de temperatura, precipitación y suelos totalmente diferentes a su región de arralgo con una tradición de consumo de frejol, antagónica a este alimento con poco o ningún acceso al mercado por su baja capacidad económica con un nivel de pobreza que lo constituyen en objeto de ayuda de ONGs que confluyen a Bolivia tratando de ayudar, con soluciones no siempre plausibles y de toque patemalista."},{"index":15,"size":24,"text":"Frente a este agricultor nos encontramos con un grupo de visionarios que aspiran a través del frejol a rescatarlos en parte de su pobreza."},{"index":16,"size":38,"text":"Para entender y resumir el proceso se ha elaborado un esquema de la situación de los productores y la de los actores que tuvieron que ver con la introducción del frejol a Bolivia, definiendo el rol que jugaron."},{"index":17,"size":40,"text":"Es fácil observar que confluyeron una serie de factores, instituciones y alianzas estratégicas que jugaron un papel importante en la viabilidad del proyecto &ejol en Bolivia y que no fue la tecnología por si sola quien pudo sortear las dificultades."},{"index":18,"size":37,"text":"CIAT y PROFRIZA fueron deternúnantes en la oferta tecnológica atendiendo el suministro de germoplasma y el adiestramiento del personal local en el manejo del germoplasma entregado, delegando a la universidad (UAGRM) la relación directa con el agricultor."},{"index":19,"size":42,"text":"Los agricultores al crearse ASOPROF se constituyeron en actores dinámicos y participativos del proceso incorporándose en varios segmentos de la cadena productiva: mercadeo de insumas y productos, participación en la producción técnica de semilla, generación de mercado doméstico, búsqueda de mercados internacionales."},{"index":20,"size":45,"text":"Las campañas de divulgación de la calidad nutritiva del frejol que se acompañaron con información culinaria, fueron atendidas y apoyadas por ASOPROF. MEDA y la UAGRM, generando una demanda doméstica para el frejol con efectos colaterales sobre la nutrición de los consumidores rurales y urbanos."},{"index":21,"size":37,"text":"La cooperación internacional tuvo un rol invisible pero protagónico a la vez para el éxito de esta aventura. Sin el apoyo económico de COSUDE habría sido imposible acometer esta empresa con un cultivo nuevo sin mercado interno."},{"index":22,"size":33,"text":"Por útímo, pero no menos importante es necesario resaltar que los agricultores a quienes estaba llegando la tecnología disponían de tierra para realizar sus sueños y los de quienes emprendieron esta exitosa aventura."}]},{"head":"I ... Santa Cruz, Boüvia","index":15,"paragraphs":[{"index":1,"size":15,"text":"Eoquema del proceso que acompañó la adopción del frejol en Santa Cruz, Bolivia • Llanura  "}]}],"figures":[{"text":"\" Consultora del CIAT _. Asociado de Investjgación de la Unidad de Evaluación de Impacto del CIAT . -Director de Planeaci6n EIlItratégica del CIAT de Frojol.,. "},{"text":"Figura 1 . Figura 1. Evolución del área en cultivos, Santa Cruz, Bolivia. "},{"text":"Figura 3 . Figura 3. Consumo d. !Njol en los sectores urbanos y rural d. SantaCru.z, 1999.     "},{"text":"1 I Figura 5. Estructura d.1 costo d. producción de frejol, SantaCruz, Bolivia, 1999.     "},{"text":" De la población rotal De loo consumidores do {rejol De loa consumido ..... d. estrato. bojos 75% Impacto de l<í.Ad.opci6n de Frejal '\" "},{"text":"Canüdade8con~dasal Las cantidades consumidas en el departamento de Santa Cruz son altas. El consumo par cápita observado para la población rural es de 23.5 kg per cápitalaflo, mayor que el promedio de Brasil (Cuadro 2l. b) En el sector urbano el consumo es de 6 kg per cápitalaño, mayor que el de países con una mas larga tradición de consumo. (Colombia 4 kgteápitalañol. "},{"text":"Figura 1 . Figura 1. Cambios en el consumo defrejol,Santa Cruz, 1988-1999.  "},{"text":".  "},{"text":" Figura 11. Metas y logros en bienestar. SanJulián. "},{"text":"Figura 14 . Figura 14. Metas de bienestar, porcentaje de eumplimientn, Santa Cruz, Bolivia. "},{"text":"Y=b~ logro en bienestar alcanzado por cada familia X= número de años cultivando &ejol .! En el Cuadro 4 se presentan los resultados y se puede evidenciar que el frejol explica parte del bienestar adquirido por los habitantes rurales del área de penetración de Santa Cruz. Impacto ck la Adopción di!. Frejol ,,.Cuadro 4. Coeficientes de bienestar. "},{"text":"de la Adopción de Frejol (Phaseolus vulgaris L.) en Santa Cruz, Bolivia Norha Rufz tk Londoño- JarnesArbe;y Garr::ía*'* Dougku Pachico'*'\" Antecedentes 1999 En  Oswaldo Voysest Voysest Oswaldo Voysest Voysest Coordinador Regional Coordinador Regional  "},{"text":"bienestar para la zona la ciudad de Santa Cruz 5 niveles de ingreso 1. Fuentes d. información consultad .. para el estudio d. impacto de la adopción de frejol. Santa Cruz. 1999. ...     ... Nivel ~i6n ConaumQ  Reglón Comercio Nivel~i6nConaumQReglónComercio   Urbano Rural  UrbanoRural Fuentes     Fuentes  252 agricultores 367 amns de case de 261 amas d. casa CAO Exportadora 252 agricultores367 amns de case de261 amas d. casaCAOExportadora  2 localidades:  2 localidad .. : l1lCE ASOPROF 2 localidades:2 localidad .. :l1lCEASOPROF  San Julíán y  San Julián y CIMAR DOLIVIAN San Julíán ySan Julián yCIMARDOLIVIAN  Colonia Berlín  Colonia Berlín CORDECRUZ SHOJI Colonia BerlínColonia BerlínCORDECRUZSHOJI  80 mujeres,    ASOMEX 80 mujeres,ASOMEX  esposas de    esposas de  productores    productores TIpod.e     TIpod.e información     información  C .... cter!stie .. de COIlllUInO d. frlllol y Consumo de Estadratieas Volúmenes C .... cter!stie .. deCOIlllUInO d. frlllol yConsumo deEstadratieasVolúmenes  la produ<ción, de otros niimen1:os. frlllol y de sobre cultivos y exportados, la produ<ción,de otros niimen1:os.frlllol y desobre cultivos yexportados,  rendimiento. costos  ot:ros alimentos actividades de precios y rendimiento. costosot:ros alimentosactividades deprecios y     la región dest.inos. la regióndest.inos.  Destino producción e    Destino producción e  ingreso d. !rejo!    ingreso d. !rejo!  Información base por.    Información base por.  ídentifi<ar indicadores de   ídentifi<ar indicadores de  "},{"text":"Sama Cruz, Bolivia   "},{"text":" Bolivia es el país de América que registra el consumo de frejol más bajo. Según las estadísticas de la FAO, el país muestra un consumo de 1.1 kilos per cápitalaño. referido casi totalmente al género Vigna unguiculata, que en Bolivia se conoce como frejol camba o cumandá. Su vecino Brasil llega a los 18 kilos y aún países de bajo consumo como Colombia y Venezuela con cerca de 4 kilogramos per cápitalaño son superiores a Bolivia.El impacto de la introducción de este género de frejol sobre el consumo en el departamento de Santa Cruz se analiza en base a: Promedio de 1 .. consumidores de estrato. boj ... RoJo •7.5 549 -Cantidades consumidas !iilIIngr ... neto • Ingreso monetario Rendimiento MedIo 892 1616 Importancia relativa en la íngesta nutricional Alto 1821 2617 -Cambios ocurridos en el consumo de otros alimentos Cobertura y estabilidad Cantidad de fr<\\jol consumido (kg per cápita I afúJ) Promedio de la población total Promedio de loa consumidores Figura 6. Cobertura y estabilidad Aporte nutriclonaJ protéleo RoJo •7.5 549 -Cantidades consumidas !iilIIngr ... neto • Ingreso monetario Rendimiento MedIo 892 1616 Importancia relativa en la íngesta nutricional Alto 1821 2617 -Cambios ocurridos en el consumo de otros alimentos Cobertura y estabilidad Cantidad de fr<\\jol consumido (kg per cápita I afúJ) Promedio de la población total Promedio de loa consumidores Figura 6. Cobertura y estabilidad Aporte nutriclonaJ protéleo  "},{"text":" Cuadro 3. Metas de bienestar definidas por las Ihmilias rurales de Santa Cruz.  SanJuIián C.lonta Berlin SanJuIiánC.lonta Berlin M<;ior educación para los hijos 1.0 .98 M<;ior educación para los hijos1.0.98 Finca Ubre de lroe<ls de árboles 1.0 U) Finca Ubre de lroe<ls de árboles1.0U) M<;ior nutrición para 10& hijos .94 .94 M<;ior nutrición para 10& hijos.94.94 Pane¡solar para energía eléctrica .94 .86 Pane¡solar para energía eléctrica.94.86 Disponer d. fumigadora .94 .96 Disponer d. fumigadora.94.96 No tener que emigrar por trabajo .94 .96 No tener que emigrar por trabajo.94.96 Tener CIll!l1 de mllterial .94 .78 Tener CIll!l1 de mllterial.94.78 Tener tractor .89 .47 Tener tractor.89.47 Recibir agua de aeueducto .83  Recibir agua de aeueducto.83  "},{"text":" Indicadores de bienestar en Santa Cruz, Bolivia, area rura~ localidad .. d. San Julián y Col<>nia Berlin .   1.00 0.96 0.86 0.96 0.96 0.78 0.47 1.000.960.860.960.960.780.47 • San Julián l.OO 1.00 0.94 0.94 0.94 0.94 0.94 0.89 • San Juliánl.OO1.000.940.940.940.940.940.89 Figura 10.         Figura 10.  "},{"text":"-Colonia Berlín 16%    30% 36% 51% 68% 63% 30%36%51%68%63% _SanJulián 4% 31% 53% 69% 71% 80% _SanJulián4%31%53%69%71%80%  "},{"text":" Ca:racterísticas sociodemográficas de los consumidores d. frejol, Santa Cruz, Bolivia, 1999. CIAT entrega prmoplfHI.ooa y adiestra profesionales de la UAGRM en producci6n de Tamaño de la familia Num.ero de personas por familia COSUDE a travéi!: de PROFRIZA financia e integra esfuerzos ,-------~ MEDA promueve la :: creacion de la asociación i ¡ de produd:ol'es de &ejo) CIAT entrega prmoplfHI.ooa y adiestra profesionales de la UAGRM en producci6n de Tamaño de la familia Num.ero de personas por familiaCOSUDE a travéi!: de PROFRIZA financia e integra esfuerzos,-------~ MEDA promueve la :: creacion de la asociación i ¡ de produd:ol'es de &ejo) semilla, evaluación de gernwplasma y manejo de Estructura de la familia ; nacionales e internacionales ASOPROF, que mercadea productos e irulum08 semilla, evaluación de gernwplasma y manejo de Estructura de la familia ;nacionales e internacionalesASOPROF, que mercadea productos e irulum08 patología •• n fl'eí<>l FORMACIONDE Distribucwn JW\"\"'n.tual por grupo de edad RECURSOS ECONOMICOS Menos de tres afios ' RECURSO HUMANO APOYO TECNOLOGIA * LA UAGRMofrece al agrlcu)ror, variedadee, paquete tecnológico y &f.!milla certificada 1 La UAGRM ofrece tUl . , nuevo género vegetru al ; , productor I I ' ! ALTERNATIVAS DE De tres a 12 ail\"\" De 12 a 18 años Mayores a 18 años Migración ProcedeTlCia deljefe de famílJa (%) -Uanura PRODUCCION Valle FORTALEZAS EN EL MERCADO ' \" ASOPROF facilita créditos en forma de P semilla y de asistencia técnica ! patología •• n fl'eí<>l FORMACIONDE Distribucwn JW\"\"'n.tual por grupo de edad RECURSOS ECONOMICOS Menos de tres afios ' RECURSO HUMANO APOYO TECNOLOGIA * LA UAGRMofrece al agrlcu)ror, variedadee, paquete tecnológico y &f.!milla certificada 1 La UAGRM ofrece tUl . , nuevo género vegetru al ; , productor I I ' ! ALTERNATIVAS DE De tres a 12 ail\"\" De 12 a 18 años Mayores a 18 años Migración ProcedeTlCia deljefe de famílJa (%) -Uanura PRODUCCION ValleFORTALEZAS EN EL MERCADO ' \" ASOPROF facilita créditos en forma de P semilla y de asistencia técnica ! Altiplano   Altiplano Otropa.fs   Otropa.fs Procedencia del ama de casa (%)   Procedencia del ama de casa (%)   ASOPROF. UAGRM. ASOPROF. UAGRM.   MEDA. apoyan la MEDA. apoyan la   promoci6n del ftejol promoci6n del ftejol   como aJime.nto, ereando como aJime.nto, ereando   , un mereado doméstico , un mereado doméstico   FORTALEZAS EN FORTALEZAS EN   EL MERCADO EL MERCADO • Con tecnologta. 'i con recur1I08 tecnoI.6gicoe  • Con tecnologta. 'i con recur1I08 tecnoI.6gicoe • (,;'(m alterruJtiva# de product:!ÍÓA  • (,;'(m alterruJtiva# de product:!ÍÓA • Con ~ en ell'lU!rcadc  • Con ~ en ell'lU!rcadc  "},{"text":".\"Santa Cruz, BoU¡;Ut AnelW 3. COll8Umo de frejolen Santa Cruz, Bolivia, 1999. Urbano Urbano  "},{"text":"Rural Consumo de trejol según género Característicasd.las vari.dad .. consumidas, Santa Cruz, Bolivia, 1999.    Impacto de laAdopcum eh Frejol o\" Anexo 6. Consumarle alimentos, Santa Cruz, Bolivia, 1999.Estimación del ingreso proveniente del frejol, Santa Cruz, Bolivia, 1999, Ingesta de proteína y eaIorías, Santa Cruz, Bolivia, 1999. Anexo 4.        Anexo 4. Porcentaje de ro j1(}blacwn • Frejol común (Pha.seolus uulgaris) • Frejol camba (Vigna unguieulata! Proporeión de consumidores Po ..... ntaj. de ro población Sólo camba Sólo freiol común Camba + frejol común No comen frejal Variedades Color V\"ritd4des de {rejo! órdentuia. por tamallO de grano 49 70 32 11 38 19 Forma Tl1IW1iI.o PrecIo 75 6() 11 28 48 Peso en Minorista gramos BaIKg. d.l00 se_ ROJOORIENTAL Rojo con manchas blancas alargada 46 7.0 ROJO TINTO fuljo alargada 46 5.0 MANTECA AmariJlo claro alargada 45 Cantidad de alimentos consumidos (Kg I per cápita I allo) Frejol Maíz Lenteja Arvejas Arro. Carnes varios (tes, cerdo, otros) Urbano 9.5 34.0 10.4 30.6 5.7 6.0 13.5 8.5 32.2 108.2 29.1 13.5 Ingreso por bectárea Alimentos Urbano Rural Con Con rendimiento rendimiento Calorías Proteinas Calorias Protelnas rendimiento ._--Con buJo medio alto M _ _ _ _ _ _ _ _ _ M __ Ingreso bruto ldóÚlres I ha! 240.3 400.5 1lOO.7 Rendimiento (qqlha) 15 25 35 Precio ($USlqq) 16.02 16.02 16.02 Coato de producción Per cápitaldía FrE\\iol 169 11 293 19 M..n 94 2 7 322 Lenteja 52 4 61 5 Arvejas 113 13 84 6 Arroz 311 7 1216 27 Carnea varios (res, cerdo, otros) 159 20 86 8 8.0 Pollo o gallina 18.2 12.8 ldóÚlreslha! 250.1 284.6 324.2 Pollo o gallina 69 10 73 8 13 Variedadeseonsum.idas Carioca 26.3 73.2 Rojo Oriental 15.5 30.6 Mantequilla 18.5 6.1 Negro 30.6 8.8 Otros (blanco, mante<a y rojo tinto) 20.5 0.0 • Frejol Camba (V'¡gna ungulculatal Camba 86.9 59.8 Número de variedades consumidas Número de variedades consumidas ¡x;r familia • Frejol común (Pha.seolus vulgaris) 0.9 1.2 • Frejol camba (Vigna unguiculala) 0.9 0.6 CARIOCA Crema rayado alargada 26 4.8 NEGRO Negro alargada 21 5. BLANCO Blanco redonda 20 3.5 MANTEQUILLA AmariJlo claro alargada 20 8.0 CAMBA Crema redonda 11 4.0 VarietÜuÚlJl de {rejo! orde1Uld4s por precio de venta minorísta Variedades Color Forma T_ Precio Peso en Minorlsta gramos BaIKg. do lOO . . -MANTECA AmariJlo claro alargada 45 8.0 Vainitas Papa Fideoa Huevos Lecllelíquida Yuca Pescado Maní Aceite Azúcar Proporción del guto en alimentos (gasro en cada ai,menro sobre gasro totai) Frtúol Maí. Lenteja 10.9 7.3 62.9 57.3 14.6 18,4 13.0 11.9 53.0 14.9 15.6 29.1 6.8 2.0 3.6 4.l 16.1 13.6 27.0 16.7 6.0 1.9 0.6 2.1 1.7 1,4 Manad. obra 117.5 145.0 178.6 Insum .. 75.2 75.2 75.2 Maquinaria Y transporte 57.4 64.4 70.4 Ingreso neto (dólar..thal -11.8 11U 236.5 Ingreso neto total •75 S92 1821 del agricultor Total hectáre\"\" ¡l<)t ngricultor 7.7 7.7 7.7 Ingreso neto por ha -9.8 115.9 236.5 Ingreso por jornalee en fn\\Iol 624 Número d. jornal •• ptopioalha 16.2 18.8 20.7 Valor jornale. propioalha 81.0 103.4 94.0 724 796 V _ IO 1 8 O Papa 125 6 133 6 Fideos 142 4 207 6 Huevos 56 5 60 5 Lechelíquida 89 4 25 1 Pan 712 19 535 14 YUca 62 O 186 1 Pescado 14 3 5 1 Maní 57 9 76 4 Aceite 394 O 387 O Azúcar 287 O 207 O TOTAL 2873 n3 3943 121 i t f: í ¡ ! ¡ t ! í r ¡ ! , ¡ ¡ f t , l ' I ¡ ( ¡ , t ! f Porcentaje de ro j1(}blacwn • Frejol común (Pha.seolus uulgaris) • Frejol camba (Vigna unguieulata! Proporeión de consumidores Po ..... ntaj. de ro población Sólo camba Sólo freiol común Camba + frejol común No comen frejal Variedades Color V\"ritd4des de {rejo! órdentuia. por tamallO de grano 49 70 32 11 38 19 Forma Tl1IW1iI.o PrecIo 75 6() 11 28 48 Peso en Minorista gramos BaIKg. d.l00 se_ ROJOORIENTAL Rojo con manchas blancas alargada 46 7.0 ROJO TINTO fuljo alargada 46 5.0 MANTECA AmariJlo claro alargada 45 Cantidad de alimentos consumidos (Kg I per cápita I allo) Frejol Maíz Lenteja Arvejas Arro. Carnes varios (tes, cerdo, otros) Urbano 9.5 34.0 10.4 30.6 5.7 6.0 13.5 8.5 32.2 108.2 29.1 13.5 Ingreso por bectárea Alimentos Urbano Rural Con Con rendimiento rendimiento Calorías Proteinas Calorias Protelnas rendimiento ._--Con buJo medio alto M _ _ _ _ _ _ _ _ _ M __ Ingreso bruto ldóÚlres I ha! 240.3 400.5 1lOO.7 Rendimiento (qqlha) 15 25 35 Precio ($USlqq) 16.02 16.02 16.02 Coato de producción Per cápitaldía FrE\\iol 169 11 293 19 M..n 94 2 7 322 Lenteja 52 4 61 5 Arvejas 113 13 84 6 Arroz 311 7 1216 27 Carnea varios (res, cerdo, otros) 159 20 86 8 8.0 Pollo o gallina 18.2 12.8 ldóÚlreslha! 250.1 284.6 324.2 Pollo o gallina 69 10 73 8 13 Variedadeseonsum.idas Carioca 26.3 73.2 Rojo Oriental 15.5 30.6 Mantequilla 18.5 6.1 Negro 30.6 8.8 Otros (blanco, mante<a y rojo tinto) 20.5 0.0 • Frejol Camba (V'¡gna ungulculatal Camba 86.9 59.8 Número de variedades consumidas Número de variedades consumidas ¡x;r familia • Frejol común (Pha.seolus vulgaris) 0.9 1.2 • Frejol camba (Vigna unguiculala) 0.9 0.6 CARIOCA Crema rayado alargada 26 4.8 NEGRO Negro alargada 21 5. BLANCO Blanco redonda 20 3.5 MANTEQUILLA AmariJlo claro alargada 20 8.0 CAMBA Crema redonda 11 4.0 VarietÜuÚlJl de {rejo! orde1Uld4s por precio de venta minorísta Variedades Color Forma T_ Precio Peso en Minorlsta gramos BaIKg. do lOO . . -MANTECA AmariJlo claro alargada 45 8.0 Vainitas Papa Fideoa Huevos Lecllelíquida Yuca Pescado Maní Aceite Azúcar Proporción del guto en alimentos (gasro en cada ai,menro sobre gasro totai) Frtúol Maí. Lenteja 10.9 7.3 62.9 57.3 14.6 18,4 13.0 11.9 53.0 14.9 15.6 29.1 6.8 2.0 3.6 4.l 16.1 13.6 27.0 16.7 6.0 1.9 0.6 2.1 1.7 1,4 Manad. obra 117.5 145.0 178.6 Insum .. 75.2 75.2 75.2 Maquinaria Y transporte 57.4 64.4 70.4 Ingreso neto (dólar..thal -11.8 11U 236.5 Ingreso neto total •75 S92 1821 del agricultor Total hectáre\"\" ¡l<)t ngricultor 7.7 7.7 7.7 Ingreso neto por ha -9.8 115.9 236.5 Ingreso por jornalee en fn\\Iol 624 Número d. jornal •• ptopioalha 16.2 18.8 20.7 Valor jornale. propioalha 81.0 103.4 94.0 724 796 V _ IO 1 8 O Papa 125 6 133 6 Fideos 142 4 207 6 Huevos 56 5 60 5 Lechelíquida 89 4 25 1 Pan 712 19 535 14 YUca 62 O 186 1 Pescado 14 3 5 1 Maní 57 9 76 4 Aceite 394 O 387 O Azúcar 287 O 207 O TOTAL 2873 n3 3943 121i t f: í ¡ ! ¡ t ! í r ¡ ! , ¡ ¡ f t , l ' I ¡ ( ¡ , t ! f Total variedades Cantidades consumidas Kg {per cápita laño (promedia $(jore población total) MANTEQUILLA AmariJlo claro alargada ROJOORIENTAL Rojo con manchas blancas allU'gada Arvejas Arroz 3.0 Total ingreso mooetario 5.2 porfrejol (Va/or IÚ joT7UJ.k. propios mas Carnes varios (roo, cerdo, otros) 21.1 ingreso \"\"te) 1.8 20 46 2.5 23.5 13.0 8.0 7.0 1.8 Total variedades Cantidades consumidas Kg {per cápita laño (promedia $(jore población total) MANTEQUILLA AmariJlo claro alargada ROJOORIENTAL Rojo con manchas blancas allU'gada Arvejas Arroz 3.0 Total ingreso mooetario 5.2 porfrejol (Va/or IÚ joT7UJ.k. propios mas Carnes varios (roo, cerdo, otros) 21.1 ingreso \"\"te)1.820 462.5 23.5 13.08.0 7.01.8 • Frejol común (P1uueol ... • u/gario) Negro Pollo o gallina NEGRO (en datares) alargada 10.4 1149  21 9.7 161fl 5.8  2017 • Frejol común (P1uueol ... • u/gario) Negro Pollo o gallina NEGRO (en datares)alargada 10.4 1149219.7 161fl5.82017 Cari_ Rojo Oriental Mantequilla Negro Otros (blanco, manteca y rojo tinto) Total trejo! común • Frejol Camba (Vigna ungulcularo:) Tola! coosumo de trejo! Blanco Crema Leche líquida Aceite Maní Pescado BLANCO Yuca CAMBA Huevos CARIOCA Crema rayado Fideos ROJO TINTO Rojo Papa Vainitas (en boliuianos)  5.2 0.9 4.9 redonda 0.7 redonda 9.7 4.8 alargada 2.5 allU'gada 7.4 0.9 2743 1.3 0.7 1.0 2.1 1.0 6.0 3.6 9.55 20 11 26 46 5.3 1.2 2.3 1.6 3.5 6.7 3.9 8.8 0.9 8081 13.3 4.3 4.3 1.3 0.3 23.5 10.5 34.00 3.5 4.0 4.8 5.0 13086 } '{ I j ¡ t\" , ¡ ; ¡ ¡ , Cari_ Rojo Oriental Mantequilla Negro Otros (blanco, manteca y rojo tinto) Total trejo! común • Frejol Camba (Vigna ungulcularo:) Tola! coosumo de trejo! Blanco Crema Leche líquida Aceite Maní Pescado BLANCO Yuca CAMBA Huevos CARIOCA Crema rayado Fideos ROJO TINTO Rojo Papa Vainitas (en boliuianos)5.2 0.9 4.9 redonda 0.7 redonda 9.7 4.8 alargada 2.5 allU'gada 7.4 0.9 27431.3 0.7 1.0 2.1 1.0 6.0 3.6 9.5520 11 26 465.3 1.2 2.3 1.6 3.5 6.7 3.9 8.8 0.9 808113.3 4.3 4.3 1.3 0.3 23.5 10.5 34.00 3.5 4.0 4.8 5.013086} '{ I j ¡ t\" , ¡ ; ¡ ¡ , Azúcar  4.0   3.0   Azúcar4.03.0 TOTAL 88.7   91.6   ¡ TOTAL88.791.6¡         31 35 f ¡ i ! 31 35f ¡ i !  "},{"text":"Paticipaclón del f'n\\lol en la lnceate nutricional Anexo 9.Consumo de calorías y proteínas. Santa Cruz, Bolivia. 1999.Con8llDlO de eslorf .... totales (CalorÚJ$ per Clipita rita) ExpoItación de frejol según país de destino. Sants Cruz, Bolivia, 1997.Anexo 11. Exportaciones de frejol de Bolivia según medio de transporte hasta la fronters l del volúmen total de producci6n Santa Cruz: Exportaciones de frejol,1977 según país de destino.Ane\"\" 12. Exportaciones de fr<\\Íol de Bolivia según puntos fronterizo. de salida, 1997.  \".Santa Cruz. &ÜUw,       \".Santa Cruz. &ÜUw,        Urbano Rural I , ¡ UrbanoRuralI , ¡  Consumo de proteínas totales (Protell!as per cápita día) Poblaeión con déficits en requerimientos nutricionales (Porcentaje t:k la población) Déficit en caloría y proteína Déticit en calorín solamente 113 5.'3 O 121 21 O I r ¡ Consumo de proteínas totales (Protell!as per cápita día) Poblaeión con déficits en requerimientos nutricionales (Porcentaje t:k la población) Déficit en caloría y proteína Déticit en calorín solamente113 5.'3 O121 21 OI r ¡  Déficit en proteína solamente     9 9 Déficit en proteína solamente99  Sin déficit en caloría ni proteína     38 70 Sin déficit en caloría ni proteína3870   TOTAL    100 100 TOTAL100100  Anexo 10. País de destiJw Kilos  Valor  Participación ! Anexo 10. País de destiJwKilosValorParticipación! Punto fronterizo Paío de Medio de ($OS) Volúmen Valor Punto fronterizoPaío deMedio de($OS) VolúmenValor de oaIlda  destino transporte Kg % del volúmen % del valor $OS de oaIldadestinotransporteKg% del volúmen % del valor $OS BrMil De.sa¡¡uadero Penl 9.477.805 terrestre 6.518.068 55.000 76.8% 19.250  74.4% BrMil De.sa¡¡uaderoPenl9.477.805 terrestre6.518.068 55.00076.8% 19.25074.4% Japón Puerto Quijarro Brruill 1.220.000 férreo  986.174 4.652.750 9.9% 4.121.355  11.3% Japón Puerto QuijarroBrruill1.220.000 férreo986.174 4.652.7509.9% 4.121.35511.3% Perú Puerto Suare. Brasil 55.000 férreo  19.250 3.183.140 0.4% 1.986.543  0.2% Perú Puerto Suare.Brasil55.000 férreo19.250 3.183.1400.4% 1.986.5430.2%  Colombia Brruill 848.878 terrestre  580.592 210.800 6.9% 52.500  6.9% ColombiaBrruill848.878 terrestre580.592 210.8006.9% 52.5006.9% San Ignocío Espaila Brruill 38.295 ú¡rrestre  30.636 240.000 0.3% 89.000  0.3% San IgnocíoEspailaBrruill38.295 ú¡rrestre30.636 240.0000.3% 89.0000.3% % de los requerimienro.r que aporta cada alimenro 5.6 10.5 Argentina 690.000 614.100 Brasil terrestre 1.191.115 7.4 3.1 2.1 8.2 1.7 3.7 1.5 Itslin 12.000 9.200 TOTAL 12.341.978 8.758.020 Tambo Quemado Fr.;iol San Vicente M..n Lenteja Colombia terrestre 848.878 Italia terrestre 12.000 ArvE\\ias 3.8 8.4 2.1 Fuente: Anuario estadístico de las exportaciones de Santa Cruz. 268.670 5.6% 0.1% 100.0% 580.592 9.200 Japón terrestre 1.220.000 986.174 Arroz 10.5 6.7 30.8 Elaboración: IBCE. Yacuiba A!'gentin. terrestre 690.000 614.100 Caroes varios (res, cerdo, otros) 5.1 14.5 2.2 España terrestre 38.295 30.36 15.7 6.2 3.8 5.4 22.5 6.8 7.\\l% 0.1% 100.0% % de los requerimienro.r que aporta cada alimenro 5.6 10.5 Argentina 690.000 614.100 Brasil terrestre 1.191.115 7.4 3.1 2.1 8.2 1.7 3.7 1.5 Itslin 12.000 9.200 TOTAL 12.341.978 8.758.020 Tambo Quemado Fr.;iol San Vicente M..n Lenteja Colombia terrestre 848.878 Italia terrestre 12.000 ArvE\\ias 3.8 8.4 2.1 Fuente: Anuario estadístico de las exportaciones de Santa Cruz. 268.670 5.6% 0.1% 100.0% 580.592 9.200 Japón terrestre 1.220.000 986.174 Arroz 10.5 6.7 30.8 Elaboración: IBCE. Yacuiba A!'gentin. terrestre 690.000 614.100 Caroes varios (res, cerdo, otros) 5.1 14.5 2.2 España terrestre 38.295 30.3615.7 6.2 3.8 5.4 22.5 6.87.\\l% 0.1% 100.0% Pollo o gallina v_ TOTAL 1997. 2.9 5.3 9.6 0.6  1.9 0.2  0.4 6.9 Pollo o gallina v_ TOTAL1997.2.9 5.39.6 0.61.9 0.20.4 6.9 Papa   0.3 5.9  3.4  5.2 Papa0.35.93.45.2 Fide\"\" Huevos Leche líquida Pan YUea Pescado Maal Aceite Medio de Transporte Férreo Carretera TOTAL 4.8 VoIúrnen 1.9 2.9 24.1 (Kg.) 7.835.890 2.1 4.506.098 0.6 1.9 13.2 12.341.978 4.2 4.5 4.3 18.5 0.2 2.9 2.8 0.0 Volúmen (%) 5.'3% 37% 100% 5.2 1.5 0.6 13.6 3.5 0.1 1.9 9.8 8.7ó8.020 Valor ($US) 6.107898 2.650.122 5.2 4.1 1.1 11.8 0.5 0.9 3.2 0.0 Valor (%) 70% 80% 100% r í I Fide\"\" Huevos Leche líquida Pan YUea Pescado Maal AceiteMedio de Transporte Férreo Carretera TOTAL4.8 VoIúrnen 1.9 2.9 24.1 (Kg.) 7.835.890 2.1 4.506.098 0.6 1.9 13.2 12.341.9784.2 4.5 4.3 18.5 0.2 2.9 2.8 0.0Volúmen (%) 5.'3% 37% 100%5.2 1.5 0.6 13.6 3.5 0.1 1.9 9.8 8.7ó8.020 Valor ($US) 6.107898 2.650.1225.2 4.1 1.1 11.8 0.5 0.9 3.2 0.0Valor (%) 70% 80% 100%r í I Ame.,. Elaboración: IBCE 9.7 0.0  5.2  0.0 Ame.,.Elaboración: IBCE9.70.05.20.0          37 37  "}],"sieverID":"6c6ed119-632a-43e6-ba62-2f50d771ccac","abstract":"Impacto sobre los consumídores Cobertura y estabilidad Cantidades consumídas Importancia relativa en la ingesta nutricional Cambios ocuxridos en el consumo de frejol y de otros alimentos Impacto sobre el bienestar de las familias rurales Resumen y Conclnsiones Anexos 27 Anexo 1. Características sociodemográficas de los consumí dores de frejo! Anexo 2. Características socioeconómicas de los consumídores Anexo 3. Consumo de frejol en Santa Cruz Anexo 4. Características de las variedades consumídas Anexo 5. Cambios ocurridos en el consumo de frejo! Anexo 6. Consumo de alimentos Anexo 7. Estimación del ingreso proveniente del frejol Anexo 8. Ingesta de proteína y calorías Anexa 9. Consumo de calorías y proteínas Anexo 10. Exportaciones d. frejo! según país de destino Anexo 11. Exportaciones de frE¡jol de Bolivia segun medio de transporte hasta la frontera Anexo 12. Exportaciones de frejo! de Bolivia según pnntos fronterizo. de salida Anexo 13. Precios del frejol iv"}

data/part_2/08aa9c9e69dc5c2aedd8d90b1f44deb6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08aa9c9e69dc5c2aedd8d90b1f44deb6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/36ecc298-a905-41ce-bada-693fe5895cce/retrieve"},"pageCount":2,"title":"The food system Challenges","keywords":[],"chapters":[{"head":"Red de Mercados Agroecológicos","index":1,"paragraphs":[{"index":1,"size":19,"text":"The co-development of a joined vision, an impact pathway and associated action plan to guide partners and stakeholders efforts."},{"index":2,"size":22,"text":"The actions of this platform reflecting the generation of knowledge, information, tools and recommendations for decision-makers and for programs and policies planning."},{"index":3,"size":20,"text":"The City authorities need to have an integrated conceptual framework -from production to consumption-to guide local planning and development processes."},{"index":4,"size":14,"text":"Multiple actors perceive the issue of food security as limited to only food production."},{"index":5,"size":9,"text":"Influencing consumers' behavioral changes through (but not only) education."},{"index":6,"size":24,"text":"Lack of lobbying activities on the topic to influencing key decision-makers and the civil society. Need to strengthen local producers and their informal markets."},{"index":7,"size":15,"text":"Increased scientific evidence on nutrition, urban and peri-urban food production, local markets and food waste."},{"index":8,"size":23,"text":"Specific communication actions to make visible the existing experiences around food and nutritional security, waste management, climate change and others topics of interest."}]},{"head":"Education","index":2,"paragraphs":[{"index":1,"size":6,"text":"for social efforts mobilization and advocacy."}]},{"head":"Spaces for discussion","index":3,"paragraphs":[{"index":1,"size":3,"text":"with different stakeholders."},{"index":2,"size":8,"text":"Knowledge (not only scientific) for action and innovation."},{"index":3,"size":18,"text":"Adapted icons from: Art shop; B Farias; Delwar Hossain; Gan Khoon Lay & Tomas Knopp. From Noun Project. "}]}],"figures":[],"sieverID":"b1a07576-9eef-4456-b0c7-2541134dd59b","abstract":""}

data/part_2/08e2c7370056965e0c145afbdca09f77.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08e2c7370056965e0c145afbdca09f77","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/090a4323-2d50-4c99-bd06-deef7f7dbd76/retrieve"},"pageCount":39,"title":"Good Agricultural Practices for Ware Potato Production in Cameroon","keywords":[],"chapters":[{"head":"1-Importance of the potato crop","index":1,"paragraphs":[{"index":1,"size":11,"text":"• The potato crop comes from the highlands of South America."},{"index":2,"size":16,"text":"• The crop is currently the third food crop in the world, after wheat and rice."},{"index":3,"size":20,"text":"• It produces more calories per unit area and unit of time than any other crop grown in cool climates."},{"index":4,"size":22,"text":"• It is also a good source of iron and zinc, 2 micro-nutrients important for human nutrition (especially infants and breastfeeding women)."},{"index":5,"size":20,"text":"• Potato is one of the best food cash crops. This income enables smallholder farmers to upgrade their living conditions:"},{"index":6,"size":9,"text":"-better houses, -better schools for children, and -better healthcare"},{"index":7,"size":5,"text":"Importance of the potato crop"},{"index":8,"size":8,"text":"1. Where does the potato crop come from?"},{"index":9,"size":18,"text":"2. Name the only two crops that are produced more than potato for food production in the world?"},{"index":10,"size":11,"text":"3. Why is the potato considered to be an important crop?"},{"index":11,"size":19,"text":"The income generated by growing potatoes is normally higher compared to the ones obtained from any other food crop."}]},{"head":"Growth stage 1 -From planting to emergence (2-4 weeks)","index":2,"paragraphs":[{"index":1,"size":13,"text":"-Factors: soil type and moisture, seed physiological age, planting depth, soil temperature, etc."},{"index":2,"size":14,"text":"-Very important to plant well sprouted tubers with multiple (minimum 3) and strong sprouts."},{"index":3,"size":8,"text":"-This phase is very critical for better yields."}]},{"head":"Growth stage 2 -From emergence to tuber initiation (2-4 weeks)","index":3,"paragraphs":[{"index":1,"size":10,"text":"-Duration is strongly related with the type of varieties used."},{"index":2,"size":5,"text":"-Fertilization process should be completed."},{"index":3,"size":12,"text":"-Plants need more protection against diseases like late blight than later stages."}]},{"head":"Growth stage 3 -From tuber initiation to end of leaf growth","index":4,"paragraphs":[{"index":1,"size":10,"text":"--This means that all leaves are formed and fully grown."},{"index":2,"size":18,"text":"-Ensure that plants have maximum soil around stems and all leaves are protected from any pests and diseases."}]},{"head":"Growth stage 4 -From tuber bulking to plant death","index":5,"paragraphs":[{"index":1,"size":14,"text":"-This is the maturity stage of the crop, leaves turn yellow and then die."},{"index":2,"size":7,"text":"-Crop growth stops and tubers become bigger."},{"index":3,"size":14,"text":"-It is important to wait until total death of the foliage for maximum yields."},{"index":4,"size":19,"text":"-Control of pests and diseases, but chemical applications (fungicides and insecticides) must stop at 2 -3 weeks before harvest."}]},{"head":"Figure 2","index":6,"paragraphs":[{"index":1,"size":5,"text":"Understanding the potato's crop cycle"},{"index":2,"size":24,"text":"The more the ground is covered by potato foliage the more yield can be expected. It is important to preserve foliage throughout the cycle."},{"index":3,"size":11,"text":"1. What are the four stages of the potato crop cycle?"},{"index":4,"size":18,"text":"2. Why is it important to have maximum ground coverage by foliage until the end of the season?"},{"index":5,"size":9,"text":"3. When is it appropriate to harvest the potato"}]},{"head":"Figure 3","index":7,"paragraphs":[{"index":1,"size":20,"text":"• Potatoes like cool environment: 16 -20°C, not beyond 28°C, nor below 10°C (normally grown in highlands and at mid-elevation)."},{"index":2,"size":17,"text":"• Soil should be deep, well drained and loose for proper development of roots, stolons and tubers."},{"index":3,"size":28,"text":"• Site should be free of soil borne pests and diseases (bacterial wilt and nematodes), i.e. where potato has not been grown for more than 2 consecutive years."},{"index":4,"size":26,"text":"• Plan for a 2-3 year rotation scheme as potatoes should not follow potatoes or other crops of the same family (eggplant, pepper, tomato, tobacco, etc)."},{"index":5,"size":19,"text":"• Essential to prepare soil early in the season when the soil is partially dry to prevent soil compaction."},{"index":6,"size":20,"text":"• Prepare land until the ground becomes soft, free from clods and dug to a depth of over 30 cm."},{"index":7,"size":26,"text":"• Ploughing soil using hoes is tiresome and labor intensive. Therefore, farmers are urged to modernize their agriculture and use machinery as being introduced by Pro-CISA:"},{"index":8,"size":133,"text":"-Over 1 ha, use tractors, or -Less than 1 ha, use motocultivators.  • Manure collected with 2 hands can be applied for 2-3 seed tubers (i.e., 15-20 t/ ha). Not recommended for rich soils such as forest soils. • Fertilisers: various compound NPK fertiliser packages but most commonly used fertilisers have a composition of NPK 12-11-18 (YaraMila) or NPK 11-11-22 to be mixed with a second N-rich fertiliser (15-0-0, like YaraLiva) at a ratio of 4/1. • Avoid any NPK fertilisers like 20.10.10. • For a planting density of 80 cm x 30 cm, 600 kg/ha of mixed fertilisers will be required, i.e., 480 kg/ha for the NPK-based fertiliser (e.g. YaraMila) and 120 kg/ ha for the N-based fertiliser (e.g., YaraLiva). • Apply 2 Fanta or beer bottle caps for each seed plant:"}]},{"head":"Land selection and preparation","index":8,"paragraphs":[{"index":1,"size":53,"text":"-1 cap of mixed fertilisers (e.g. Mila + Liva) at planting, and -Second cap of same fertilisers for top-dressing (1-2 weeks after emergence). • For those who may not be able to fertilise after emergence, they can apply the 2 caps at planting. • Also, you may apply the 2 caps after emergence."},{"index":2,"size":16,"text":"• To fertilise the crop after emergence, dig one small hole at around 10-15 cm from"}]},{"head":"Application of manure and fertilisers","index":9,"paragraphs":[{"index":1,"size":21,"text":"Unlike other crops, planting potatoes on a poor soil without manure and mineral fertilisers is a waste of time and resources."},{"index":2,"size":18,"text":"1. What is the quantity of organic manure required to fertilise potatoes on an area of 1 ha?"},{"index":3,"size":18,"text":"2. What are the mineral fertilisers that are recommended for potato crop in your area? At which dose?"},{"index":4,"size":17,"text":"3. When can you apply organic manure and mineral fertilisers if you wish to get better yields?"},{"index":5,"size":18,"text":"• Plant good quality seed of market-preferred varieties (most known are Cipira, Dosa, Panamera, Spunta, Mondial and Désirée)."},{"index":6,"size":15,"text":"ensure the seed tubers are well sprouted and avoid too old tubers with long sprouts."},{"index":7,"size":15,"text":"• Ensure that seed tubers of same size (category) are planted together in one area."},{"index":8,"size":31,"text":"• Two ways of planting potatoes are possible whether using farmers' tools or machinery: planting onto furrows or in holes. It is up to the farmer to choose the easiest method."},{"index":9,"size":16,"text":"• Planting on ridges should be avoided because plants may not have enough soil for hilling-up."},{"index":10,"size":29,"text":"• Prepare furrows or holes at a spacing of 75 -80 cm. But if your variety produces long stolons and/or the slope is steep, go up to 90 cm."},{"index":11,"size":37,"text":"• Within rows, use a plant spacing of 25 -40 cm depending on seed size, 25 cm when tubers are small (around 30 mm of diameter) and 40 cm for largest size (like 55 mm of diameter)."},{"index":12,"size":18,"text":"• Note that on a sloping terrain, furrows or seed holes should run across the slope to reduce"},{"index":13,"size":25,"text":"• Tubers should be covered by enough soil (10 -15 cm). 3. What is the optimal plant spacing for a maximum yield in ware potatoes?"},{"index":14,"size":25,"text":"• Potato crop should be weeded early to reduce competition (light, nutrients and water) from weeds and to prevent weeds from harboring pests and diseases."},{"index":15,"size":7,"text":"• Weeding occurs right after plant emergence."},{"index":16,"size":22,"text":"important hilling-up occurs 2 -3 weeks later; it loosens the soil, allowing plants to produce many tubers of good size and shape."},{"index":17,"size":21,"text":"• A third and last hilling-up may occur 2 -3 weeks later, especially when the slope and the rainfall are high."},{"index":18,"size":1,"text":"i."},{"index":19,"size":11,"text":"ii. Maintaining soft ground for smooth root, stolon and tuber development,"},{"index":20,"size":54,"text":"iii. Preventing that stolons become new but late above-ground stems when exposed to light, iv. Reducing tuber exposure to sunlight which turns the tubers green. Green tubers are NOT meant to be eaten because they are poisonous, and v. Reducing exposure of tubers to pests and diseases such as potato tuber moth that can"}]},{"head":"Weeding and hilling-up","index":10,"paragraphs":[{"index":1,"size":22,"text":"Unlike other crops such as cereals, potato yield is underground. If you are unable to hill-up, please refrain yourself from planting potatoes."}]},{"head":"weeds, until the harvest?","index":11,"paragraphs":[{"index":1,"size":8,"text":"2. Why is it important to hill-up potatoes?"},{"index":2,"size":6,"text":"3. When should potatoes be hilled-up?"},{"index":3,"size":2,"text":"Figure 7"},{"index":4,"size":14,"text":"• Potato is considered to be one of the most drought sensitive food crops."},{"index":5,"size":15,"text":"• Prior to planting, ensure that the crop will get enough water throughout the season."},{"index":6,"size":39,"text":"• Potato water needs are critical at tuber initiation because drought causes longer duration of tuber formation and big yield reductions. • Ensure that plants get enough water at least once a week, whether from rains or by irrigation."},{"index":7,"size":9,"text":"because water needs are dependent of many factors, including:"},{"index":8,"size":11,"text":"-type of variety (early or late maturing, drought sensitive or tolerant),"},{"index":9,"size":5,"text":"-soil type (clay, loam, sand),"},{"index":10,"size":4,"text":"-weather, and -ground cover."},{"index":11,"size":19,"text":"• Since it is possible to grow potatoes during dry season, farmers are encouraged to invest in irrigation systems."},{"index":12,"size":14,"text":"method. • Otherwise do use the new solar irrigation innovation being introduced by GIZ-ProCISA."},{"index":13,"size":11,"text":"It includes a solar panel, an electric pump, pipe(s) and sprinkler(s)."}]},{"head":"Irrigation","index":12,"paragraphs":[{"index":1,"size":44,"text":"Please ensure that there will be enough rain or irrigation water until the end of the season prior to planting potatoes. • It is important to protect potatoes against pests and diseases because they reduce tuber quality and yield (losses of 100% are possible)."},{"index":2,"size":5,"text":"TRIANGLE) must simultaneously be met:"},{"index":3,"size":29,"text":"-The potato crop which is attacked by pests and diseases, -The pathogen or pest (organism causing disease or damage), and -The environment (conditions that favor the pathogen or pest)."},{"index":4,"size":10,"text":"high (over 90%) and temperatures are low (less than 22°C)."},{"index":5,"size":17,"text":"• Any initiatives or strategies to control pests and diseases should aim at breaking this harmful interaction."},{"index":6,"size":24,"text":"• Please note that the pathogen can stay in the plant or tuber for a long time without symptoms (latent infection -e.g., bacterial wilt)."}]},{"head":"Disease triangle","index":13,"paragraphs":[]},{"head":"Pathogen Environment","index":14,"paragraphs":[{"index":1,"size":7,"text":"Host Disease towards controlling pests and diseases."},{"index":2,"size":10,"text":"1. Why is it important to control pests and diseases?"},{"index":3,"size":10,"text":"2. What are the three components of a disease triangle?"},{"index":4,"size":18,"text":"3. What do you call an infection of the potato plant or tubers that does not show symptoms?"}]},{"head":"Control of late blightt","index":15,"paragraphs":[{"index":1,"size":4,"text":"Control of late blight"},{"index":2,"size":20,"text":"• Late blight causes crop failure by damaging the leaves, stems and tubers. It can be controlled by spraying chemicals."},{"index":3,"size":18,"text":"• Severe infections occur at times of high relative humidity (over 90%) and cool temperatures (less than 22°C)."},{"index":4,"size":7,"text":"• Late blight can be managed through:"},{"index":5,"size":15,"text":"-Timely sprays to prevent infection and even kill the pathogen after infection to avert spread."},{"index":6,"size":12,"text":"-Two major groups of chemicals are normally used to control this disease."},{"index":7,"size":20,"text":"-Group 1 comprises chemicals that kill by contact (contact fungicides). Examples: Mancozeb, Pencozeb, Balear (Tropic), Plantineb, Manesam, Mancobex and Mancozan."},{"index":8,"size":32,"text":"-Group 2 comprises systemic fungicides that enter the plant and move inside the plant and kill the pathogen. Examples: Ridomil (Gold and Plus), Fungi-Pro, Fungicur, Monchamp, Metalm 75 WP, Metrostar and Parastar."},{"index":9,"size":7,"text":"-Planting clean seed of less susceptible varieties."},{"index":10,"size":6,"text":"• What and when to spray:"},{"index":11,"size":29,"text":"later, i.e., around 40 -45 days after planting at a dose (commonly used) of about 3 g per liter (45-50 g/sprayer). The right dose is provided by the manufacturer."},{"index":12,"size":24,"text":"-For subsequent sprays, use contact fungicides at 2-week intervals until the canopy turns yellow systemic fungicide (max twice per season for less susceptible varieties)."},{"index":13,"size":19,"text":"Late blight is the most damaging foliage disease. Ensure that you have access to appropriate fungicides prior to planting."},{"index":14,"size":11,"text":"1. What are the key symptoms of late blight in outbreak?"},{"index":15,"size":1,"text":"2."},{"index":16,"size":3,"text":"3. systemic fungicide?"}]},{"head":"Control of bacterial wilt","index":16,"paragraphs":[{"index":1,"size":30,"text":"Figure 10 • Bacterial wilt can infect the crop at all crop stages and can cause total failure of the crop. It is both a soil and seed borne disease."},{"index":2,"size":2,"text":"weed species."},{"index":3,"size":26,"text":"glass of water (exclusive property of oozing from the stem and moving downward in the water). In fact, every wilt is not caused by bacterial wilt."},{"index":4,"size":16,"text":"• Bacterial wilt causes plant to wilt even if there is enough water in the soil."},{"index":5,"size":16,"text":"• When a tuber is cut in half, black or brown rings can be seen. harvested."},{"index":6,"size":16,"text":"• The disease can spread via infected seed, water, roots, soil, farming tools, livestock and people."},{"index":7,"size":10,"text":"• There is no commercial chemical for controlling bacterial wilt."},{"index":8,"size":15,"text":"• The only way of control is to manage the disease through cultural practices :"},{"index":9,"size":34,"text":"--Rotating potato crops with other crops not belonging to the potato family, such as cereals (maize as -Uprooting wilting plants together with soil around roots, -Cleaning the tools before and after use, and -"}]},{"head":"Control of bacterial wilt","index":17,"paragraphs":[{"index":1,"size":25,"text":"There is no commercial chemical to control bacterial wilt. It is 1. What are the symptoms of bacterial wilt on the plant and tubers? 2."}]},{"head":"bacterial wilt?","index":18,"paragraphs":[{"index":1,"size":2,"text":"Figure 11"},{"index":2,"size":25,"text":"• Soft rot also known as blackleg is caused by a bacterium which has the exclusive characteristic of altering tuber tissue into liquid (no other"},{"index":3,"size":26,"text":"• Soft rot on infected tuber shows a decay from one spot which expand rapidly, resulting in rotting tissue that is mushy, slimy and water soaked."},{"index":4,"size":13,"text":"• In line with the disease triangle, high soil moisture favors the pathogen"},{"index":5,"size":13,"text":"• Blackleg symptoms appear as black lesions at the base of the stem."},{"index":6,"size":5,"text":"and then the plant collapses."},{"index":7,"size":12,"text":"• Manage this disease by applying control measures recommended for bacterial wilt "}]},{"head":"Control of viral diseases","index":19,"paragraphs":[{"index":1,"size":15,"text":"Figure 12 • In mild infections, plants can show no signs of disease at all."},{"index":2,"size":20,"text":"• One of the potato viral diseases that can be easily detected is potato leafroll virus because brittle and fragile."},{"index":3,"size":11,"text":"• There are many types of viruses from a diseased one."},{"index":4,"size":53,"text":"• What these viruses have in common is that they all lead to smaller potato tubers which farmers unknowingly select for seed, leading to further reduced yields during subsequent seasons (seed • Note that you may need at least two types of insecticides as certain products may not be appropriate to control aphids."}]},{"head":"Control of viral diseases","index":20,"paragraphs":[{"index":1,"size":15,"text":"No need to know the names of viruses. What is important is to diseased one."}]},{"head":"Why does the negative impact of viral diseases","index":21,"paragraphs":[{"index":1,"size":4,"text":"2. viral diseases? 3."}]},{"head":"Control of potato tuber moth","index":22,"paragraphs":[{"index":1,"size":6,"text":"move with tubers to the store."},{"index":2,"size":15,"text":"• Moth larvae penetrate tubers through the eyes and create twisting tunnels in the tubers."},{"index":3,"size":35,"text":"• They reproduce continuously in stored potatoes causing huge losses. They display fewer characteristic tunnels in stores but they have clearly visible excreta, mainly at the eyes. Oftentimes, these tubers become drier than healthy ones."},{"index":4,"size":13,"text":"• Potato tuber moth can be controlled by: fungicides and insecticides when spraying."},{"index":5,"size":49,"text":"-Avoiding planting in too light and loose soil, -Deep planting or high hilling up to protect the tubers, -Decontaminating the storage rooms before putting potatoes, -Inspecting the tubers carefully before and during storage and removing each tuber showing openings/galleries and/or excreta, and -Using natural repellent plants such as Lantana."}]},{"head":"Figure 13","index":23,"paragraphs":[{"index":1,"size":18,"text":"Control of potato tuber moth such as Lantana can help to reduce the impact of potato tuber moth."},{"index":2,"size":7,"text":"1. What is potato tuber moth (PTM)?"},{"index":3,"size":11,"text":"2. What are the symptoms of PTM on tubers in storage?"},{"index":4,"size":4,"text":"3. PTM in storage?"}]},{"head":"Control of nematodes","index":24,"paragraphs":[{"index":1,"size":18,"text":"• Two types of nematodes are known in potato production: potato cyst nematodes and root-knot nematodes (widely spread)."},{"index":2,"size":29,"text":"• Root-knot nematodes are the most common across the globe and they attack tubers and cause blemishes making tubers unmarketable. Infested potatoes can become more susceptible to bacterial wilt."},{"index":3,"size":29,"text":"• Damage from cyst nematodes shows expanding patches of poor growth. The plants are stunted, yellow or yellow-white and wilting. Over time, yields are reduced and tubers become small."},{"index":4,"size":22,"text":"• Note that it is safe to eat potatoes containing nematodes. Do not keep them for seed but you can eat them."},{"index":5,"size":15,"text":"• Nematodes management should focus on reducing nematode population to levels below the damaging threshold."},{"index":6,"size":5,"text":"• Management practices should include:"},{"index":7,"size":21,"text":"--Using healthy seed potatoes, reduce the quantity of nematodes found in the soil, and -Cultivating potato varieties that are less susceptible."}]},{"head":"Control of nematodes","index":25,"paragraphs":[{"index":1,"size":10,"text":"Nematodes are hard to eradicate once introduced in the soil."},{"index":2,"size":5,"text":"1. What is potato nematode?"},{"index":3,"size":9,"text":"2. What are the symptoms of nematodes on tubers?"},{"index":4,"size":2,"text":"3. nematodes?"},{"index":5,"size":30,"text":"s Figure 15 • Chemicals should be used carefully to ensure protection of the user and the environment because all chemicals are harmful and should be handled with much care."},{"index":6,"size":15,"text":"• The user should dress in recommended protective gear and follow instructions of safe spraying."},{"index":7,"size":10,"text":"• Many cases of pesticide poisoning occur in farming communities."},{"index":8,"size":40,"text":"• Chemicals should thus be the last resort once the farmer has exhausted other cultural or biological control mechanisms such as varieties with pest/disease resistance, healthy seed potatoes, rotation with other crops, organic pesticides (e.g., Neem) and integrated soil management."},{"index":9,"size":27,"text":"• When chemicals are mandatory (e.g., late blight), the farmer should not spray more than the dose required, nor exceed the treatment frequency recommended by the manufacturer."},{"index":10,"size":22,"text":"• The aim is to maintain pest populations and disease severity at acceptable levels while safe for human health and the environment."},{"index":11,"size":14,"text":"fungicides or insecticides should be applied during the last 2-3 weeks of the crop."},{"index":12,"size":15,"text":"• Disposal of chemical containers is also another societal issue that needs to be addressed."},{"index":13,"size":12,"text":"Please ONLY spray when necessary without exceeding the recommended dose and frequency."},{"index":14,"size":18,"text":"1. Why is it so important to be careful when using chemicals in general, and pesticides in particular?"},{"index":15,"size":5,"text":"2. to use a pesticide?"},{"index":16,"size":9,"text":"3. When is the use of pesticides strictly forbidden"}]},{"head":"Harvesting","index":26,"paragraphs":[{"index":1,"size":19,"text":"Figure 16 • Harvest should be done when the crop is well mature, at complete death of the vegetation."},{"index":2,"size":14,"text":"• Harvest should be done in dry weather and not when it is raining."},{"index":3,"size":10,"text":"• Potatoes can be harvested either manually or using machinery."},{"index":4,"size":17,"text":"• When harvesting manually, there are also two ways: directly by hand or by using a hoe."},{"index":5,"size":18,"text":"• Harvesting by hand takes longer and is more labor intensive, but produces good quality and undamaged tubers."},{"index":6,"size":18,"text":"• Using a hoe is less time-consuming and labor intensive, but some tubers are damaged in the process."},{"index":7,"size":16,"text":"• Use of motocultivator or tractor is by far less labor intensive and faster method than"},{"index":8,"size":30,"text":"• Tubers should be left on the ground for a while to allow any soil caked on them to dry remnants such as foliage residues, rotten tubers, etc (disease triangle)."}]},{"head":"Harvesting","index":27,"paragraphs":[{"index":1,"size":15,"text":"Never harvest before complete death of shoots if you wish to have a maximum yield."}]},{"head":"1.","index":28,"paragraphs":[{"index":1,"size":6,"text":"for maximum ware potato yield? 2."}]},{"head":"harvest? Why?","index":29,"paragraphs":[{"index":1,"size":2,"text":"Figure 17"},{"index":2,"size":9,"text":"• Tubers from diseased plants must be collected last."},{"index":3,"size":20,"text":"• Healthy looking tubers should then be graded, separating big tubers from small ones (depending on what the market demands)."},{"index":4,"size":20,"text":"• All tubers are not appropriate for processing. Only large tubers (over 60 mm) are normally used for chip making."},{"index":5,"size":2,"text":"establishing prices."},{"index":6,"size":16,"text":"• The cheating practice of displaying large tubers at the top of the bags while hiding"},{"index":7,"size":26,"text":"• Also, the use of bucket as a metric for transactions hides malpractices. Use of scales is the method that instills trust between seller and buyer."},{"index":8,"size":10,"text":"1. Why is it important to sort potatoes after harvest?"},{"index":9,"size":10,"text":"2. Why is it important to grade tubers after harvest?"},{"index":10,"size":16,"text":"3. What are the possible consequences of using buckets instead of a scale while selling potatoes?"},{"index":11,"size":11,"text":"uses, and thus the same value. Please grade your tubers and"},{"index":12,"size":16,"text":"• Oftentimes farmers do not care much about storing ware potato like they do for seed."},{"index":13,"size":17,"text":"• Tubers for consumption or the market provide long storability while maintaining good -Cool temperatures (below 20°C),"},{"index":14,"size":3,"text":"-Darkness, and -Ventilation."},{"index":15,"size":11,"text":"• Tubers exposed to direct sun light become green and poisonous."},{"index":16,"size":8,"text":"• Lack of aeration causes tubers to rot."},{"index":17,"size":2,"text":"of hygiene."},{"index":18,"size":14,"text":"1. Does it make any sense to care about storage of ware potatoes? Why?"},{"index":19,"size":14,"text":"2. What are the best conditions for a longer shelf life of ware potatoes?"},{"index":20,"size":14,"text":"3. Why is it recommended not to expose too long ware potatoes to sunlight?"},{"index":21,"size":16,"text":"Never eat or sell for consumption green tubers or tubers presenting green spots. They are poisonous."}]},{"head":"Legal notice","index":30,"paragraphs":[{"index":1,"size":15,"text":"As a federally owned enterprise, GIZ supports the German Government in achieving its objectives in "}]}],"figures":[{"text":"Figure 4 Figure 4 "},{"text":" Figure 5 "},{"text":"1. Figure 8 "},{"text":" Viruses are controlled by the combination of the following practices: --Controlling insects that can spread viral diseases (insecticides, traps, predators, etc), -Planting potato varieties that are less susceptible to viral diseases, and -Uprooting and destroying any other non-potato plants which can attract and host the vectors of viral diseases "},{"text":" Published by the : Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbHBonn and Eschborn, Germany to delivering sustainable solutions to the pressing world problems of hunger, poverty, and the © This publication is licensed for use under the Creative Commons Attribution 4.0 International License "},{"text":"It is highly recommended to wait at least 2 to 3 years before  1. What are the suitable climatic conditions for 1. What are the suitable climatic conditions for growing potatoes? growing potatoes? 2. Is it advisable to plant potatoes where you 2. Is it advisable to plant potatoes where you have harvested potatoes or crops of the same have harvested potatoes or crops of the same family during the previous season? Why? family during the previous season? Why? 3. What are the sister crops grown in your area? 3. What are the sister crops grown in your area?  "}],"sieverID":"c71b2d77-063d-41e3-8d92-78790e6bce41","abstract":""}

data/part_2/08f988594d993a943fb900cd555dad38.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08f988594d993a943fb900cd555dad38","source":"gardian_index","url":"https://digitalarchive.worldfishcenter.org/bitstream/handle/20.500.12348/4136/5f0af3ad0cbaa13db8a965301c32b636.pdf"},"pageCount":1,"title":"","keywords":[],"chapters":[],"figures":[],"sieverID":"677d5595-cd72-41d4-9d3a-f57d234de6c1","abstract":""}

data/part_2/0921da14be960076d9aefc70effdc51a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0921da14be960076d9aefc70effdc51a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2babd3b3-b3ca-4926-a505-e872f7b38140/retrieve"},"pageCount":1,"title":"Study #141 Contributing Projects: • P42 -Tailored Agro-Climate Services and food security information for better decision making in","keywords":[],"chapters":[],"figures":[],"sieverID":"c7f8af36-70ce-45ba-914e-d40a65006f87","abstract":""}

data/part_2/09283e749c76411cbd2e4fc4de8173f9.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09283e749c76411cbd2e4fc4de8173f9","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/59b139a6-6707-46e7-a3d8-a661bf7a933e/retrieve"},"pageCount":9,"title":"Poverty Impacts of Food Price Increases in Nigeria","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":75,"text":"Maize prices, represented by US No 2 yellow maize, followed a similar pattern, though the increase was greater, as shown in Figure 1. It spiked once in May 2021 at 77 percent above the pre-pandemic level, and again after the invasion of Ukraine, when it reached double the pre-pandemic price. Unlike the wheat price, the maize price has remained high. As of April 2023, the maize price was still 70 percent above the pre-pandemic level."},{"index":2,"size":74,"text":"The international price of sorghum rose even more than wheat or maize, reaching 116 percent above the pre-pandemic price in May 2021 and again in March 2022 following the invasion. Although the price has declined somewhat since then, it was still 86 percent above the pre-pandemic price in April 2023. Russia and Ukraine are not important exporters of sorghum, but sorghum prices typically follow maize prices because they are close substitutes as animal feed."},{"index":3,"size":66,"text":"Somewhat surprisingly, the price of Thai 100% B rice has remained relatively stable throughout the Covid-19 pandemic and during the war in Ukraine. The war had little effect on the production or transport of rice in world markets, much of which is centered on Asia. Rice prices began to creep up in early 2023 but were just 11 percent above the pre-pandemic level in April 2023."}]},{"head":"Figure 1. World prices of selected grains (January 2020=100)","index":2,"paragraphs":[{"index":1,"size":47,"text":"Source: FAO Global Information and Early Warning System. FAO (2023). Note: Wheat prices are for US soft red winter wheat. Maize prices are for US No. 2 yellow maize. Sorghum is represented by US sorghum prices at Gulf Ports. Rice prices are for Thai 5% broken rice."}]},{"head":"Grain prices in Nigeria","index":3,"paragraphs":[{"index":1,"size":215,"text":"What matters to farmers and consumers in Nigeria is not the trends in international markets, but the prices they face in domestic markets. Thus, the question is how much of the shocks in international markets are transmitted to domestic grain markets in Nigeria? Without an international price shock, we would expect domestic prices to rise at the rate of inflation in the country. An increase in international prices should cause domestic prices to rise faster than inflation; that is, it causes the real (inflation-adjusted) domestic price to rise. Econometric analysis suggests that shocks in international food prices are generally not fully transmitted to domestic markets, implying that domestic prices generally rise by a smaller proportion than the increase in international prices of the same commodity (Minot, 2011;Ceballos et al., 2017). There are several reasons for this. First, if the marketing margin between international and domestic prices is fixed in monetary terms, the domestic prices in an importing country (which are generally higher than international prices) will rise by a smaller percentage than the international price. Second, local and imported grains may be somewhat different to consumers, making them imperfect substitutes for each other. Third, the government may reduce tariffs when world prices increase, thus insulating domestic consumers from the full shock (Martin and Minot, 2022)."},{"index":2,"size":104,"text":"Table 1 shows the changes in the world price (expressed in US$), local nominal prices, and the local real price for three staple grains: wheat, maize, and sorghum. Rice is not included in the analysis because international prices have been relatively stable. The analysis covers four time periods: February 2020 (pre-pandemic), January 2022 (pre-invasion), May 2022 (peak international prices), and July 2022 (post-peak). The analysis does not extend beyond July 2022 because, as shown in Figure 1, the world prices of wheat, maize, and sorghum in the second quarter of 2023 have remained in the same broad range as they were in July 2022."},{"index":3,"size":110,"text":"Because wheat prices are not available for Nigeria, we use the retail price of bread. Between February 2020 and May 2022, when international prices peaked, the world price of wheat rose 76 percent, before falling back somewhat, remaining 25 percent above the pre-pandemic price. Source: IMF (2022) for international sorghum price. FAO (2023a) for others. The international prices are the US soft red winter wheat price, the US No 2 yellow maize price, and the US International Grain Council price of sorghum. The local prices are the retail price of bread in Damaturu, the wholesale price of white maize in Lagos, and the wholesale price of white sorghum in Lagos."},{"index":4,"size":203,"text":"Over this period, the nominal price of bread in Nigeria was relatively stable, dipping prior to the Ukraine war and then rising back to the pre-pandemic level. Given that the inflation rate in Nigeria rose from 12 percent in early 2020 to over 20 percent in early 2023, this implies that the real (inflation-adjusted) price of bread actually fell by about 30 percent over the period. Because the world price of wheat increased and the domestic real price of bread fell, the price transmission ratio was -120 percent. The government of Nigeria faces considerable pressure from urban consumers to keep the price of bread low. Because Nigeria depends on imports for 90 percent of wheat products, both import and foreign exchange policies affect bread prices. Wheat and flour can be imported at the official exchange rate, which has become increasingly overvalued in recent years. Because exchange rate overvaluation creates shortages of foreign exchange, reflected in high parallel market exchange rates, a policy of supplying enough foreign exchange to meet market demand at the official exchange rate requires a strong bias in foreign exchange allocation in favor of wheat imports. This may have occurred and played a role in dampening price increases for bread."},{"index":5,"size":97,"text":"In the case of maize and sorghum, the international price more than doubled between February 2020 and July 2022. The nominal price of these commodities in Nigeria also more than doubled, and the domestic real prices of maize and sorghum rose by 62 percent and 56 percent, respectively. As a result, the price transmission ratio was 79 percent for maize and 62 percent for sorghum, reflecting incomplete transmission of the international price shocks to domestic markets. This is not surprising given that Nigeria is essentially self-sufficient in both commodities, importing less than 2 percent of domestic requirements."}]},{"head":"Income and spending patterns","index":4,"paragraphs":[{"index":1,"size":84,"text":"How do staple food price changes affect household income? These impacts vary widely across households depending on the importance of the commodity as a source of income and its share in the household budget. Households that produce and sell the commodity gain from higher prices, while those that are net buyers lose. The percentage change in income will be proportional to the magnitude of the price change and the net sales of the commodity (positive or negative) as a share of income (Deaton, 1989)."},{"index":2,"size":123,"text":"The first column of Table 2 shows the importance of maize, sorghum, and wheat in the Nigerian diet. Maize is the most important of the three, contributing 12.3 percent of the calories on average. Maize is the second most important food in terms of caloric intake, after yams. After maize, cassava and rice are third and fourth in caloric contribution. The analysis does not consider yams and cassava because there is no international trade in yams and cassava for human consumption. Rice is excluded from the analysis because, as discussed earlier, international rice prices have been relatively stable over the period under consideration. Sorghum and wheat are the fifth and sixth most important items in the Nigerian diet in terms of caloric intake."},{"index":3,"size":173,"text":"The second and third columns show the importance of each commodity as a source of household income and as a component in household budgets. The last column gives the net benefit ratio, defined as the income share minus the expenditure share, that is, net sales as a proportion of household income. The net benefit ratio can be interpreted as the short-run elasticity of real income with respect to price changes. Maize and sorghum show rough parity between income and expenditure shares, reflecting the fact that Nigeria neither imports nor exports large quantities of these commodities. On the other hand, wheat is important in expenditure but negligible as a source of income, which is expected given that 90 percent of the wheat and wheat products consumed in Nigeria are imported. Thus, average household income is much more sensitive to changes in bread prices than changes in maize and sorghum prices. For maize and sorghum, the losses of consumers due to higher prices are offset by the gains to farmers who grow and sell it."},{"index":4,"size":76,"text":"The impact of price changes on the incidence of poverty is particularly sensitive to the net benefit ratio of households near the poverty line. For these households, a price change may affect their income enough to nudge them above or below the poverty line. Low-income households generally spend a larger share of their budget on staple grains, but they are also more likely to be farmers. The effect on the net benefit ratio is, therefore, mixed."}]},{"head":"Poverty impact of grain price increases","index":5,"paragraphs":[{"index":1,"size":118,"text":"The simulation of the impact of staple food price changes on poverty in Nigeria is based on the real price changes of maize, sorghum, and wheat products in domestic markets combined with information about the income and expenditure patterns of each household in a nationally-representative survey. Real (inflation-adjusted) price changes are used to capture the impact of the rise in grain prices relative to the prices of other goods. The analysis does not attempt to measure the welfare impact of general inflation. Such an analysis would be challenging because of the need for data on which incomes and prices rise with inflation (such as agricultural prices) and which ones tend to lag behind inflation (such as formal-sector wages)."},{"index":2,"size":107,"text":"The results are shown below in Figure 2. Overall, the simulations indicate that the higher prices for maize, wheat, and sorghum in international markets have had little effect on the incidence of poverty in Nigeria. The national poverty rate remains close to 39.1 percent, while the rural poverty rate is stable close to 46.4 percent. The urban poverty rate actually declines slightly from 16.1 percent in the pre-pandemic period to 15.8 percent in July 2022. These results are unusualin the other five countries where this analysis has been carried out, the poverty rate rises by 1-3 percentage points as a result of the higher staple food prices."},{"index":3,"size":182,"text":"There are two explanations for these unexpected results. First, the net benefit ratios for maize and sorghum are close to zero for the average household and for households close to the poverty line. This means that the losses for consumers due to higher maize and sorghum prices are offset by benefits to farmers growing and selling these commodities. Second, in the case of wheat, the negative net benefit ratio suggests that higher prices for wheat products would reduce income and increase the prevalence of poverty. However, domestic policies have prevented the higher wheat prices from being transmitted to domestic Nigerian markets. More specifically, the government maintains the official exchange rate below the market rate, creating excess demand for foreign currency. It appears that wheat and flour importers may have been given valuable allocations of foreign currency at the low official rate, implicitly subsidizing bread prices. In September 2022, the official exchange rate was 460 naira/USD, while the parallel market rate was 715 naira/USD. Thus, the official rate was 64 percent below the official rate, the largest gap in six years (Mojeed, 2022)."},{"index":4,"size":45,"text":"These policies reduced the domestic real price of bread in spite of the rising international price of wheat. The lower price of bread is estimated to have actually reduced poverty in urban areas, thanks to the relative importance of bread in urban areas of Nigeria."}]},{"head":"Figure 2. Impact of staple grain price changes on poverty in Nigeria","index":6,"paragraphs":[{"index":1,"size":20,"text":"Source: Authors' calculations based on changes in real prices of maize, wheat, and sorghum and household income and expenditure patterns."}]},{"head":"Sensitivity of results to alternative assumptions","index":7,"paragraphs":[{"index":1,"size":79,"text":"In this section, we compare the main results from Figure 2 with the poverty impact under two alternative sets of assumptions. We estimate the impact on poverty 1) if the world price shocks in the three commodities had been fully transmitted to domestic markets and 2) if we included both the increase in the real price and the increase due to inflation for the three commodities, while also assuming that other prices and income are fixed in nominal terms."},{"index":2,"size":78,"text":"As discussed earlier, the shocks in international prices are frequently not fully transmitted to domestic markets. What would the poverty impact be if the international price shocks were fully transmitted, that is, if the domestic real prices of wheat, maize, and sorghum rose in the same proportion as international prices did? Figure 3 compares the estimated actual change in poverty from Figure 2 (in green) with the hypothetical change in poverty assuming full transmission of shocks (in blue)."},{"index":3,"size":120,"text":"While the estimated impact on poverty in Nigeria was almost negligible, if international price changes for the three staple food commodities had been fully transmitted to domestic markets, the impact on poverty would have been substantial. More specifically, the national poverty rate would have increased by 1 percentage point in February 2022, just before the invasion of Ukraine, and an additional 1 percentage point in May 2022, when world prices peaked, before subsiding as international prices declined. The bulk of this increase in poverty would have been due to the increase in the price of bread in Nigeria. As discussed earlier, income and poverty rates in Nigeria are not particularly sensitive to changes in the price of maize and sorghum."},{"index":4,"size":222,"text":"Thus, the results suggest that the overvalued exchange rate and the prioritization of wheat and flour imports in allocating scarce foreign currency were successful in preventing higher international food prices from increasing poverty in Nigeria. However, this does not necessarily imply that the policy of currency controls and overvaluation is justified by this outcome. First, it does not take into account uncertainty, the misallocation of scarce foreign currency, and the risk of rent-seeking behavior associated with having the government allocate a scarce resource administratively, favoring some imports and importers over others. In addition, the implicit subsidy on bread was not well targeted, with a majority of the benefits accruing to non-poor households. The same level of poverty reduction could have been achieved in a more cost-effective manner through some form of targeted assistance such as a cash-transfer program. Source: Authors calculations based on changes in real prices of maize, wheat, and sorghum and household income and expenditure patterns. Note: Our best estimate of the poverty impact of international shocks uses domestic real price changes (in green). Full transmission of international shocks is represented by the world price changes (in blue). And the domestic nominal price increase (in red) describes the impact of both international shocks and inflation on the three commodities, while assuming other prices and income are fixed in nominal terms."},{"index":5,"size":117,"text":"The overvalued exchange rate and prioritization of wheat and flour imports is a type of insulation policy, designed to protect domestic food markets from international price volatility. On a global level, insulation policies inhibit the adjustment of domestic food markets to changes in international prices, particularly grain prices. As such, they exacerbate the volatility in international grain markets. Martin and Minot (2023) found that insulation of domestic markets following the invasion of Ukraine likely doubled the spike in international wheat prices. A few large countries (notably India and China) were responsible for much of this magnification. Thus, insulation is a double-edged sword: it protects domestic markets from international shocks, while simultaneously exacerbating the size of those shocks."},{"index":6,"size":158,"text":"The second alternative is to estimate the poverty impact of the increase in domestic nominal prices of the three commodities, which is the combination of the increase in the real price and the increase associated with domestic inflation, while assuming that all other prices and incomes are fixed in nominal terms over the being examined. The results are shown in red in Figure 3. In this scenario, the poverty rate would increase 0.4 percentage points by January 2022, 0.8 percentage points by the peak in April 2022, and remain at that level in July 2022. The poverty increase in this case is greater than in the main simulation, but less than in the hypothetical case of full transmission of the international price shock. As noted above, this likely overstates the poverty impact of the world grain price rise since it includes the effect of inflation on the three commodity prices and excludes the effect of inflation on incomes."}]},{"head":"Summary","index":8,"paragraphs":[{"index":1,"size":74,"text":"International commodity prices rose in the wake of the Covid-19 epidemic and spiked sharply in the first months of the war in Ukraine. This was particularly true in the case of wheat and maize because of the importance of Russia and Ukraine as exporters of these commodities. A critical question was: will the higher prices for wheat, maize, and other staple grains have an adverse effect on poverty and food security in low-income countries?"},{"index":2,"size":225,"text":"In the case of Nigeria, we find that the real price of maize and sorghum increased over 2020-2022 but by less than the increase in world prices, as expected. In contrast, the real price of bread in Nigeria declined in real terms over this period, at least in part because of increasing overvaluation of the naira and the prioritization given to wheat and flour imports in allocating scarce foreign currency. When combined with information about the spending patterns and composition of income, these staple grain price changes had a negligible effect on national poverty rates. This is explained by the fact that poverty is not sensitive to increases in maize and sorghum prices, since gains to farmers offset the losses of consumers. Higher wheat prices would have increased poverty, but wheat prices were kept stable in nominal terms and pushed down in real terms. The analysis finds that if world price shocks were fully transmitted to domestic markets in Niger, the increase in poverty would have been in the range of 1-2 percentage points. The overvaluation and prioritization of wheat and flour imports prevented poverty from rising due to higher prices for staple foods on world markets, but it seems likely that alternative programs could have achieve this end without distorting the market for foreign currency and with less leakage of benefits to non-poor households."},{"index":3,"size":78,"text":"This study is part of a series of case studies that IFPRI is undertaking to assess the impact of higher commodity prices on income and poverty in developing countries. The analysis presented is an initial impact assessment designed to estimate the impact of higher food prices on poverty in selected countries. The initial set of case studies covers Ethiopia, Kenya, Nigeria, Niger, Burkina Faso, and Mali. The analysis may be extended to cover other countries in the future."}]}],"figures":[{"text":"Figure 3 . Figure 3. Sensitivity of the poverty impact to alternative assumptions "},{"text":"Table 1 . International and domestic cereal prices in Nigeria    Price index (100 = February 2020) Price Price index (100 = February 2020)Price Commod- Price type Pre-Covid Pre-inva- Peak Post-peak transmis- Commod-Price typePre-CovidPre-inva-PeakPost-peaktransmis- ity  (Feb 2020) sion (May 2022) (July 2022) sion ratio ity(Feb 2020)sion(May 2022)(July 2022)sion ratio    (Jan 2022)    (Jan 2022)  World (US$) 100 130 176 125 -- World (US$)100130176125-- Wheat Local nominal 100 86 102 104 -- WheatLocal nominal10086102104--  Local real 100 64 71 70 -120% Local real100647170-120%  World (US$) 100 161 201 178 -- World (US$)100161201178-- Maize Local nominal 100 215 244 239 -- MaizeLocal nominal100215244239--  Local real 100 160 170 162 79% Local real10016017016279%  World (US$) 100 205 229 190 -- World (US$)100205229190-- Sorghum Local nominal 100 222 235 229 -- SorghumLocal nominal100222235229--  Local real 100 165 164 156 62% Local real10016516415662%  "},{"text":"Table 2 . Importance of selected commodities in caloric intake, income, and expendi- ture in Nigeria Sources: Caloric contribution fromFAO Food Balance Sheets, 2021 (FAO, 2023). Budget shares from the Povana database(Mamun and Laborde, 2021). Includes derived products such as flour and bread.  Caloric contribution  Budget shares  Caloric contributionBudget shares  to the diet (%) Income Expenditure Net benefit to the diet (%)IncomeExpenditureNet benefit   share (%) share (%) ratio (%) share (%)share (%)ratio (%) Maize 12.3 2.2 2.3 -0.1 Maize12.32.22.3-0.1 Wheat 7.6 0.0 2.8 -2.8 Wheat7.60.02.8-2.8 Sorghum 8.3 1.1 1.6 -0.6 Sorghum8.31.11.6-0.6  "}],"sieverID":"04377e52-a093-4150-9777-732b85c51bc8","abstract":"The prices of staple grains on international markets began to rise in mid-2020 in response to higher fertilizer prices and supply constraints associated with the Covid-19 pandemic. They further spiked in early 2022 following the invasion of Ukraine by Russia. This brief examines the impact of these events on poverty in Nigeria. It is part of a series of six such briefs that estimate the poverty impact of higher world prices for staple grains. The other briefs cover Kenya,"}

data/part_2/092ce3b7a8c00563fe51dfb719aa16bb.json

@@ -0,0 +1 @@
+{"metadata":{"id":"092ce3b7a8c00563fe51dfb719aa16bb","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/adc00532-2f71-4447-9f74-1eb11e33c24a/retrieve"},"pageCount":10,"title":"Developing optimal branding strategies in food markets segmented by cultural and colonial heritage: Evidence from rice in Senegal","keywords":[],"chapters":[{"head":"Cultural and Colonial heritage","index":1,"paragraphs":[{"index":1,"size":21,"text":"• Two rice markets have been identified in Senegal with diverging preferences between domestic and international branding (Costello et al. 2013)."},{"index":2,"size":6,"text":"• It would be expected that:"}]},{"head":"Cultural heritage will drive preferences for local brands, with","index":2,"paragraphs":[{"index":1,"size":7,"text":"Colonial heritage driving preferences for foreign brands"},{"index":2,"size":9,"text":"• However, this question has never been formally researched."}]},{"head":"Research Objectives","index":3,"paragraphs":[{"index":1,"size":4,"text":"Study's objectives were to:"},{"index":2,"size":12,"text":"ØElicit preferences for local versus international rice brands among urban Senegalese consumers."},{"index":3,"size":12,"text":"ØTo understand the role of colonial and cultural heritage in brand preferences."}]},{"head":"Design of brands","index":4,"paragraphs":[{"index":1,"size":13,"text":"Study employs a dataset from auction experiments conducted by Costello et al. (2013)."},{"index":2,"size":17,"text":"Brands were specially designed following a review of available market brands. These did not duplicate existing brands."},{"index":3,"size":8,"text":"Local brands depicted traditional Senegalese symbols: e.g., drum"},{"index":4,"size":17,"text":"Foreign brands depicted concepts like freedom (star), happiness (also with a star) and nobility (with a crown)."},{"index":5,"size":14,"text":"Four of eight brands were subsequently selected -two local brands, and two international brands. "}]},{"head":"Experimental Auction Procedures","index":5,"paragraphs":[{"index":1,"size":20,"text":"• Women participants were sampled from urban markets in two large cities in Senegal: St. Louis and Dakar (~240 participants)."},{"index":2,"size":21,"text":"• Four 50kg bags of rice each displaying one of the four brands were showcased, featuring the fragrant Sahel 329 rice."},{"index":3,"size":11,"text":"• A two-stage process was followed to elicit labeling preference: 1."},{"index":4,"size":19,"text":"Participants indicated a preference between one local vs one foreign branded bag of rice from 2 meters away. 2."},{"index":5,"size":13,"text":"Participants inspected rice in each of the two bags and restated their preference."},{"index":6,"size":18,"text":"• Given response in the second stage, participants were endowed with a 1kg bag of their non-preferred rice."},{"index":7,"size":22,"text":"• They then submitted their willingness to pay (WTP) to exchange their endowed bag for a 1kg bag from their preferred brand."}]}],"figures":[{"text":" ØLocal brands: Sunu Ceeb (our rice) & Ndanane (noble) Ø International brands: Happiness & Noblesse "},{"text":"  "}],"sieverID":"d29aa0ac-5de9-4163-bc63-174eebf2e0e7","abstract":".• Rice has emerged the de facto staple in the Global South with governments encouraging local production.• Consumers in sub-Saharan Africa (SSA) have consistently demonstrated preferences for quality attributes, often associated with imported versions.• Extrinsic attributes such as \"foreignness\" is perceived by some SSA consumers as a quality cue.• In marketing local rice, the conundrum is whether to differentiate or undifferentiate domestic from imported rice."}

data/part_2/09bc0469d06db55d446e4b74eea5f827.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09bc0469d06db55d446e4b74eea5f827","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3869b705-8a9e-4a7f-9cb3-0c7f42143b91/retrieve"},"pageCount":12,"title":"History and Characteristics","keywords":[],"chapters":[{"head":"Indexation","index":1,"paragraphs":[{"index":1,"size":40,"text":"The Journal is indexed in the core collection of Science Citation Index Expanded and two additional indexes of Clarivate Web of Science, which provides the best-known impact factor indicator (formerly: ISI Journal Impact Factor). The 5-year Impact Factor is 0.897."},{"index":2,"size":50,"text":"TGFT is also indexed in Scopus, and the CiteScore for 2022 was 2.1, making a considerable progress since 2017 (0. SciELO was created to meet the scientific communication needs of developing countries (with focus on Latin America) and provides an efficient way to increase visibility and access to scientific literature."},{"index":3,"size":67,"text":"In 2019, the Journal was included in the National Bibliographic Index (Publindex) of the Colombian Ministry of Science Technology and Innovation, based on indicators and standards of scientific quality at international level. In the 2020 classification the journal was ranked as \"A2\", in accordance with the fulfillment of the internationally recognized evaluation criteria for scientific publications related to the processes of: editorial management, evaluation, visibility and impact."},{"index":4,"size":45,"text":"In 2019, the Journal was also included in the Regional Online Information System for Scientific Journals of Latin America, the Caribbean, Spain and Portugal (Latindex), a network of institutions that work jointly to gather and disseminate information of serial scientific publications produced in Latin America."},{"index":5,"size":31,"text":"Jisc Sherpa Services is an online resource that aggregates and analyzes publisher open access policies from around the world. According to this analysis, the Journal has a Diamond Open Access compliance."},{"index":6,"size":81,"text":"Updated annually, the MIAR database gathers key information for the identification and analysis of journals. The system creates a correspondence matrix between the journals, and the databases and repositories that index or include them. The ICDS (Composite Index of Secondary Dissemination in Spanish) is an indicator that shows the visibility of the journal in different scientific databases of international scope. A high ICDS means that the journal is present in different information sources of international relevance. The ICDS 2021 was 10.4"}]}],"figures":[{"text":" 9), 2018 (1.0), 2019 (1.3), 2020 (1.5), and 2021 (1.9) CiteScore is the way how Scopus measures the impact of its indexed journals. The SCImago Journal & Country Rank is a portal that includes the journals and country scientific indicators developed from the information contained in the Scopus® database (Elsevier B.V.). These indicators can be used to assess and analyze scientific domains. For 2022, the Journal had a score of 0.26, and in 2019 was ranked in the second highest value amongst the set of agronomy journals ranked by SJR (Q2). Since 2018, the Journal is indexed in SciELO, a bibliographic database, digital library, and cooperative electronic publishing model of open access journals. "},{"text":"  "},{"text":"  "},{"text":"Tropical Grasslands-Forrajes Tropicales Online Journal ISSN: 2346-3775 www As per September 2022, Tropical Grasslands-Forrajes Tropicales has published 385 papers, 177 in special issues (115 contributions to the International Grassland Congress 2013 and 62 contributions to the International Leucaena Conference 2018), and 208 in regular issues. Articles published     Articles published Year Volume No. Issue No. No. of articles Regular issues Special issues Year Volume No. Issue No.No. of articlesRegular issuesSpecial issues 2013 1 1-2 (special) 57  57 2013 11-2 (special)5757 2014 2 1 (special); 2-3 72 14 58 2014 21 (special); 2-3721458 2015 3 1-3 17 17  2015 31-31717 2016 4 1-3 19 19  2016 41-31919 2017 5 1-3 16 16  2017 51-31616 2018 6 1-3 17 17  2018 61-31717 2019 7 1; 2 (special); 3; 4 (special); 5 79 17 62 2019 71; 2 (special); 3; 4 (special); 5791762 2020 8 1-3 32 32  2020 81-33232 2021 9 1-3 42 42  2021 91-34242 2022 10 1-3 34   2022 101-334  "}],"sieverID":"b521ce45-f111-4f0b-8ac4-d01c9a8c389e","abstract":"Lyle Winks and Rainer Schultze-Kraft have been the editors of the Journal from 2013 to 2020. Throughout their tenure, they have demonstrated remarkable consistency and accuracy in their work. They have played a crucial role in ensuring that the renewed Journal became s a trusted source of information for the tropical grasslands research community. Their commitment to maintaining the highest standards of quality is evident in the rigorous review process they have implemented, ensuring that all articles published in the journal meet the necessary standards for accuracy and relevance. Their efforts have not only helped to elevate the quality of the journal but have also contributed significantly to the advancement of tropical forage and grasslands research."}

data/part_2/09c8ee3ed2b0a6eab4b38373ecc5f7a7.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09c8ee3ed2b0a6eab4b38373ecc5f7a7","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d6beae48-0f15-46d3-aca9-725b0744a985/retrieve"},"pageCount":5,"title":"","keywords":[],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":77,"text":"Small ruminants, such as sheep and goats, are critically important in sustaining livelihoods in rural Ethiopia. In fact, their importance is growing compared to other species. Bachewe et al (2018) recently reported that within the livestock sector, the cattle output is declining while share of small ruminants is on the rise. Despite their importance and growing population, the attention given to improving production, productivity and marketing of small ruminants, or livestock in general, is far from satisfactory."},{"index":2,"size":99,"text":"Taking marketing as a case in point, limited access to markets and lack of infrastructure have curtailed the level of value addition along the livestock chain. Mistreatment by brokers and traders, poor infrastructure, lack of price information and absence of a well-functioning standardized marketing information system has limited the benefit that accrues to smallholder sheep and goat keepers (Kocho et al. 2011). Therefore, facilitating livestock marketing by reducing transaction costs, for example through improving access to market information, can be vital to uplifting the lives of poor smallholders and improving the contribution of the livestock sector to the economy."}]},{"head":"THE EXPERIMENT","index":2,"paragraphs":[{"index":1,"size":76,"text":"The innovation was tested through an experiment implemented in eight randomly selected intervention [information receiving] and eight control [non-recipient] markets in Menz-Gishe area of North Shewa zone in central Ethiopia (Table 1). In 2016/7, fifty small ruminant keeping households were randomly selected in each market and interviewed using a structured questionnaire aimed at developing baselines. The experiment was conducted for 12 months in 2017/2018. Once the experiment was concluded, an end-line survey was conducted in 2018/2019."},{"index":2,"size":74,"text":"The implementation of the experiment included distribution of mobile phones for all participating farmers as the reconnaissance survey we conducted showed only four percent of the households owned mobile phones. Then, the weekly data collection and relaying back to farmers every two weeks started right after the phones were handed out. By the end of the experiment, data was collected over 50 weeks and 25 rounds of information was sent to the treated farmers."},{"index":3,"size":89,"text":"2 -SmaRT Ethiopia / Impact of market information on market participation and income of small ruminant keepers Studies show that because of poor access to market information, among other factors, the margins smallholder farmers make are limited (Kassie et al. 2019). Also, these farmers seldom venture past small local rural markets to sell their produce or buy their daily necessities (Kocho et al. 2011). Increased access to market information reduces the costs, hidden and observable, of exchange. As a result, the markets will offer better prices for smallholders' produce."},{"index":4,"size":141,"text":"Although there have been efforts to establish market information systems in Ethiopia, farmers have not benefited from these efforts. The main organized marketing information system for the livestock sector in Ethiopia is the National Livestock Market Information System (NLMIS), a government initiative launched in 2019. The system works via mobile text messaging from a central server where price and volume information are aggregated by livestock, breed, age, sex and grade for 47 markets spread across the country. The database is updated regularly. The NLMIS has reduced duplication of effort at different levels of government, improved digitizing, analysis and packaging of livestock market information for dissemination, reduced delay in market data transmission, and set standard for generating comparable data. However, awareness about the NLMIS itself and the technological difficulties to access its services remain limiting factors to its widespread use (Kebebe 2019)."},{"index":5,"size":133,"text":"Empirical evidence is required to inform decision makers on why market information is needed and how systems providing it can be established. However, this empirical evidence is not available because Ethiopia never had a functioning livestock market information system that reached out to farmers. To fill this glaring gap, the International Center for Agricultural Research in the Dry Areas (ICARDA), in collaboration with its national and international partners, implemented an innovative experiment entitled 'Smart Marketing for the development of small ruminant value chains in Ethiopia'. This brief summarizes key policy findings of a recent report entitled \"Impact of market information on market participation and income of small ruminant keepers: Application of Doubly Robust Difference-in-Differences.\" The report presents panel data-based analysis of the impacts of the market information intervention in the smart marketing project."},{"index":6,"size":115,"text":"A market information framework was developed to manage the generation, synthesis and communication of sheep and goat market information. Market data were collected on trait preferences, price expectations, quantity demanded, quantity supplied, availability of and access to market services and key social [e.g. extraordinary social occasions] and environmental [e.g. profound shifts in the weather] phenomena. The data were generated weekly in each market using a structured questionnaire. Two waves (weeks) of data were compiled, cleaned and analyzed. The information was then packaged in a user-friendly and concise way for easier dissemination and use. Every two weeks text messages were sent to the mobile phone of every farmer who was part of the smart marketing experiment."}]},{"head":"THE INNOVATION","index":3,"paragraphs":[{"index":1,"size":41,"text":"The changes at household level were monitored every month through group discussions with treated farmers and feedbacks from field coordinators. The monitoring helped in capturing the behavioral and progressive changes identified by farmers themselves. The changes reported by treated farmers include:"},{"index":2,"size":93,"text":"• Higher confidence in bargaining prices for their small ruminants. • More frequent and richer communication among themselves on livestock market related issues. • Sense of empowerment and hence being more comfortable in going to the market. They indicated to be less concerned about the hustle they used to experience in the markets. • Changes in marketing behavior such that farmers were able to postpone their selling and buying decisions. Farmers in the area, and poor rural communities in general, hardly had the information or market understanding to consider postponing as an option."},{"index":3,"size":44,"text":"We also collected two rounds of data on 800 households before after the experiment. The estimated doubly robust difference-in-differences models revealed the effects of the access to information on income from small ruminants, annual cash income and net small ruminant sales at household level."},{"index":4,"size":93,"text":"The farmers who received market information from the project generated 20.1% higher income from their small ruminants within a year. Farm households in Menz-Gishe area depend very heavily on their small ruminants. A 20% increase in the income from small ruminant per annum might not sound so high but it means a lot to the poor households who eke out their living in one of the harshest environments in the country. Given the importance of the small ruminants in the study areas, investing in market information would significantly change the livelihoods of farmers."},{"index":5,"size":87,"text":"Households who received the market information also generated 32% higher aggregate cash income compared to non-recipients. Income generated from small ruminants has a multiplier effect because those who received market information were able to generate more income from non-small ruminant related activities as well. Being involved in market transactions improved their access to key inputs and services needed for production and marketing purposes. It is therefore justified to argue that the access to market information has significantly improved the cash income of small ruminant keepers in Ethiopia."},{"index":6,"size":75,"text":"One of the most common ways of estimating market participation is net sales. The net sale is the difference between total small ruminant sales and purchases within a year. The analysis revealed that farm households who received market information annually sold 85.5% more small ruminants compared to nonrecipients. Farmers reported that they felt confident to take their animals to the market and as a result sold their animals more often than non-recipients of the information."},{"index":7,"size":17,"text":"SmaRT Ethiopia / Impact of market information on market participation and income of small ruminant keepers -3"}]},{"head":"Distributing mobile phones for the participants. It was found that only four percent of the participating households owned a mobile phone.","index":4,"paragraphs":[{"index":1,"size":8,"text":"A small ruminant market in Yabello, Southern Ethiopia."},{"index":2,"size":4,"text":"Photo ICARDA/Girma T. Kassie"},{"index":3,"size":4,"text":"Photo ICARDA/Girma T. Kassie"}]},{"head":"OUTCOMES AND EVIDENCE","index":5,"paragraphs":[{"index":1,"size":17,"text":"4 -SmaRT Ethiopia / Impact of market information on market participation and income of small ruminant keepers"}]},{"head":"DRIVERS AND SUCCESS FACTORS LESSONS LEARNED AND CONSIDERATIONS FOR SCALING","index":6,"paragraphs":[{"index":1,"size":63,"text":"If agricultural transformation is a genuine national agenda, livestock market development is an activity Ethiopia cannot afford to undermine. Market development generally revolves around reducing information asymmetry and minimizing transaction costs. Small ruminants serve many purposes in the study area. Farmers are very keen to receive support that minimizes the market risk and/or increase the likelihood of receiving higher prices for their animals."},{"index":2,"size":85,"text":"With the help of farmers, a number of factors were identified to determine how to design and implement successful livestock market information systems. An important starting point is creating awareness among farmers and other disadvantaged market actors on the mechanics of price discovery in the markets and the role access to information plays. Informed farmers will look at the traders and the brokers -two of the most powerful actors in Ethiopian livestock markets -differently once they understand the essence of information asymmetry and its implication."},{"index":3,"size":86,"text":"The second important consideration is the functional definition of livestock market information. Classical information systems focus entirely on price, with little to no regard for other key factors that determine demand and supply. It is essential to understand the key determinants of demand and supply in the markets and tailor the information accordingly. By including information on traits of small ruminants in the markets and potential demand and supply shocks in the package, farmers were able to grow in confidence to bargain for a better price."},{"index":4,"size":89,"text":"Another key observation made was that market information needs to be presented to the farmers as frequently as possible to keep them up-to-date and enable them to make informed decisions in time. Every two weeks messages were sent to increase the depth of the information and hence the confidence we have in it to help farmers make decisions based on it. Nevertheless, farmers were continuously asking for a weekly update on the markets. It is worth noting that the need for information grows once it starts to become available."},{"index":5,"size":87,"text":"Information is more useful if it covers higher number of relevant markets and species of animals. Farmers wanted to know more about what was happening in other markets after being very comfortable about their own markets. They are aware of the arbitrage collectors and traders are benefiting from due to the poor integration of markets. Similarly, including more species of animals in the information system will help farmers make better decisions, as there is considerable level of substitution and complementarity among the species in relation to marketing."},{"index":6,"size":85,"text":"Developing livestock markets requires a carefully designed market information system to reduce marketing risk and increase farmers' bargaining power. Timely and adequate market information is essential to bridge the gap between livestock potential and the benefits generated from it. It is clear that the market information provided at experimental level was very useful for farmers in the study area. These empirical findings can be scaled up with the right institutions and procedures. Five issues were identified that could help scale up the market information system:"},{"index":7,"size":28,"text":"1. The accessibility of mobile phones and internet is growing in rural Ethiopia. Hence, livestock market information can be made available widely by developing affordable and userfriendly platforms."},{"index":8,"size":28,"text":"2. The new development in opening up the telecommunication services is an encouraging sign, but the private sector needs to be involved more to ensure competitiveness and efficiency."},{"index":9,"size":45,"text":"3. NLMIS can serve as a solid foundation to build a comprehensive livestock market information system. Millions of livestock keeping households can be reached if NLMIS focuses on farmers' needs and capabilities, and considers the heterogeneities between markets and marketers in synthesizing the raw data."},{"index":10,"size":21,"text":"4. The national agenda of agricultural transformation is an important opportunity to justify investment into developing the livestock market information system."},{"index":11,"size":26,"text":"5. Introducing livestock marketing information, like any other new product, entails introducing what it is and why it is useful for the smallholder small ruminant keepers."},{"index":12,"size":56,"text":"Awareness campaigns and advertisements will go a long way toward enhancing the impact of marketing information on livestock market performance. Round photo: Ayeleche Alato with her prize winning goats in Bonga, Jimma, Ethiopia. Small ruminant farmers like Ayeleche would benefit from better market information, which would enable them to get the best value from their animals."}]},{"head":"Saarr is a pastoralist in","index":7,"paragraphs":[]}],"figures":[{"text":" Photo ILRI/Zerihun Sewunet "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 1 : Interventions and control markets.  Intervention markets Control markets Intervention marketsControl markets Bash Del BashDel Girar amba Gey Girar ambaGey Wejed Ashen WejedAshen Kollo margefia Mehal meda Kollo margefiaMehal meda Molalle Meleya MolalleMeleya Yigem Rabel YigemRabel Zemero Shesho ZemeroShesho Zeret Wegere ZeretWegere  "}],"sieverID":"43ebc807-62db-4b0e-be9a-48567e03b578","abstract":""}

data/part_2/0a1f9bda6b080e83c17acfdc544a5194.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a1f9bda6b080e83c17acfdc544a5194","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2fdc5df6-c4a7-4896-9f5a-8256ceacc0c7/retrieve"},"pageCount":11,"title":"An assessment of irrigated rice cultivation with different crop establishment practices in Vietnam","keywords":[],"chapters":[{"head":"Materials and methods","index":1,"paragraphs":[{"index":1,"size":53,"text":"All methods included in the research, such as the experimental design, measurement of planting uniformity, yield, and sustainable performance indicators, are under the guidelines of the International Rice Research Institute (IRRI) or global standards, which are indicated in the specific sections and parameters below. The manuscript was internally reviewed and approved by IRRI."},{"index":2,"size":183,"text":"Site and crop descriptions, experimental design and water management. The experiment was conducted in Trung-Thanh Village, Co Do District, Can Tho, Vietnam (10.178103°N latitude; 105.524434°E longitude), across two consecutive rice-cropping seasons. These were the Winter-Spring season (WS), or dry season, from 8 November 2018 (sowing) to 14 February 2019 (harvest); and the Summer-Autumn season (SA), or early wet season, from 1 March 2019 (sowing) to 28 May 2019 (harvest). Rice varieties used were Dai-Thom-8 and OM5451 for the WS and SA seasons, respectively. The use of these plants complies with the national guidelines of Vietnam 32 . At the start of the WS season, fields were drained of floodwater, whereas, at the start of the SA season, irrigation water was required during land preparation before the onset of the monsoon rains. The mean farm size in the study area was 2.1 ± 0.1 ha, with an acid sulphate clay soil type 8 . The predominant crop establishment method was wet direct-seeding with broadcast pregerminated seed and the majority of farmers used four-wheel tractors for land preparation and combine harvesters for harvesting 8 ."},{"index":3,"size":160,"text":"The four crop establishment methods were considered as separate treatments and implemented in a randomized complete block design (Table 1). The four treatments were: (1) BroadC (Fig. 1a), (2) BlowS using the Kasei 3WF-3A-26L machine (Fig. 1b), (3) DrumS using the Hoang-Thang drum seeder (Fig. 1c), and (4) MecT using the Yanmar VP7D25 transplanter (Fig. 1d). The four different farmers' fields were considered as blocks or replicates and the four crop establishment methods were applied in each field (block). The field area of each treatment ranged from 3,000 to 4,000 m 2 . Different fields were used each season. Irrigation and drainage were applied similarly across the four treatments, but were different for the WS and SA seasons depending on the weather and flood conditions at the research site (Fig. 2). Growing time of the rice was 90 and 83 days for DSR and MecT, respectively. However, MecT required the seedlings to be prepared 12 days prior to crop establishment."},{"index":4,"size":183,"text":"Land preparation, fertilizer and pesticide application, and harvesting operations, were the same for all treatments. Land preparation included plowing using locally fabricated rotavators and puddling with wet leveling. Fertilizer and pesticides were applied using Knapsack-blowers and -sprayers, respectively, combined in the Kasei 3WF-3A-26L machine. Harvesting in all treatment plots was done using combine harvesters (Kubota DC-70). Straw after harvest was generally incorporated at about 25-30 days before land preparation for the WS, while it is burned at about 12-15 days before land preparation for the SA. We applied 1M5R based on the criteria Table 1. Distribution of the treatments and replications in the experiment plots. BroadC = manual broadcasting, BlowS = blower-seeding, DrumS = drum-seeding, MecT = mechanized transplanting; the numbers associated with the treatments in the Table (i.e. 1, 2, 3, and 4) represent for the blocks or farmers, correspondingly.  Flowering Flowering described in Table 2. We were not prescriptive for herbicide application. For all treatments, farmers applied herbicide based on their experience. Sofit-300EC (480 ml ha -1 ) and Cantamil-550EC (500 ml ha -1 ) were the two common herbicides used."}]},{"head":"Measuring planting uniformity.","index":2,"paragraphs":[{"index":1,"size":67,"text":"To measure the planting uniformity, five 40-× 50-cm quadrants (randomly placed in a cross diagonal transect) were sampled in each treatment plot 7 days after sowing or transplanting. Seedling density was assessed by counting the number of seedlings in each quadrant divided by the quadrant area. The standard deviation (SD) was then used to compare the variation in seedling density from the mean across all replicate plots."},{"index":2,"size":131,"text":"Quantification of grain yield. Grain yield was determined by the crop-cut method from each experimental plot. In the WS season, the samples for the crop cut were taken from two 5-m 2 (2.5 × 2.0 m) quadrants, which were located 5 m from the center of each plot along a cross diagonal transect. In the SA season, the same sampling procedure was applied with one more sampling at the center of each plot (total of three samples for each plot). The threshed paddy grains were cleaned (unfilled spikelets removed), weighed and recorded as fresh weight. The moisture content (MC) of the grain samples was determined using a grinding-type moisture meter (Kett®, product code: F511), which was precalibrated using the oven method 33 . The grain yield was calculated at 14% MC."}]},{"head":"Analysis of energy efficiency and indirect GHGEs.","index":3,"paragraphs":[{"index":1,"size":24,"text":"Energy efficency (GJ ha -1 ) was analyzed based on the net differences between the outputs and inputs of rice production-Eq. 1 (Eq. 1):"},{"index":2,"size":273,"text":"where NEV is the net energy value for energy efficiency; E out is the output energy value only accounting for the harvested grains but not including rice straw because this residue was incorporated before WS and burned before SA in this research; E in is the input energy value accounting for mechanized operations including machine production and fuel consumption, labor and agronomic inputs such as seeds, fertilizer and pesticide. The conversion factors reported in Ecoinvent (2019) 34 were used to estimate the energy of the related materials and processes (Table 3). In addition, the energy conversion factor for machine production was calculated through fuel consumption at 15 MJ L -1 (35,36) . Fertilizer inputs, such as nitrogen (N), phosphorus (P 2 O 5 ) and potassium (K 2 O) were calculated based on the chemical content of N, P 2 O 5 and K 2 O, such as urea (46-0-0) and DAP (18-46-0). Pesticide and herbicide inputs were converted based on the content of active ingredients and the conversion weight of the applied pesticides. Manpower was calculated based on the metabolic equivalent of task (MET), which is the ratio of human metabolic rate when performing an activity to the metabolic rate at rest, and on a labor energy conversion factor 37 , with the assumption that the mean weight of a Vietnamese is 55 kg. GHGE (kg CO 2 -eq ha -1 ) is calculated based on Eq. ( 2), that accounts for the production of agronomic inputs including seeds, fertilizer and pesticide (GHG agro-input ); mechanized operations (GHG operation) , soil emissions (GHG soil ) and rice straw management (GHG ricestraw )."},{"index":3,"size":67,"text":"The GHG conversion factors for agronomic inputs and mechanized operation are shown in Table 3. GHG soil is calculated based on Eq. ( 3) 38 , accounting for CH 4 and N 2 O emissions. The CH 4 emission is affected by water management, pre-season soil management and rice straw incorporation; while the N 2 O emission is affected by N use for rice cultivation 38 ."},{"index":4,"size":46,"text":"where Time grow is the rice-growing period; 28 and 265 are the Global Warming Potentials of CH 4 and N2O, respectively, for conversion to CO 2 -eq 38 ; EF default , SF water and SF pre , are the CH 4 emission and scaling factors"},{"index":5,"size":59,"text":"Table 2. Specifications of best practices for irrigated rice production (1 Must (certified seed) and 5 Reductions (reduced rates of seed, fertilizer, pesticides and water; reduced post-harvest losses) applied in the field trial at Trung-Thanh Village, Co Do District, Can Tho, for both seasons. (Max. = maximum). *Postharvest processes were excluded for analyses of the findings in this study."}]},{"head":"Criteria* Requirements","index":4,"paragraphs":[{"index":1,"size":143,"text":"Seed rate ≤ 120 kg ha of water management and pre-season soil management, respectively; and SF ricestraw is the scale factor for rice straw management. EF 1FR is the N 2 O emission factor in flooded rice systems and fertilizer amount of applied N, calculated based on Eq. ( 4) 38 . Water management was considered as single-and multiple-drainage scenarios during the WS and SA, respectively (Fig. 2). Total growing time of the direct-seeded rice was 90 days while that of transplanted rice in the field was 83 days. The seedling preparation time of 12 days was accounted for in the transplanted rice scenario. However, the land area used for seedling is only 1:100 for growing compared with the common practice in Vietnam, which was observed to be the case in this study. The emission and scaling factors are shown in Table 3."},{"index":2,"size":106,"text":"where R straw is the incorporation rate of rice straw (dry matter, t ha -1 ) and CF straw is the conversion factor of rice straw depending on time of incorporation before the crop establishment. Yield of straw only accounted for top parts of rice plant harvested is 50% of rice yield 39 . This factor is only applied for the straw incorporation scenario of WS but not for the burning scenario of SA. On the other hand, GHG emission from straw burning is taken into account through the last component (GHG ricestraw ) in Eq. ( 2) which is reported in Romasanta (2017) 40 ."}]},{"head":"Computation of sustainability performance indicators.","index":5,"paragraphs":[{"index":1,"size":63,"text":"The Sustainable Rice Platform (SRP) has developed 12 sustainability performance indicators for rice production (SRP, 2019). We computed the seven agronomic indicators: productivity (grain yield), nitrogen-use efficiency (NUE), phosphorous-use efficiency (PUE), biodiversity (pesticide use), labor productivity, profitability (net profit) and GHGE as defined by SRP version 2 13 . In addition, we included potassium-use efficiency (KUE) due to its importance in rice productivity."},{"index":2,"size":192,"text":"Farmers were asked to record input and economic data in diaries, which were checked and collected by project staff every 3-4 weeks. To compute phosphorus (P) and potassium (K) application rates, the amounts of P 2 O 5 and K 2 O for each fertilizer application were determined and multiplied by a factor of 0.4364 and 0.8302, respectively, to convert them into the elemental form 13 . To compute for NUE, PUE and KUE, the total grain yield harvested was divided by the elemental N, P or K rate applied and was expressed in terms of kg grain kg -1 elemental N, P or K. To compare pesticide practices among treatments, we reported the total frequency of application of formulated pesticide products. To compute for labor productivity, both hired and owned (family) male and female laborers were considered and the number of labor days per season (for all activities from land preparation until harvest, including regular field visits by farmers) were estimated by dividing the total labor cost per season by the average daily wage rate (VND 200,000 day -1 , collected during this research) at the time taken across all activities."},{"index":3,"size":14,"text":"The result was then divided by the grain yield as determined from crop cuts."},{"index":4,"size":84,"text":"(4) Net income was calculated by deducting the total production cost from the gross income obtained from grain yield. Production cost consisted of: (1) land use; (2) service costs of mechanized operations such as land preparation, mechanical transplanting, fertilizer and pesticide applications and combine harvesting; (3) agronomic inputs including seeds, fertilizer and pesticide; and, (4) labor. Gross income consisted of the income from the total fresh harvested grain sold at the field. Costs of inputs and price of paddy are shown in Table 4."},{"index":5,"size":88,"text":"Statistical analysis and software. SPSS software and Analysis of Variance (ANOVA) were used to evaluate the effects of the contrasting crop establishment-based scenarios on the measured production and environmental parameters using a Least Significant Difference (LSD) at α = 0.05 to compare the mean values. Seedling density was analyzed using log transformation due to non-normally distributed residuals. Energy balance analysis was based on the Cumulative Energy Demand 1.09 method by SIMAPRO (2019) 41 and CO 2 -equivalent analysis was based on the GWP-100a of IPCC (2013) 46 ."}]},{"head":"Results","index":6,"paragraphs":[{"index":1,"size":202,"text":"Planting uniformity. During the WS and SA seasons, there was a significant difference in the seedling density among treatments (F 3,73 = 39.050, P < 0.001; F 3,73 = 4.984, P = 0.003, respectively). During the WS season, the seedling density for MecT was significantly lower than those of the other crop establishment methods (P < 0.05; Fig. 3). In addition, the variation in seedling density (or planting uniformity) for MecT was substantially lower (SD = 54.1) than BlowS (SD = 130.0), BroadC (SD = 137.8) and DrumS (SD = 104.9). During the SA season, there was no significant difference in the seedling density between Drum S and MecT. However, the seedling density for BlowS was significantly higher than DrumS and MecT. During this season, BlowS also had the largest variation in seedling density (SD = 146.9), and therefore had the lowest planting uniformity, compared to BroadC (SD = 70.6), DrumS (SD = 75.2) and Mec T (SD = 79.2). The average seedling density of MecT in the WS was lower than in the SA; while that of other treatments in the WS was lower than in the SA. The differences were mainly caused by the different operational performances during crop establishment."},{"index":2,"size":225,"text":"Energy input, GHGE, and production cost. Figure 4 shows the energy input, GHGEs and production costs for rice production among the different crop establishment options applied with 1M5R. The MecT had additional fuel consumption and machine production energy use than other direct seeding treatments but had lower agronomic inputs, particularly the seed rate, which was 50-60 kg ha -1 , as compared with 100-120 kg ha -1 for the other DSR treatments. MecT also had lower in-field growing time than direct seeding by about 10%. These together led to lower total energy input and GHGEs of MecT than for direct seeding. Total energy input was 12.5-15.3 GJ ha -1 and 12.6-13.5 GJ ha -1 , during the WS and SA seasons, respectively, consisting of 65-73% from agronomic inputs and the rest from operations. GHGEs during WS were 7.31-8.03 Mg CO 2 -eq ha -1 , higher by 40% than that during SA; mainly caused by the difference of rice straw management (incorporation before the WS and burning before the SA) and water management (one drainageof rice fields during the WS and two drainages during the SA). Of the total GHGEs during the WS and SA, respectively, 86 and 70% were from soil emissions; 10 and 14% were from agronomic inputs; 4 and 8% were from mechanized operations and 8% was from straw burning (for SA)."}]},{"head":"Sustainability performance indicators.","index":7,"paragraphs":[{"index":1,"size":235,"text":"Table 5 shows the sustainability performance indicators of crop production across the four field trial treatments in the WS and SA seasons. There was no significant difference in N-P-K use efficiency (n = 4, P > 0.05). However, the farmers used less fertilizer for the MecT in the WS because of better rice plant growth and leaf color. As a consequence, MecT also had better mean energy efficiency. MecT had significantly lower pesticide use in the WS season. There was a significant difference in the number of pesticide applications between treatments (F 9,3 = 5.121, P = 0.024), with the lowest number applied in the MecT treatment (P < 0.005). MecT required less pesticides because of increased rice plant vigor and lower plant density (Fig. 5). During the SA season, farmers applied less fertilizer and pesticide than in the WS season, with no sig-  Table 5. Sustainability performance indicators (mean values followed by standard error in parentheses) of crop production across the four field trial treatments in the WS and SA seasons in Can Tho, Vietnam. Within a particular row, numbers followed by different letters are significantly different by least significant difference at α = 0.05.  nificant differences across treatments. However, there was a significant difference in labor productivity among treatments (F 9,3 = 5.498, P < 0.001). Labor productivity was significantly lower in the MecT plots compared to the other treatments (P < 0.05)."}]},{"head":"Discussion","index":8,"paragraphs":[{"index":1,"size":205,"text":"The use of 1M5R practices following mechanized crop establishment produced similar yields to the other three crop establishment methods. More importantly, MecT provided significant economic and environmental benefits to smallholder farmers in the MRD because of reduced input use. The findings support what we hypothesized. Although this study was conducted under the conditions of irrigated rice for a specific site in Can Tho, we suggest that the findings are representative of most of the lowland rice production in the MRD with alluvial soil. Rice production in the MRD has high yield (about 6-7 Mg ha -1 ) compared with most other countries in Southeast Asia 1 , but the net income of farmers is low mainly due to overuse of seed, fertilizer and pesticides 7,8 . In contrast, we demonstrate in this study that the application of 1M5R and mechanized transplanting, using lower agronomic inputs without reducing yield, generated a net profit of 600-1,000 $US ha -1 season -1 or about 1,800-3,000 $US ha -1 for three crops per year. This equals 0.2-0.3 $US kg -1 paddy, which was 7-20% higher than FP and 20-40% higher than that reported for conventional farmers in Devkota et al. (2019) 7 in the same region of the MRD."},{"index":2,"size":193,"text":"Our findings do not clearly demonstrate the influence of the crop establishment method on energy efficiency and GHGEs, but revealed that mechanized transplanting did not increase energy input and GHGEs (based on life-cycle assessment) 48 . A number of studies highlight the advantages of direct seeding practices under wet-tillage condition in terms on yield, water use effciency and labor 27,28 . However, in the previous studies, the comparisons were compared to manual transplanting and not to mechanized transplanting, a technology that has been significantly improved recently. The current study illustrates that mechanized transplanting reduced seed rate by 40% compared to three other direct seeding options. Moreover, the reduction of sowing density, as well as the planting of 12-day old seedlings, led to reduced fertilizer and pesticide use. The latter suggests that mechanical transplanting reduces weeds, pest and disease pressure in comparison with wet direct-seeding. This is likely to be due to a number of factors, such as reduced exposure of seeds and young seedlings in fields to birds, snails and rats; a competitive advantage of rice seedlings over weeds after transplanting, and lower plant densities that lead to more ventilation and lower humidity."},{"index":3,"size":165,"text":"Herbicide application was based on conventional farmer practice and was the same for all treatments. We contend that mechanized transplanting would reduce or avoid herbicide application through enabling better vigor of rice seedlings after the field had been mechanically cultivated to manage weeds. The benefits of manual transplanting over wet direct seeding in relation to weeds, pests and diseases are well documented [49][50][51] . We argue that our results highlight similar benefits for MecT. The density of seed-trays and age of seedlings when transplanting also are critically important factors to consider when transplanting in snail-infested regions 49 . Through reduced seed rates, mechanized transplanting also reduced the risk of the lodging of rice plants 50 . Reduced lodging was observed in the current study and thus reduced postharvest losses due to unfavorable operating conditions of combine harvesters when the crop is lodged. The grain quality of lodged rice also is significantly reduced because of increased moisture content of the grain and mud contaminating the grain."},{"index":4,"size":193,"text":"Energy efficiency, GHGEs and net profit are commonly used as environmental and economic indicators of crop production 13,48 . Energy efficiency, which is the net energy difference between outputs and inputs of rice production, could vary depending on many factors including site-specific management of water, nutrients, pests and crop residues. Previous studies report a wide range for the estimate of net energy value for irrigated rice: 13.7 MJ kg -1 rice produced in Ecoinvent (2019) 34 ; 11.3-12.3 MJ kg −1 for rice in the Philippines in Quilty et al.  (2014)  45 ; and 10-28 MJ kg −1 for production in the Philippines with different rice straw management practices 36 . The estimates of total input energy of rice production in the current study are similar to those reported for irrigated rice production in Southeast Asian 36,45,52 . The energy efficiency value in the current study (11-14 MJ kg -1 ) was similar with that reported in Ecoinvent (2019) 34 and was higher by 10% than that reported in Quilty et al. (2014) 45 , which is likely because of higher grain yield in the MRD compared to that produced in the Philippines."},{"index":5,"size":82,"text":"In this study, soil emission levels were calculated based on the conversion factors reported in IPCC (2019) 38 using research scenarios with similar specific water and rice straw management and fertilizer application. Total GHGEs of the research scenarios were 1.05 and 0.65 kg CO 2 -eq kg -1 paddy during WS and SA, respectively. GHGEs during WS was higher by 40% that of SA and that reported in Vo et al. (2017)  53 because of the additional emissions from rice straw incorporation."}]},{"head":"Conclusions","index":9,"paragraphs":[{"index":1,"size":144,"text":"The research provided field-trial evidence from studies within smallholder farmers' fields of the benefits of mechanized transplanted rice compared to direct seeded rice in the MRD. Across the four treatments, the rice yield ranged from 7.3 to 7.5 Mg ha −1 and 6.2 to 6.8 Mg ha −1 in the WS and SA seasons, respectively. In comparison with direct seeding methods, the mechanized transplanting practice decreased the seed rate by 40% and reduced pesticide applications by 30-40% in the main crop season (WS) of Vietnam. Despite mechanized transplanting required higher inputs for machine production (depreciation) and fuel consumption, its net energy balance, net income and GHGEs were at a similar level as the other non-mechanized planting practices. Thus, MecT in combination with 1M5R is a technology package that should be promoted to improve the economic and environmental sustainability of rice cultivation in the MRD."}]}],"figures":[{"text":"Figure 1 . Figure 1. Four crop establishment practices showing (a) manual broadcasting (BroadC), (b) blower seeding (BlowS), (c) drum seeding (DrumS) and (d) mechanical transplanting (MecT). The people with their images included in Fig. 1 have consented to publish the paper as online open-access material. "},{"text":"Figure 2 . Figure 2. Water level (above-or under-ground) during the SA and WS cropping seasons. "},{"text":"Figure 3 . Figure 3. Seedling density (no. of seedlings m -2 ) 7 days after sowing/transplanting of the four different crop establishment treatments in Can Tho, Vietnam, during the Winter-Spring (A) and Summer-Autumn (B) seasons. Box plots with the same letters are not significantly different at the 0.05 level of significance following pairwise comparisons. "},{"text":"Figure 4 . Figure 4. Energy input, GHGEs and production costs for rice production applied with 1M5R under different crop establishment options in Can Tho, Vietnam. "},{"text":"Figure 5 . Figure 5. Comparisons in experimental fields of rice sown using a blower seeder (broadcast seeding, on left) or mechanized transplanting (on the right). "},{"text":"Table 3 . Energy and GHGE conversion factors used for calculating the relative energy efficiency of the four crop establishment methods from crop establishment to harvest.  Energy   GHGE   EnergyGHGE Parameters Unit Value Sources Unit Value Sources ParametersUnitValueSources UnitValue Sources Land use MJ ha -1 0.0024 34,41 See details under \"Soil emissions\"   Land useMJ ha -10.0024 34,41See details under \"Soil emissions\" Seeds MJ kg -1 30.1 34,41 kg CO 2 -eq kg -1 1.12 34,41,46 SeedsMJ kg -130.134,41kg CO 2 -eq kg -11.1234,41,46 Grain MJ kg -1 15.2 34,42    GrainMJ kg -115.234,42 Diesel consumption MJ L -1 44.8 34,35,41 kg CO 2 -eq MJ -1 0.08 34,41,46 Diesel consumptionMJ L -144.834,35,41kg CO 2 -eq MJ -10.0834,41,46 Gasoline consumption MJ L -1 39.1 34,35,41 kg CO 2 -eq MJ -1 0.08 34,41,46 Gasoline consumptionMJ L -139.134,35,41kg CO 2 -eq MJ -10.0834,41,46 Electric power MJ kWh -1 3.6 34,35,41 kg CO 2 -eq kWh -1 0.564 34,41 Electric powerMJ kWh -1 3.634,35,41kg CO 2 -eq kWh -10.56434,41 Machine production MJ L -1 15.6 35,36    Machine productionMJ L -115.635,36 N MJ kg -1 58.7 34,41,43 kg CO 2 -eq kg -1 5.68 34,41,46 NMJ kg -158.734,41,43kg CO 2 -eq kg -15.6834,41,46 P 2 O 5 MJ kg -1 17.1 34,41,43 kg CO 2 -eq kg -1 1.09 34,41,46 P 2 O 5MJ kg -117.134,41,43kg CO 2 -eq kg -11.0934,41,46 K 2 O MJ kg -1 8.83 34,41,43 kg CO 2 -eq kg -1 0.52 34,41,46 K 2 OMJ kg -18.8334,41,43kg CO 2 -eq kg -10.5234,41,46 Herbicide MJ kg -1 354 34,41,44 kg CO 2 -eq kg -1 23.3 34,41,46 HerbicideMJ kg -135434,41,44kg CO 2 -eq kg -123.334,41,46 Pesticide MJ kg -1 182 34,41,43 kgCO 2 -eq kg -1 10.4 34,41,46 PesticideMJ kg -118234,41,43kgCO 2 -eq kg -110.434,41,46 Driving 4WT and combine harvesters MJ h -1 0.44 37,45    Driving 4WT and combine harvestersMJ h -10.4437,45 Manual labor MJ h -1 0.89 37,45    Manual laborMJ h -10.8937,45 Soil emission:       Soil emission: EF default of CH 4 in WS    kg ha -1 day -1 1.7 47 EF default of CH 4 in WSkg ha -1 day -11.747 EF default of CH 4 in SA    kg ha -1 day -1 2.8 47 EF default of CH 4 in SAkg ha -1 day -12.847 SF pre for pre-season soil management     1 13 SF pre for pre-season soil management113 SF water for single drainage     0.71 38 SF water for single drainage0.7138 SF water for multiple drainage     0.55 38 SF water for multiple drainage0.5538 SF N for Nitrogen use    % N applied 0-1 38 SF N for Nitrogen use% N applied0-138 CF incorporation     1 13 CF incorporation113 CH 4 from burning straw    kg Mg -1 4.51 40 CH 4 from burning strawkg Mg -14.5140 N 2 O from burning straw    kg Mg -1 0.069 40 N 2 O from burning strawkg Mg -10.06940  "},{"text":"Table 4 . Cost of inputs and price of paddy. Inputs Unit Value InputsUnitValue Land use $US ha -1 year -1 2000 Land use$US ha -1 year -12000 Water pumping for WS $US ha -1 season -1 23 Water pumping for WS$US ha -1 season -1 23 Water pumping for SA $US ha -1 season -1 34 Water pumping for SA$US ha -1 season -1 34 Seed $US kg -1 5.2 Seed$US kg -15.2 Urea 46-0-0 $US kg -1 58.7 Urea 46-0-0$US kg -158.7 TSP 18-46-0 $US kg -1 0.6 TSP 18-46-0$US kg -10.6 MOP 0-0-60 $US kg -1 0.4 MOP 0-0-60$US kg -10.4 NPK 16-16-16 $US kg -1 0.6 NPK 16-16-16$US kg -10.6 NPK 16-16-8 $US kg -1 0.5 NPK 16-16-8$US kg -10.5 Herbicide $US L -1 4.8 Herbicide$US L -14.8 Molluscicide $US L -1 6.1 Molluscicide$US L -16.1 Fungicide/Insecticide $US kg -1 12.3 Fungicide/Insecticide$US kg -112.3 Fungicide/Insecticide $US L -1 11.0 Fungicide/Insecticide$US L -111.0 Land preparation $US ha -1 94.1 Land preparation$US ha -194.1 Manual broadcast-seeding $US ha -1 26.0 Manual broadcast-seeding$US ha -126.0 Blower seeding $US ha -1 26.0 Blower seeding$US ha -126.0 Drum seeding $US ha -1 26.0 Drum seeding$US ha -126.0 Mechanized transplanting $US ha -1 220.0 Mechanized transplanting$US ha -1220.0 Crop care $US ha -1 56.5 Crop care$US ha -156.5 Harvesting $US ha -1 90.3 Harvesting$US ha -190.3  "},{"text":"seeding 100 kg/ha (left side) Mechanized transplanting 60 kg/ha (right side)     Manual      Mechanical ManualMechanical    broadcasting Blower seeding Drum seeding transplanting broadcastingBlower seedingDrum seedingtransplanting    (n = 4)  (n = 4)  (n = 4)  (n = 4) (n = 4)(n = 4)(n = 4)(n = 4) Winter-Spring        Winter-Spring Nitrogen-use efficiency (grain kg N kg -1 )  80.5 (14.56) 78.9 (14.55) 78.5 (11.80) 101.8 (17.34) Nitrogen-use efficiency (grain kg N kg -1 )80.5(14.56) 78.9(14.55)78.5(11.80)101.8(17.34) Phosphorus-use efficiency (grain kg P kg -1 )  322.4 (55.59) 312.8 (46.65) 315.2 (41.77) 358.6 (16.81) Phosphorus-use efficiency (grain kg P kg -1 )322.4 (55.59) 312.8(46.65)315.2 (41.77)358.6(16.81) Potassium-use efficiency (grain kg K kg -1 )  185.3 (24.43) 180.3 (19.92) 181.0 (14.46) 248.8 (30.00) Potassium-use efficiency (grain kg K kg -1 )185.3 (24.43) 180.3(19.92)181.0 (14.46)248.8(30.00) No. of pesticide applications  9.8 (1.44) a 9.8 (1.44) a 9.8 (1.44) a 6.5 (0.87) b No. of pesticide applications9.8(1.44) a9.8(1.44) a9.8(1.44) a6.5(0.87) b Labor productivity (kg days -1 ) -based on total labor cost 264.3 (22.29) 262.4 (26.80) 269.4 (21.98) 254.9 (22.88) Labor productivity (kg days -1 ) -based on total labor cost264.3 (22.29) 262.4(26.80)269.4 (21.98)254.9(22.88) Grain yield (t ha -1 )  7.5 (0.44) 7.4 (0.48) 7.4 (0.27) 7.5 (0.23) Grain yield (t ha -1 )7.5(0.44)7.4(0.48)7.4(0.27)7.5(0.23) Energy efficiency (GJ ha -1 )  98.61 - 96.74 - 97.54 - 101.64 Energy efficiency (GJ ha -1 )98.61 -96.74-97.54 -101.64 GHGEs (kg CO 2-eq ha -1 )  8,025 - 7,988-- 7,976 - 7307 GHGEs (kg CO 2-eq ha -1 )8,025 -7,988--7,976 -7307 Net income (USD ha -1 )  1,014 (96) 999 (101) 1,017 (56) 1069.8 (60) Net income (USD ha -1 )1,014 (96)999(101)1,017 (56)1069.8 (60) Summer-Autumn        Summer-Autumn Nitrogen-use efficiency (grain kg N kg -1 )  83.9 (6.28) 83.2 (5.64) 77.6 (6.46) 83.2 (7.76) Nitrogen-use efficiency (grain kg N kg -1 )83.9(6.28)83.2(5.64)77.6(6.46)83.2(7.76) Phosphorus-use efficiency (grain kg P kg -1 )  336.4 (29.27) 333.4 (27.15) 310.2 (25.42) 341.3 (39.73) Phosphorus-use efficiency (grain kg P kg -1 )336.4 (29.27) 333.4(27.15)310.2 (25.42)341.3(39.73) Potassium-use efficiency (grain kg K kg -1 )  174.9 (7.49) 173.7 (7.66) 161.9 (9.16) 177.1 (14.09) Potassium-use efficiency (grain kg K kg -1 )174.9 (7.49)173.7(7.66)161.9 (9.16)177.1(14.09) No. of pesticide applications  3.5 (0.29) 3.5 (0.29) 4.0 (0.71) 3.5 (0.65) No. of pesticide applications3.5(0.29)3.5(0.29)4.0(0.71)3.5(0.65) Labor productivity (kg days -1 )-based on total labor cost 255.7 (8.86) a 241.9 (17.29) a 228.4 (17.99) a 136.9 (8.09) b Labor productivity (kg days -1 )-based on total labor cost255.7 (8.86) a241.9(17.29) a 228.4 (17.99) a 136.9(8.09) b Grain yield (t ha -1 )  6.7 (0.10) 6.6 (0.21) 6.2 (0.36) 6.8 (0.27) Grain yield (t ha -1 )6.7(0.10)6.6(0.21)6.2(0.36)6.8(0.27) Energy efficiency (GJ ha -1 )  87.86 - 87.04 - 80.45 - 90.60 Energy efficiency (GJ ha -1 )87.86 -87.04-80.45 -90.60 GHGEs (kg CO 2-eq ha -1 )  4,984 - 4,991 - 4995 - 4,679 GHGEs (kg CO 2-eq ha -1 )4,984 -4,991-4995-4,679 Net income (USD ha -1 )  769 (25) 749 (54) 663 (663) 678 (92) Net income (USD ha -1 )769(25)749(54)663(663)678(92)  At harvest       At harvest Broadcast 33 days after seeding 26 days after transplanting     Broadcast33 days after seeding 26 days after transplanting  At seeding At transplanting      At seedingAt transplanting  "}],"sieverID":"c6fc1664-a83f-475c-acb9-e2a70a6e143b","abstract":"Overuse of seed and chemical inputs is a major constraint for sustainable rice production in Vietnam. In this study, two seasons of field trials were conducted to compare different crop establishment practices for rice production in the Mekong River Delta using environmental and economic sustainability performance indicators. The indicators including energy efficiency, agronomic use efficiency, net income, and greenhouse gas emissions (GHGEs) were quantified based on four treatments including manual broadcast-seeding, blower seeding, drum seeding, and mechanized transplanting. Across the four treatments, yields ranged from 7.3-7.5 Mg ha −1 and 6.2-6.8 Mg ha −1 in the Winter-Spring (WS) and Summer-Autumn (SA) seasons, respectively. In comparison with direct seeding methods, mechanized transplanting decreased the seed rate by 40%. It also led to a 30-40% reduction in pesticide use during the main crop season (WS). Mechanized transplanting required higher inputs, including machine depreciation and fuel consumption, but its net energy balance, net income and GHGE were at a similar level as the other non-mechanized planting practices. Mechanized transplanting is a technology package that should be promoted to improve the economic and environmental sustainability of lowland rice cultivation in the Mekong River Delta of Vietnam."}

data/part_2/0a5b0d81035848a99e90ced2fde06d56.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a5b0d81035848a99e90ced2fde06d56","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/295da560-447e-40cf-acc1-202f75af9396/retrieve"},"pageCount":25,"title":"Crioconservación de plantas en","keywords":[],"chapters":[{"head":"Introducción","index":1,"paragraphs":[{"index":1,"size":125,"text":"Los factores bióticos y abióticos del medio agrícola ejercen, sobre la variedad o el clon que constituye un cultivo, una presión que reduce considerablemente el tiempo de permanencia del cultivo en el medio, la calidad de su producto agrícola, su nivel de producción y su respuesta a los estímulos del entorno. Esta situación obliga al investigador o al gestor agrícola a mantener un programa proactivo de mejoramiento que genere continuamente materiales de comportamiento superior para reemplazar a los ya existentes. Una respuesta a esta necesidad, tanto en el presente como hacia el futuro, es conservar la mayor cantidad posible de variabilidad genética de las especies -que se encuentra principalmente en los centros primarios y secundarios de diversidad-y hacer siempre posible el acceso a esa diversidad."},{"index":2,"size":72,"text":"Un recurso genético puede conservarse empleando dos estrategias de manejo: una in situ y otra ex situ. La primera se orienta a mantener el potencial evolutivo de una especie en estado de competencia natural; la segunda, como su nombre lo indica, maneja la especie fuera de su espacio o lugar natural, es decir, en un ambiente artificial que permite desarrollar las siguientes actividades con los individuos o las muestras de la especie:"},{"index":3,"size":60,"text":"• trabajos de evaluación, caracterización y mejoramiento (en bancos de campo); • distribución de germoplasma de la especie, de características conocidas y en forma segura (un banco in vitro); • conservación de la diversidad genética de la especie (un banco de semillas); • conservación a largo plazo y creación de copias de seguridad denominadas \"back up\" (un banco de crioconservación)."},{"index":4,"size":124,"text":"El presente documento muestra los avances logrados en la crioconservación de germoplasma, para lo cual se toma como ejemplo algunos trabajos desarrollados por entidades nacionales e internacionales en Colombia. El Centro Internacional de Agricultura Tropical (CIAT) ha jugado un papel importante en la ejecución de esos trabajos, ya sea por la generación directa de información de sus investigaciones o a través de proyectos colaborativos, capacitaciones y entrenamientos a otras instituciones, lo cual ha permitido elaborar criterios de análisis y de investigación aplicables tanto a la actividad propia como a las acciones de conjunto. Del mismo modo, diversos trabajos de tesis, realizados tanto a nivel de pregrado como de posgrado, han permitido crear un grupo de investigadores expertos en crioconservación de germoplasma en el país."}]},{"head":"La crioconservación: investigaciones desarrolladas en Colombia","index":2,"paragraphs":[{"index":1,"size":39,"text":"A lo largo de los años, diversos cultivos y tipos de tejidos han sido utilizados para la realización de investigaciones en crioconservación. La información al respecto se presenta a continuación agrupada en estudios de caso en cinco áreas temáticas:"},{"index":2,"size":7,"text":"1. Crioconservación de cultivos de propagación vegetativa"},{"index":3,"size":6,"text":"• Yuca cultivada (Manihot esculenta Crantz)"},{"index":4,"size":9,"text":"• Especies silvestres afines a la yuca (Manihot spp.)"},{"index":5,"size":18,"text":"• Tejido embriogénico de la yuca cultivada • Papas (Solanum tuberosum Grupo phureja y Solanum tuberosum spp. andigena)"}]},{"head":"Crioconservación de semillas botánicas","index":3,"paragraphs":[{"index":1,"size":9,"text":"• Especies silvestres afines a la yuca (Manihot spp.)"},{"index":2,"size":4,"text":"• Café (Coffea arabica)"},{"index":3,"size":18,"text":"• Palma de chontaruro (Bactris gasipaes Kunth) y \"güérregue\" (Astrocaryum standleyanum Bailey) • Palma aceitera (Elaeis guineensis Jacq.)"},{"index":4,"size":7,"text":"• Cratylia (Cratylia argentea (Desvaux) O. Kuntze)"}]},{"head":"Crioconservación de la flora amenazada","index":4,"paragraphs":[{"index":1,"size":11,"text":"• Chambimbe (Sapindus saponaria var. Drummondii (Hook. & Arn.) L. Benson)"}]},{"head":"Crioconservación de especies frutales","index":5,"paragraphs":[{"index":1,"size":8,"text":"• Tomate de árbol (Cyphomandra betacea (Cav.) Sendt)"},{"index":2,"size":11,"text":"• Maracuyá y granadilla (Passiflora edulis f. flavicarpa y Passiflora ligularis)"}]},{"head":"Nuevas iniciativas en crioconservación","index":6,"paragraphs":[{"index":1,"size":6,"text":"• Microorganismos (caso de Phytophthora spp.)"},{"index":2,"size":10,"text":"• Bancos de tejidos y de ADN • Otros casos"}]},{"head":"Crioconservación de cultivos de propagación vegetativa","index":7,"paragraphs":[{"index":1,"size":10,"text":"Estudio de caso de la yuca cultivada (Manihot esculenta Crantz)"},{"index":2,"size":73,"text":"El trabajo de crioconservación en el CIAT se inició con el apoyo del antiguo Consejo Internacional de Recursos Fitogenéticos (IBPGR), que luego se incorporó al Grupo Consultivo sobre Investigación Agrícola Internacional (CGIAR) como el Instituto Internacional de Recursos Fitogenéticos (IPGRI), hoy conocido como Bioversity International. En los primeros años la investigación se centró en comprender el comportamiento de la yuca frente a los diferentes agentes osmóticos de protección adicionados al medio de cultivo."},{"index":3,"size":216,"text":"En la investigación en yuca se ha ido evolucionando en cuanto a las técnicas implementadas. Los primeros trabajos reportaron éxitos parciales en el uso de técnicas clásicas (Escobar et al. 1997) y últimamente se están aplicando técnicas modernas basadas en la vitrificación, especialmente la encapsulación-deshidratación y la vitrificación-microgota. Uso de las técnicas clásicas de crioconservación: Estudios preliminares indicaron que los ápices de yuca responden de modo diferente al agente osmótico (DMSO, sorbitol o sacarosa) usado en el medio de cultivo. Así pues el sorbitol (>1 M) favorece la formación de callo, y el DMSO resulta tóxico en concentraciones mayores que 0.1 M; mientras que la suplementación del medio con sorbitol 1 M disminuye el efecto negativo de los dos agentes anteriores en el tejido. En ese estudio también se observó la posible existencia de una correlación entre la zona edafoclimática de donde provenía la variedad y la respuesta de esta a la congelación; en efecto, los materiales de mejor respuesta a la congelación son aquellos con tolerancia a la sequía y a condiciones climáticas subtropicales. Este hallazgo ayudó a establecer un patrón de respuesta de la yuca: los materiales cuya tolerancia de la sequía es baja pueden tratarse previamente con sustancias crioprotectantes en concentraciones bajas durante un periodo largo y viceversa (alta concentración por corto tiempo)."},{"index":4,"size":51,"text":"Los materiales recalcitrantes al protocolo básico (Escobar et al. 1997) mejoraron hasta en un 20 % su respuesta en regeneración de plantas después de la congelación, cuando fueron pretratados durante cinco días en medios suplementados con sorbitol 0.25-0.5M, DMSO 1x10 -3 -1x10 -4 M, y sacarosa 0.11-0.25M (Escobar et al. 2000)."},{"index":5,"size":47,"text":"Asimismo, se ha observado que la regeneración de plantas después de la congelación está mediada por la consistencia del medio, el tipo y la combinación de los gelificantes, y del tipo y concentración de la citoquinina agregada al medio de regeneración (Escobar et al. 2000) (figura 8.1)."},{"index":6,"size":60,"text":"Este protocolo fue probado con éxito en 16 clones de yuca; no obstante, no se considera un esquema de trabajo práctico a usarse con la colección completa de yuca, ya que tiene muchos pasos y medios previos a la congelación. Apreciaciones similares fueron expuestas por Choroensub et al. (1999). Crioconservación de plantas en América Latina y el Caribe | 97"},{"index":7,"size":65,"text":"Uso de las técnicas modernas de crioconservación: Escobar y Roca (1997) habían ajustado con anterioridad las condiciones para la congelación rápida de ápices descubiertos de yuca sin que se mostraran diferencias estadísticas respecto a la congelación programada. Esta técnica de congelación abría la posibilidad de establecer un sistema práctico para el manejo del banco, ya que evitaba el uso del programador y agilizaba el proceso."},{"index":8,"size":38,"text":"La técnica de la encapsulación-deshidratación fue adaptada a yuca, para lo cual ápices caulinares provenientes de plantas jóvenes (2.5-3 meses de edad) propagadas en medio 4E (Roca 1984) fueron encapsulados en alginato de sodio suplementado con reguladores hormonales."},{"index":9,"size":258,"text":"Previamente, Marín et al. (1990) había logrado crioconservar con éxito semillas de M. carthaginensis. Posteriormente, en la Unidad de Biotecnología (hoy Área de Investigación para la Agrobiodiversidad), se probó y ajustó dicha metodología en ocho genotipos conservados in vitro. Ajustes al medio de precultivo y a las condiciones de regeneración fueron necesarias para lograr recuperar plántulas después del paso por nitrógeno líquido (Escobar et al. 2001b). Tiempos de deshidratación usando gel de sílice durante 16 y 24 horas fueron probados. Los resultados mostraron recuperación de plantas (7.7 %) en tejidos tratados de la accesión M. carthaginensis 17F-417-001 durante 16 horas y un 16.6 % en M. esculenta subs. peruviana 417-005 deshidratada durante 24 horas. En M. esculenta subsp. flabellifolia se logró de 10 % a 60 % con 16 horas de deshidratación, y de 0 % a 100 % con 24 horas, dependiendo de la accesión (figura 8.2). Los datos preliminares sugieren que es necesario ajustar las condiciones del medio de cultivo antes y después de la congelación (como se indicó antes) para garantizar la recuperación de las plantas de M. carthaginensis. En tejido embriogénico de yuca cultivada Un requisito fundamental para acceder a la transformación genética es contar con protocolos eficaces de regeneración de plantas, ya sea mediante la embriogénesis somática o la organogénesis. Taylor et al. (1996) propusieron otro tipo de tejido embriogénico que permitía la regeneración de plantas, al que denominaron \"callo embriogénico friable\" (CEF); este tejido está conformado por agregados celulares proembriogénicos inmersos en una matriz líquida de células. Esta técnica presenta varias limitaciones:"},{"index":10,"size":38,"text":"• obtener CEF de buena calidad, cualquiera sea el genotipo de yuca; • establecer una suspensión celular de trabajo óptima a costa de una labor dispendiosa en tiempo (de 8 a 12 meses) y en mano de obra;"},{"index":11,"size":41,"text":"• asumir la probabilidad de variación del tejido y el costo considerable del mantenimiento de las suspensiones; • incluir el riesgo de pérdida del callo por contaminación durante los subcultivos y la posible ocurrencia de errores humanos y técnicos (siempre presentes)."},{"index":12,"size":168,"text":"Se propuso, por tanto, establecer un sistema seguro y práctico de conservación que apoyara eficazmente los trabajos de transformación genética. Para ello se implementó y ajustó la metodología de desecación y de desecación-vitrificación (Santos 2002;Escobar et al. 2001) a la crioconservación del tejido embriogénico de yuca. Esta metodología consiste en deshidratar parcialmente y gradualmente (en el tiempo) el CEF y congelarlo luego rápidamente mediante inmersión directa en nitrógeno líquido. La desecación se logra dejando crecer el tejido en un medio de alta concentración de agar, para obtener un callo de consistencia granulosa, dura y seca, de color oscuro, el cual resulta óptimo para el proceso de congelación. Luego se congelan viales que contienen CEF desecado en un recipiente Nalgene TM Cryo 1 ºC (Cat. No. 5100-0001). Este trabajo se considera como el primer reporte de conservación en nitrógeno líquido de líneas celulares de yuca, lo que abre la posibilidad de establecer a futuro un banco de líneas celulares-CEF crioconservados para apoyar los programas de transformación genética (figura 8.3). "}]},{"head":"Crioconservación de papas","index":8,"paragraphs":[{"index":1,"size":306,"text":"Solanum tuberosum Grupo phureja. La CORPOICA tiene a su cargo (entre otras actividades) el mantenimiento y la salvaguarda de las colecciones de germoplasma de especies de interés nacional. Respecto a la papa, el Programa Nacional de Recursos Genéticos y Biotecnología Vegetal, que es manejado por esa Corporación en la estación experimental de Tibaitatá, en Mosquera, Cundinamarca, tiene la responsabilidad de administrar la Colección Central Colombiana (CCC) de papa, que mantiene cerca de 1098 accesiones de las subespecies S. andígena, S. tuberosum y S. phureja. Esta colección, que cuenta con tres sistemas complementarios de conservación: uno in vitro, otro en el campo y un tercero en cava fría a 0 °C, ha sido considerada por la Organización de las Naciones Unidas para la Alimentación y la Agricultura (FAO) (1996), dada la representación de la variabilidad genética allí almacenada (13 %), como la segunda colección de papa más importante del mundo, después de la del Centro Internacional de la Papa (CIP), que tiene 20 % de diversidad. El tipo de material almacenado en esta colección incluye especies silvestres y cultivares de agricultor procedentes de los departamentos de Nariño, Cauca, Boyacá, Cundinamarca, Santander, Norte de Santander, Caldas, Quindío y Magdalena, y algunas introducciones de Perú, Bolivia, Ecuador, México, Argentina, Inglaterra, Escocia, Alemania, Holanda y Bélgica y material de mejoramiento de cruces entre S. andigena x S. tuberosum (Moreno y Valbuena 2006). La CORPOICA ha priorizado en la investigación de la crioconservación de papa, ya que los cálculos de los costos de conservación para el año 2005 arrojaron los montos de COP31 724 910 y COP53 869 967 para el manejo de las colecciones bajo condiciones in vitro y en campo, respectivamente, y se estima que la crioconservación podría reducir en un 20 % el costo de conservación en campo (Cerón et al. 2005, citado por Rivera et al. 2008)."},{"index":2,"size":139,"text":"De S. tuberosum Grupo phureja se conservan aproximadamente 113 accesiones de las que se hacen subcultivos periódicos cada cuatro a seis meses, según el genotipo. A esta especie pertenecen las papas amarillas o criollas, que tienen un valor nutricional alto y una precocidad considerable para la producción, si se comparan con variedades de otras especies. El cultivo de papa amarilla ocupa el tercer renglón de toda el área sembrada en Colombia y actualmente hay posibilidad de exportarla. Es, además, una especie importante para el fitomejoramiento del cultivo de papa, porque posee genes de resistencia al hongo Phytophthora infestans. Dada la importancia de este cultivo para el país, es necesario desarrollar (e implementar luego) alternativas metodológicas que amplíen el tiempo de conservación, minimicen los costos operativos de ese proceso y garanticen la conformación de copias de seguridad de la colección."},{"index":3,"size":34,"text":"Con ese fin, la CORPOICA inició un proyecto para poner en práctica las técnicas de crioconservación, en el cual utilizó a S. tuberosum Grupo phureja como modelo. Este proyecto se realizó en dos fases:"}]},{"head":"•","index":9,"paragraphs":[{"index":1,"size":47,"text":"Primera fase: Se trataron 10 accesiones de la colección mediante los protocolos publicados por Hirai y Sakai (2000), Golmirzaie (1996), Debabrata (2000) y Bouahal (1996), y su evaluación no indicó que hubiera en ellas respuesta alguna después del tiempo de congelación (citados por Villa et al. 2007)."},{"index":2,"size":80,"text":"• Segunda fase: Se planeó entonces esta fase de experimentación para tratar de ajustar las condiciones de manejo de las accesiones, partiendo de la experiencia del CIAT en la crioconservación de yuca mediante la técnica de encapsulación-deshidratación, ya que no se había logrado respuesta alguna en la fase previa. Se redujo el número de individuos experimentales de 10 a 1, y se escogió S. phureja 100 porque, además de Crioconservación de plantas en América Latina y el Caribe | 101"},{"index":3,"size":27,"text":"tener sus datos de pasaporte del CIP y contar con el código CIP703292, mostró vigor durante el subcultivo posterior a la fase de almacenamiento en el banco."},{"index":4,"size":127,"text":"Identificados los puntos críticos del proceso, se ajustaron las condiciones de manejo del tejido inicial, tales como la edad de la planta fuente del explante, el medio de cultivo (que aumentaría el vigor y mejoraría la calidad de la planta y el ápice) y las condiciones de crecimiento en el cuarto de propagación y mantenimiento. En la etapa previa a la crioconservación, también se ajustó el medio de preacondicionamiento para la congelación. Se determinó finalmente, en esa etapa previa, el efecto de la concentración y del tiempo de acción de la sacarosa en el tejido tratado, la respuesta del ápice encapsulado en gel de sílice al tiempo de deshidratación a que fue sometido y el efecto de las soluciones vitrificantes PVS2 y PVS4 en el tejido mencionado."},{"index":5,"size":74,"text":"Hechos esos ajustes, la investigación continuó luego en la estación de Tibaitatá. El objetivo ahora es ajustar aún más las condiciones de crioconservación de papa, para llevarlas a un punto óptimo, ya que el modelo usado es la subespecie S. tuberosum Grupo phureja. Este material, en realidad, es muy susceptible al estrés físico y al estrés químico, por lo que la tasa de recuperación después del congelamiento ha sido hasta ahora de 10 %."},{"index":6,"size":63,"text":"S. tuberosum ssp. andigena: Este trabajo se desarrolló como una tesis de maestría entre la CORPOICA y la Universidad Nacional de Colombia, Sede Palmira (Rivera et al. 2008). Para su desarrollo se definieron como explantes los microtubérculos de dos accesiones de S. tuberosum de la CCC de papa, con códigos CCC-4318 (carriza) y CCC-4981 (guata negra). Este proyecto se realizó en dos fases:"}]},{"head":"•","index":10,"paragraphs":[{"index":1,"size":125,"text":"Primera fase: Se recuperó el material de las condiciones de almacenamiento in vitro, se propagó en medio basal Murashige y Skoog (1962) sin adición de reguladores de crecimiento, 3 % de sacarosa y 0.2 % de carbón activado. Para la inducción de los microtubérculos se adicionó al medio 10 mg/L de cloruro de cloro colina (CCC) y 5mg/L de BAP bajo condiciones de oscuridad, 18 °C y 60 % de humedad relativa (HR). A partir de los tubérculos obtenidos se extrajeron yemas de estos para iniciar las pruebas de secado en cámara de flujo por exposición directa al flujo durante tiempos variables (de 15 minutos a una hora). Tiempos de secado altos reducen drásticamente la viabilidad de la yema previa a la fase de congelación."},{"index":2,"size":97,"text":"• Segunda fase: Yemas de microtubérculos desecadas en cámara de flujo por 30 minutos fueron congeladas por inmersión directa y recuperadas en medio convencional con 8 % de sacarosa. La supervivencia observada de las yemas fue del 99 %, 71 %, 36 % y 0 % de yemas sin secado (control), secadas por 30 minutos, secadas-congeladas y sin secar-congeladas, respectivamente (Rivera et al. 2008). Sin embargo, no se logró recuperar planta a partir del material congelado, una vez se pasó de condiciones de penumbra (14 días posteriores a la congelación, d.p.c) a condiciones de luz (30 d.p.c.)."}]},{"head":"Crioconservación de semillas","index":11,"paragraphs":[{"index":1,"size":5,"text":"Semillas botánicas de Manihot spp."},{"index":2,"size":141,"text":"La semilla de yuca se clasifica como ortodoxa. Marín et al. (1990) establecieron un protocolo sencillo de crioconservación para la semilla botánica de yuca y de algunas especies afines silvestres. Esta metodología consta de los siguientes pasos: se inicia con semillas cuyo contenido de humedad sea cercano a 8 %; las semillas se colocan en viales y se congelan mediante una programación (inicio: 25 °C; 2 °C/min hasta -50 °C, e inmersión directa en nitrógeno líquido) o sumergiéndolas directamente en nitrógeno líquido. Posterior a la congelación se recuperan como plantas, con una eficiencia cercana a 97 %, semillas descongeladas lentamente (del nitrógeno líquido a -70 °C, luego a 15 °C y luego temperatura ambiente, cada paso por una hora) para evitar rupturas de las semillas. Cuando se descongela rápidamente, se rompen del 7 % al 10 % de las semillas tratadas."},{"index":3,"size":45,"text":"Posteriormente, Escobar y Mafla (datos no publicados) lograron descongelar viales directamente a temperatura ambiente, incrementando el número de semillas por vial, ajustando bien las semillas sin dejar espacio entre una y otra en el interior, para evitar que se fracturaran durante el proceso de descongelación."}]},{"head":"Embriones de café","index":12,"paragraphs":[{"index":1,"size":103,"text":"Patiño et al. (1999), investigadores del Centro Nacional de Investigación del Café (Cenicafé) de Colombia, trabajaron en la crioconservación de embriones cigóticos y somáticos de café. Obtuvieron resultados prometedores congelando embriones cigóticos adheridos a las semillas (previamente secadas a la sombra). Una vez descongeladas las semillas, los investigadores permitieron que estos embriones germinaran in vitro y lograron un 54 % de germinación. Los embriones somáticos descongelados y puestos a germinar arrojaron un porcentaje de germinación (como respuesta) mucho más bajo (26 %), lo que sugiere, según los autores, que es necesario ensayar otros métodos de crioconservación, tales como la encapsulacióndeshidratación y la vitrificación."}]},{"head":"Semillas de palma de chontaruro","index":13,"paragraphs":[{"index":1,"size":65,"text":"En el marco del convenio 046/2004 suscrito por el CIAT con el Ministerio de Agricultura y Desarrollo Rural de Colombia, en dicho Centro se realizaron experimentos para desarrollar técnicas de conservación en nitrógeno líquido de varias especies de palmas, para lo cual se tomó como modelo metodológico la palma de chontaruro (Bactris gasipaes Kunth). Esta palma cultivada se escogió como modelo por las siguientes razones:"}]},{"head":"•","index":14,"paragraphs":[{"index":1,"size":22,"text":"Aumentó la demanda de material de propagación del cultivo, que se había convertido en opción del Plan Nacional de Desarrollo Alternativo (PLANTE)."},{"index":2,"size":20,"text":"• Era necesario responder a las preguntas biológicas sobre las actividades prioritarias de conservación de la flora amenazada en Colombia."},{"index":3,"size":79,"text":"En este contexto, dos especies de importancia del género Bactris -el chontaruro (Bactris gasipaes var. gasipaes) y el chinamato (B. gasipaes var. chinchagui)-habían sido incluidas por Bernal y Galeano en 2004 en la lista roja de fanerógamas de Colombia (citado por Aranzales 2005). Estos autores informaron que en 1992 se hallaban amenazadas de extinción en Colombia 47 de las 258 especies de la familia Palmae y que en 1994 ese número había ascendido a 208 de esas 258 especies."},{"index":4,"size":78,"text":"Como parte de un trabajo de tesis desarrollado en el CIAT (Aranzales 2005), se logró determinar el efecto del secado en la viabilidad y la germinación de las semillas de chontaruro antes y después de la fase de congelamiento. La HR de las semillas recién colectadas de frutos maduros e inmaduros (tres meses después de la polinización), que se cosecharon en la finca de un agricultor, oscilaba en alrededor de 45 %. El trabajo comprendió las siguientes actividades:"}]},{"head":"•","index":15,"paragraphs":[{"index":1,"size":50,"text":"Las semillas se colocaron en cuartos de secado a 20 ºC y a 40 % de HR, y se obtuvieron así semillas con 40 %, 20 % y 10 % de HR, en las cuales se determinó la viabilidad y el porcentaje de germinación antes y después de la congelación."}]},{"head":"•","index":16,"paragraphs":[{"index":1,"size":76,"text":"Las semillas desecadas sin congelar se colocaron en camas con arena estéril para evaluar su germinación. Pasados tres o cuatro meses, se observó respuesta en las que tenían 40 % de HR y no fue visible ninguna reacción en las de 20 % y 10 % de HR. En consecuencia, fue necesario implementar la técnica de rescate de embriones y diseñar una carta de colores para leer la prueba con sales de tetrazolio al 0.5 %."}]},{"head":"•","index":17,"paragraphs":[{"index":1,"size":80,"text":"Las semillas desecadas se empacaron en bolsas de aluminio selladas al vacío (10 semillas por bolsa) y se sumergieron directamente en nitrógeno líquido para congelarlas. Pasados 7 y 30 días después de la congelación (DDC), se evaluaron en ellas, como respuesta a la congelación, dos parámetros: viabilidad y emisión de brotes. Se observó que 30 DDC solo los embriones de semillas cuya HR era 10 % daban una respuesta positiva, tanto en viabilidad (80 %) como en brotes (53 %)."},{"index":2,"size":80,"text":"Se hicieron posteriormente ajustes a esta técnica de congelación. Si las semillas llevan de 8 % a 10 % de HR antes de la congelación, se obtiene en ellas un 80 % de viabilidad y un 60 % forman plantas. Asimismo, para validar y ampliar los resultados de este trabajo, se ensayó esta técnica en la palma africana (Elaeis guineensis Jacq.) y en el güérregue (Astrocaryum standleyanum Bailey), y en ambas especies se obtuvieron resultados positivos después de la congelación."},{"index":3,"size":34,"text":"Con este trabajo se dio una respuesta (como alternativa metodológica) al interrogante inicial sobre la posibilidad de desarrollar sistemas de conservación alternos para las especies amenazadas de extinción de la familia Palmae en Colombia."}]},{"head":"Embriones de palma de aceite","index":18,"paragraphs":[{"index":1,"size":172,"text":"La CORPOICA realiza trabajos de conservación de otras especies de palmas como parte de su estrategia de manejo de los bancos nacionales de recursos genéticos. El banco de germoplasma de palmáceas de Colombia alberga cerca de 339 accesiones de palma, chontaruro y cocotero, que se mantienen, principalmente, en condiciones de campo en el Centro de Investigación El Mira, en Tumaco (Nariño), en Colombia. Esta colección, activa y de trabajo, está continuamente expuesta a factores bióticos y abióticos que pueden ocasionar la pérdida del material biológico. Por consiguiente, el Programa de Recursos Genéticos y Mejoramiento Vegetal de la CORPOICA se dio a la tarea de desarrollar un sistema alternativo de conservación que permitiera mantener una copia de seguridad de estas especies, que son cultivos estratégicos para la economía del país, y que redujera a la vez los costos operativos y de mantenimiento de la colección mencionada. Partiendo de esa necesidad, se logró establecer, mediante experimentación, un protocolo para la crioconservación de embriones cigóticos de palma de aceite, que consta de los siguientes pasos:"}]},{"head":"•","index":19,"paragraphs":[{"index":1,"size":14,"text":"Se deshidratan los embriones durante dos horas en recipientes que contienen gel de sílice."}]},{"head":"•","index":20,"paragraphs":[{"index":1,"size":21,"text":"Los embriones desecados se introducen en viales y se someten a congelación directa por inmersión de los viales en nitrógeno líquido."}]},{"head":"•","index":21,"paragraphs":[{"index":1,"size":27,"text":"Cuando se descongelan, los viales se colocan en un baño a 37 ºC durante tres minutos, y así se obtiene una tasa de recuperación de 84.37 %."},{"index":2,"size":89,"text":"Esta metodología exige prestar atención especial al estado del embrión como tal previo a la congelación, es decir, a su desarrollo, su tamaño, su edad, la posición (o conformación) de la semilla en el racimo y las condiciones en que fue beneficiada la semilla, entre otros aspectos. La razón es que el proceso de desecación en gel de sílice causa daños severos e irreversibles al embrión (tanto en la radícula como en el haustorio), los que disminuyen su porcentaje de germinación después de la congelación (Villa et al. 2007)."}]},{"head":"Semillas de Cratylia","index":22,"paragraphs":[{"index":1,"size":93,"text":"Esta leguminosa arbustiva presenta gran interés en el trópico de Latinoamérica, ya que se convierte en una buena fuente de alimento para el ganado en épocas secas, pues presenta una alta retención foliar, capacidad de rebrotar en época seca y tolerancia a suelos pobres y ácidos, pero bien drenados (Peters et al. 2003). A pesar de que presenta una buena producción y calidad de semilla sin marcada latencia física o fisiológica, bajo ciertas condiciones de almacenamiento presenta una pérdida drástica de viabilidad, vigor y germinación (Lascano 1998, citado por Montoya et al. 2009)."},{"index":2,"size":150,"text":"Semillas con porcentajes de humedad variables (10 %, 8 % y 6 %) obtenidos mediante manejos de una relación de 1:2 entre semilla y gel de sílice, empacadas en Crioconservación de plantas en América Latina y el Caribe | 105 bolsas metálicas selladas y empacadas al vacío fueron transferidas directamente a nitrógeno líquido. El mayor porcentaje (86 %) de germinación poscongelación y el menor número de plantas anormales (5 %) se obtuvieron en semillas con 8 % de HR. Al comparar tres condiciones de conservación -en nitrógeno líquido, en cuarto frío (55 % de HR y 18 °C) y en ambiente-se observa un efecto marcado sobre la germinación de las semillas de Cratylia de las condiciones de almacenamiento y la humedad de la semilla. Las mayores pérdidas en germinación se observaron en ambiente con 6 % de HR, seguido por el almacenamiento en cuarto frío con -6 % de HR."},{"index":3,"size":17,"text":"Los resultados de Montoya et al. (2009) sugieren un comportamiento no ortodoxo de las semillas de Cratylia."}]},{"head":"Crioconservación de la flora amenazada","index":23,"paragraphs":[{"index":1,"size":43,"text":"La Universidad Nacional de Colombia, sede Palmira, mediante su Facultad de Ingeniería Agroindustrial y del Programa de Investigación en Recursos Genéticos de Plantas Medicinales, Aromáticas y Condimentarias, ha realizado experimentos, junto con el CIAT, en la crioconservación de la flora amenazada de extinción."}]},{"head":"Semilla de chambimbe","index":24,"paragraphs":[{"index":1,"size":80,"text":"En este proyecto se tomó como modelo experimental el chambimbe [Sapindus saponaria var. Drummondii (Hook. & Arn.) L. Benson]. El trabajo, que se incorporó en una tesis de pregrado (Arce et al. 2007), dio como resultado la caracterización morfoanatómica de la semilla y la evaluación del efecto sobre la germinación de tres métodos para escarificar mecánicamente la semilla: a) con lija, b) con cortes hechos cerca del micrópilo con una segueta, y c) perforando con una broca de 3 mm."},{"index":2,"size":40,"text":"Semillas con porcentajes de humedad variables (12 %, 5 % y 4 %) obtenidos mediante manejos de la relación entre semilla y gel de sílice, empacadas en bolsas metálicas selladas y empacadas al vacío, fueron transferidas directamente a nitrógeno líquido."},{"index":3,"size":48,"text":"Semillas escarificadas mediante perforaciones con la broca de 3 mm mostraron una geminación del 96 %. También se observó un comportamiento no ortodoxo de las semillas de chambimbe. Semillas desecadas hasta un 12 % de humedad y congeladas mostraron un 92 % de germinación en camas de arena."}]},{"head":"Crioconservación de frutales","index":25,"paragraphs":[]},{"head":"Tomate de árbol","index":26,"paragraphs":[{"index":1,"size":97,"text":"Los cultivadores de tomate de árbol manejan tres cultivares según la morfología, la calidad y, principalmente, el color del fruto (rojo común, morado y amarillo). Los tres cultivares son aceptados en el mercado y sus precios dependen de los mecanismos de demanda y oferta. El CIAT hizo una incursión en el campo de la conservación de frutales y tomó como modelo el tomate de árbol (Cyphomandra betacea (Cav.) Sendt.). Partiendo de semilla botánica colectada de frutos maduros y sanos adquiridos en los mercados locales, se desarrolló un protocolo de conservación en nitrógeno líquido (Montoya et al. 2002)."},{"index":2,"size":7,"text":"El protocolo consta de los siguientes pasos:"}]},{"head":"•","index":27,"paragraphs":[{"index":1,"size":45,"text":"Se obtienen semillas de frutos maduros y sanos de los tres cultivares, y se sumergen en agua durante 24 horas para lavarlas y removerles el mucílago; luego se desinfectan en cámara de flujo laminar con alcohol al 70 % y con hipoclorito al 1 %."}]},{"head":"•","index":28,"paragraphs":[{"index":1,"size":83,"text":"Las semillas tratadas se colocan luego en cajas de Petri abiertas, que se sitúan contra el flujo de aire de la cámara para deshidratar sus tejidos; este tratamiento dura de una a dos horas y media continuas, según el material experimental, hasta que la humedad de las semillas esté cerca del 7 %. La semilla de los frutos morados (variedad Mora) necesita más tiempo para llegar a ese punto. Este porcentaje de humedad es un requisito previo a la congelación de las semillas."}]},{"head":"•","index":29,"paragraphs":[{"index":1,"size":19,"text":"Las semillas deshidratadas se colocan en viales y se congelan por inmersión directa en un tanque de nitrógeno líquido."}]},{"head":"•","index":30,"paragraphs":[{"index":1,"size":37,"text":"Descongelados más tarde los tejidos en un baño a 37 °C, las semillas se siembran en un medio de cultivo, donde vuelven a crecer y producen plántulas normales y vigorosas que se trasplantan al suelo del invernadero."},{"index":2,"size":61,"text":"A pesar de la respuesta de viabilidad observada, no fue posible obtener plantas después del proceso de congelación, porque la semilla de las pasifloras experimenta un fuerte efecto de latencia. Esta condición debe resolverse antes de seguir con las técnicas de conservación, las cuales garantizarían la recuperación de las plantas después del proceso de almacenamiento a que se sometan las semillas."}]},{"head":"Nuevas iniciativas de crioconservación","index":31,"paragraphs":[{"index":1,"size":4,"text":"Crioconservación de Phytophthora spp."},{"index":2,"size":50,"text":"En el CIAT se han llevado a cabo trabajos preliminares de crioconservación de microorganismos como una experimentación alterna a los ensayos que se hacen con plantas. Sirvieron de modelo para este trabajo 80 aislamientos del género Phytophthora de la colección del Programa de Patología del Centro (Bedoya et al. 1999)."},{"index":3,"size":117,"text":"Es necesario mantener continuamente en replicación la copia activa de la colección del hongo en un refrigerador; por ello puede perder el aislamiento, entre otros atributos, la viabilidad o la pureza o la virulencia, o puede ocurrir que desarrolle una variabilidad no deseada. En este trabajo se evaluaron aislamientos del género Phytophthora obtenidos de tejidos de yuca, que fueron purificados y crecieron antes de entrar en la fase de congelación en un medio de agaravena. Del micelio que creció durante cinco días a 27 °C se obtuvieron discos centrales con un sacabocados esterilizado en cámara de flujo, y se colocaron en viales con DMSO al 15 %. La congelación programada se ejecutó mediante el programador Cryomed 1010."},{"index":4,"size":59,"text":"Se recuperaron al azar 32 de los 80 aislamientos congelados, y con ellos se infectaron algunas plantas bajo condiciones controladas en el invernadero. Se pudo demostrar que estos aislamientos congelados no perdían su poder de causar patogenicidad en las plantas de yuca susceptibles al patógeno, porque se compararon con los testigos no congelados y mantenidos como control del tratamiento."}]},{"head":"Banco de tejidos y de ADN crioconservados","index":32,"paragraphs":[{"index":1,"size":47,"text":"El auge de las técnicas de biología molecular y los estudios que se han hecho sobre diversidad genética, ecología, sistemática, biogeografía, genética de poblaciones y filogenia han despertado el interés de los investigadores en tener acceso directo al ADN para hacer más expeditos los trabajos que realizan."},{"index":2,"size":183,"text":"El Instituto de Investigación en Recursos Biológicos Alexander von Humboldt (IAvH) y el Ministerio del Medio Ambiente de Colombia crearon en 1998 un banco de tejidos y un banco de ADN, con el fin de disponer de una colección de referencia para el estudio de la biodiversidad colombiana desde la perspectiva genética y evolutiva (Palacio-Mejía 2006). En Latinoamérica, después de Brasil y Argentina, la colección de Colombia es la más representativa y diversa del mundo, con 1536 especies y alrededor de 11 000 muestras. Además, anualmente recibe un promedio de 1000 nuevas entradas. Del total de muestras de ADN almacenadas, 47.1 % corresponde a aves, 39.53 % a plantas, 3.54 % a mamíferos, 6.29 % a reptiles, 2.57 % a peces y el 0.97 % restante a anfibios, insectos y microorganismos. En el banco de ADN del IAvH hay dos tanques de almacenamiento con capacidad para alojar 76 000 muestras cada uno. De ellos, uno está en servicio activo y el otro se mantiene en reserva como sistema de seguridad, en caso de una falla mecánica, y para ampliar la capacidad del banco."},{"index":3,"size":184,"text":"Una muestra de ADN puede incluirse en esa colección, si tiene completos sus datos de pasaporte, que son la clave para la curaduría de la muestra, para dar información sobre ella y para darle sentido biológico al análisis, presente o futuro, en que ella intervenga. Cada ejemplar almacenado tiene una muestra de respaldo (voucher) en otra colección biológica, razón por la cual se trabaja en unión con la iniciativa de la Facultad de Ciencias de la Universidad de los Andes, a través del Banco de ADN y Tejidos del Museo de Historia Natural (BAT). Este se considera la segunda colección de tejidos más grande de Colombia y la primera en soportar información biológica asociada a cada espécimen a través de una base de datos donde se consigna información de caracteres morfológicos, ecológicos, geográficos y taxonómicos (voucher). Actualmente en el BAT se encuentran 1390 tejidos, 500 alícuotas de ADN total que abarcan 18 órdenes, 45 familias y 220 géneros de aves. Las muestras en el BAT se mantienen en seco a -80 °C y cada una tiene su duplicado en la colección central del IAvH."},{"index":4,"size":99,"text":"El CIAT inició recientemente una investigación que permite establecer un banco de ADN de yuca, fríjol, arroz, pastos tropicales y algunos frutales, cuyo objetivo es agilizar el servicio de entrega de muestras que se requieran para los análisis moleculares practicados dentro y fuera de la institución (Chacón et al. 2008). Este sistema de conservación tendrá, como ocurre en el sistema convencional in vitro, un protocolo de acceso fácil que debe descansar en la firma de un acuerdo normalizado para el intercambio de germoplasma (SMTA, por sus siglas en inglés) o para el intercambio de información en forma de ADN."}]},{"head":"Otros casos","index":33,"paragraphs":[{"index":1,"size":23,"text":"La Convocatoria Nacional 2007 para la Cofinanciación de Programas y Proyectos de Investigación, Desarrollo Tecnológico e Innovación para el Sector Agropecuario por Cadenas"}]},{"head":"Conclusiones","index":34,"paragraphs":[{"index":1,"size":73,"text":"En Colombia se cuenta con una experiencia amplia en la aplicación de técnicas de la crioconservación en diversos cultivos. La mayoría de estas investigaciones han sido desarrolladas mediante trabajos de pregrado y posgrado en universidades. Lamentablemente, una vez culminados, a dichos estudios no se les da seguimiento ni se establecen las colecciones pertinentes, debido en particular a aspectos financieros, por lo que los especialistas formados migran a otras actividades y/o proyectos de investigación."},{"index":2,"size":55,"text":"No se han logrado establecer bancos de germoplasma como iniciativas continuas, con excepción del banco del IAvH, adscrito al Ministerio de Ambiente, Vivienda y Desarrollo Territorial de Colombia, que opera como el banco de referencia y análisis de la diversidad genética colombiana de varios grupos biológicos, y la colección de yuca que mantiene el CIAT."}]},{"head":"Agradecimientos","index":35,"paragraphs":[{"index":1,"size":76,"text":"A los doctores William M. Roca, Joe Tohme y Daniel Debouck, quienes han apoyado durante años el trabajo de crioconservación en la agenda de investigación del CIAT y han permitido no solo aplicar nuestra experiencia a otras especies y cultivos de importancia en la región latinoamericana, sino ampliarla mediante la exploración de nuevas posibilidades. Al Sr. Francisco Motta, por la edición técnica del documento, y a la Sra. Lynn Menéndez, por la revisión final de él."}]}],"figures":[{"text":"Figura 8. 1 . Figura 8.1. Efecto del tipo de regulador aplicado al medio de regeneración en la etapa de poscongelación, según la metodología de Escobar et al. (1997). El medio C contiene 0.04 mg/l de BAP. En cada caso se diferencian, por su conformación, el callo y el brote. "},{"text":"Figura 8. 2 . Figura 8.2. Respuesta de ápices encapsulados de Manihot esculenta subspecies flabellifolia 444-002, después de la congelación en nitrógeno líquido. "},{"text":"Figura Figura 8.3. Respuesta de un CEF congelado mediante la técnica de la desecaciónvitrificación: A) crecimiento en poscongelación de la línea MCol 2215-A; B) etapa de conversión de embrión a planta en una línea celular de MNig 11 previamente congelada. "}],"sieverID":"d0392fea-e4af-4419-9825-bcb576b19113","abstract":""}

data/part_2/0a7cb64518bd425ef5e72972412d1444.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a7cb64518bd425ef5e72972412d1444","source":"gardian_index","url":"http://frc.forest.ku.ac.th/frcdatabase/bulletin/Document/7.Volume1-4%20Fernandez.pdf"},"pageCount":6,"title":"H Highlights of the Student-Faculty Dialogue to Improve Forestry Education in Southeast Asia","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":59,"text":"However, improvements in forestry education require concerted efforts from all stakeholders. With student enrolments apparently declining in most Southeast Asian (SEA) countries, there is even more reason to hear their opinions, considering that they constitute the new generation of forestry professionals, to help address the demands and challenges that the sector is facing now and in the near future."},{"index":2,"size":123,"text":"What other concerns do students have which need urgent improvement in forestry education? In what direction do they think forestry education should go to enhance and sustain their interest and ensure their market value after graduation? How could they adequately be involved and work hand-in-hand with academia in implementing the suggested improvements on forestry education? These are but a few of the questions whose answers may provide more informed decision making that will improve the quality of forestry education in the SEA region. A proper forum to discuss these matters is certainly needed. Thus, Kasetsart University and SEANAFE, in collaboration with the ASEAN Forestry Students' Association (AFSA) organized a Dialogue and, at the same time, hosted the conduct of AFSA's second organizational meeting."}]},{"head":"O Objectives","index":2,"paragraphs":[{"index":1,"size":162,"text":"The Dialogue generally aimed to strengthen the faculty-student relationship to build more effective and relevant forestry educational programs in SEA. Its specific objectives were to: Develop common understanding between faculty and students on the regional issues and concerns confronting forestry education; and Identify some practical ways to address these issues and concerns, which both faculty and students can act upon together on a short-and long-term basis. Meine van Noordwijk presented an overview on agroforestry at the interface of the climate change mitigation and adaptation debates. He provided examples of current policy recommendations based on interdisciplinary research and hypotheses for further research that can help shape future debates. Current international negotiations refer to the UNFCCC definition of 'forest', which includes 'institutional forest' (whether or not it has trees) and forest based on tree cover. A reorientation of current educational systems toward 'sustainability/sustainagility science' may need to open doors between existing disciplinary boxes to be relevant and prepare students for a variety of jobs."},{"index":2,"size":62,"text":"Participants gave their views on the two presentations. Two questions guided the discussions that proceeded; one was directed to the students and the other to all participants. These questions were: Why did you decide to take up forestry? What kind of career do you envisage for yourself after graduation? Should forestry as a program title be changed to reflect relevant global concerns?"}]},{"head":"H Highlights of Discussion","index":3,"paragraphs":[{"index":1,"size":19,"text":"The deans and professors shared the following current scenarios and personal opinions on forestry education in their respective countries: "}]},{"head":"Malaysia","index":4,"paragraphs":[{"index":1,"size":51,"text":"The choice of having forestry as a course is based on the existing university admission system, parent's preference and level of awareness of both parents and students of forestry as a career option. Students do not take their studies seriously because of spoonfeeding approach to teaching forestry by some faculty members."},{"index":2,"size":36,"text":"In developing curriculum based on government regulation, universities should ensure that students should possess some required competencies employers look for. However, universities are free to come up with their own approaches to implement this requirement accordingly."},{"index":3,"size":17,"text":"There are new jobs created by the government that have higher pay than a career in forestry."}]},{"head":"Philippines","index":5,"paragraphs":[{"index":1,"size":41,"text":"Student enrolment in the UPLB College of Forestry has decreased by almost 50% in recent years either because of the changing job requirements for foresters, competition of forestry graduates with those in allied sciences, and freeze hiring policy of the government."}]},{"head":"C Country C Current s sc cenarios/p pe ersonal perceptions on forestry education Thailand","index":6,"paragraphs":[{"index":1,"size":55,"text":"At KU, the number of freshmen admitted every year is limited to maintain quality, address the students' needs well and ensure a high employment rate after graduation. KU has double degree program offerings in the Faculty of Forestry within a 5 year period (i.e., B.Sc. Forestry major in social forestry and B.Sc. in Social Anthropology)."}]},{"head":"Australia","index":7,"paragraphs":[{"index":1,"size":22,"text":"There is shortage of foresters in Australia; interest in forestry is growing but there's a lack of knowledge of the career opportunities."},{"index":2,"size":24,"text":"Forestry degree is perceived as not requiring so much 'brain' from students and a career in this field is dirty and provides low salary."},{"index":3,"size":18,"text":"Most of the students revealed that forestry was not their preferred degree either, because of the following reasons:"},{"index":4,"size":97,"text":"They did not have adequate knowledge about forestry as a career Forestry is not perceived as a 'pure' science and has a lower status and entrance-grade requirement They thought employment opportunities are limited after graduation Either they are currently enrolled in the program because of influence from parents/relatives who are working in the forestry sector, or their entrance exam result did not qualify in their preferred faculty. However, they have eventually developed an interest in the program, which they attribute to the new knowledge and skills they are getting through the guidance of their lecturers and mentors."},{"index":5,"size":23,"text":"The points raised during the discussion validated some of the issues and challenges identified during the Nairobi Workshop and Hanoi Meeting as follows:"},{"index":6,"size":31,"text":"Declining student enrolment (particularly in Malaysia, the Philippines and Laos); Poor awareness of students on forestry as a career; Bad image of the forestry sector/profession; and Limited job opportunities for graduates."},{"index":7,"size":60,"text":"In general, the Dialogue participants recognized the need to enhance the regional perspective of forestry as a study program among universities in the region. This recommendation is targeted at (a) highlighting the multiple and ever-growing functions of forestry beyond national concerns, and (b) improving the competitiveness of graduates and opening up job opportunities for them at a more regional scale."},{"index":8,"size":17,"text":"To help achieve the enhancement of regional perspective of forestry, the Dialogue participants further recommended the following:"},{"index":9,"size":120,"text":"Redefine the scope of forestry as a study program in relation to current and future regional development demands; Review and revise forestry curricula to integrate related sciences/disciplines and promote forestry's multidisciplinary nature; Develop regionally acceptable standards in curricular offerings ensuring balance between core and elective courses; Strengthen linkages among universities in the region through increased faculty and student exchange programs; Provide relevant activities to students to enable them to acquire essential skills other than in forestry that are required by prospective employers, e.g., communication, entrepreneurship, management, public relations; Implement quality standards in student admission and monitoring of student performance towards enhancing quality of graduates; Promote forestry as a study program at both intermediate and secondary levels to increase student interest."},{"index":10,"size":36,"text":"With these recommendations, universities may either consider changing the title of their study program in forestry to enhance interest among students or retain the existing title provided they invest in effective promotion of the program content."}]}],"figures":[{"text":" Participants Thirty-three participants attended the Dialogue consisting of: a) 19 students from Indonesia, Malaysia, Laos PDR, Thailand, and Vietnam from the ASEAN Forestry Students' Association; b) 6 faculty of forestry deans from Kasetsart University (KU), Institut Pertanian Bogor (IPB), Universiti Putra Malaysia (UPM), University of the Philippines Los Banos (UPLB), National University of Laos (NUOL), and University Sabah Malaysia (UMS); c) 4 faculty of forestry associate deans from Kasetsart University; d) 2 representatives from ICRAF-SEANAFE; and e) 2 professors from the University of Melbourne and Chiang Mai University. Processes Undertaken Two presentations were made during the early part of the Dialogue: Jessus Fernandez provided background information on the Dialogue and highlights of the results of two related activities, namely: the 'First Global Workshop on Improving Forestry Education' organized by the African Network for Agriculture, Agroforestry and Natural Resources Education (ANAFE) in September 2007 in Nairobi, Kenya and the meeting on 'Establishing an Asia-Pacific Forestry Education Network' organized by SEANAFE and Melbourne University as a side event during the Asia-Pacific Forestry Week in April 2008 in Hanoi, Vietnam. "},{"text":"C Country C Current scenarios/pe ersonal perceptions on forestry education Indonesia Present generation of students are not too familiar with forestry as a science and as an eventual career after graduation. Forest conservation and ecotourism are more popular programs among students in IPB at present. IPB ensures admission of 'quality' students to the faculty of forestry; 70% of those admitted should come from the top 10% of graduates of secondary schools in Indonesia. The forestry sector/profession has acquired a bad image due to corruption and other illegal activities associated with it. Laos Linkage with other institutions allowed improvement of LaosLinkage with other institutions allowed improvement of  forestry curriculum in NUoL. forestry curriculum in NUoL.  Enrolment of students declined because university introduced Enrolment of students declined because university introduced  new programs that are more attractive to students and new programs that are more attractive to students and  perceived as offering better job prospects (e.g., environmental perceived as offering better job prospects (e.g., environmental  science and ecotourism). science and ecotourism).  "}],"sieverID":"a04d1640-619d-4b9a-ace0-7ab9a58f1001","abstract":"The role of forestry has apparently extended to managing trees in landscapes outside forests brought about by the rapidly changing societal demands for forest products and services. While the sector tries to manage sustainable forest production, it also faces the complexity of ensuring conservation to balance the demands of its multi-stakeholders. This indicates the need to have an improved capacity in the forestry profession.Two international meetings have been conducted recently with the aim of discussing ways to improve forestry education."}

data/part_2/0a9e185c2d3228b419b92fe6fba277db.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a9e185c2d3228b419b92fe6fba277db","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2023b694-9a2a-488b-ba79-a25ee243577a/retrieve"},"pageCount":3,"title":"CARD (Coalition for African Rice Development) initiative has contributed to increase rice production by 10.2 million ton in 2018, benefiting both rice producers and consumers","keywords":[],"chapters":[{"head":"Links to the Strategic Results Framework:","index":1,"paragraphs":[{"index":1,"size":1,"text":"Sub-IDOs:"},{"index":2,"size":14,"text":"• Conducive environment for managing shocks and vulnerability, as evidenced in rapid response mechanisms "}]},{"head":"Innovations: <Not Defined>","index":2,"paragraphs":[]},{"head":"Elaboration of Outcome/Impact Statement:","index":3,"paragraphs":[{"index":1,"size":191,"text":"The Coalition for African Rice Development (CARD) was initiated as a policy framework with the aim of doubling rice production in sub-Saharan Africa (SSA) over the period from 2008 to 2018. This paper assesses the contribution of the CARD policy to rice production and forecasts the local rice supply and demand to provide a better understanding of the policies needed to attain rice self-sufficiency by 2030. A combination of the autoregressive integrated moving average method and counterfactual approach was adopted using rice statistical data from 23 countries in SSA. The results showed that the contribution of CARD to paddy rice production in 2018 was 10.2 million tons, equivalent to 74% of the target. This contribution resulted from increases in area and yield of 23% and 19%, respectively. However, the yield growth rate was not sustainable in almost two-thirds of countries. Investments in supply-push factors such as fertilizer and irrigation development, which were the focus in the past, have limited effects on rice production. We conclude that sustainable investments in demand-pull factors such as the private-led modern milling sector and contract farming development should be prioritized to achieve rice self-sufficiency in SSA."}]}],"figures":[{"text":"CGIAR innovation(s) or findings that have resulted in this outcome or impact: This outcome is linked to the developement and implementation of policy measures and technology delevery duing the post-crisis period 2008-2018 to which AfricaRIce has actively contributed with the development of Emergency Rice Initiative Spreadsheet (ERIS) model to develop the National Rice Development Strategy (NRDS) and the Rice Offensive for West Africa. SRF 2022/2030 targets: SRF 2022/2030 targets: • Increased rate of yield for major food staples from current 1%/year • Increased rate of yield for major food staples from current 1%/year • # of people, of which 50% are women, assisted to exit poverty • # of people, of which 50% are women, assisted to exit poverty Description of activity / study: <Not Defined> Description of activity / study: <Not Defined> Geographic scope: Geographic scope: • Regional • Regional Region(s): Region(s): • Sub-Saharan Africa • Sub-Saharan Africa Comments: <Not Defined> Comments: <Not Defined> Key Contributors: Key Contributors: Contributing CRPs/Platforms: Contributing CRPs/Platforms: • Rice -Rice • Rice -Rice Contributing Flagships: Contributing Flagships: • F1: Accelerating impact and equity • F1: Accelerating impact and equity Contributing Regional programs: <Not Defined> Contributing Regional programs: <Not Defined> Contributing external partners: <Not Defined> Contributing external partners: <Not Defined>  "}],"sieverID":"8c4f6ea2-d700-465b-aa2c-e81d60954fb7","abstract":"Following the food price crisis in 2008, African governments, with support of partners including AfricaRice, JICA, etc., implemented policies through the Coalition for African Rice Development (CARD) to double rice production by 2018. We assessed the contribution of the CARD policy to rice production: the CARD policy contributed to increased rice production in 2018 by 10.2 million ton, which benefited both rice producers (increased sales and income) and rice consumers (lower market prices than without rice production increase)."}

data/part_2/0b314d218f9671b629738fee7c7d2c24.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b314d218f9671b629738fee7c7d2c24","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6b6500e4-ab9c-4a8f-97db-e613b9840990/retrieve"},"pageCount":20,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":46,"text":"La vitamine A est l'un des micronutriments essentiels à un système immunitaire fort et à une bonne vue. Les enfants dépourvus de quantités suffisantes de vitamine A risquent davantage de tomber malade et même de mourir que ceux dont le corps contient suffisamment de vitamine A."},{"index":2,"size":269,"text":"Les patates douces à chair orange (PDCO) sont l'une des sources naturelles les plus riches en bêta-carotène (BC). Le corps humain convertit le BC en vitamine A (rétinol) en équivalents d'activité du rétinol (EAR). Des études ont montré que 13 unités de BC se convertissent en une unité de rétinol (vitamine A). Il existe de nombreuses variétés de PDCO. Plus la couleur orange de la chair est intense, plus la racine contient de bêta-carotène. Les racines des variétés de PDCO en Afrique subsaharienne (ASS) contiennent 3.500 à 16.000 unités de BC pour 100 grammes (grammes) de poids frais. En moyenne, 20% de BC est perdue lors de la cuisson. L'ajout d'une cuillère à thé d'huile à une bouillie à base de PDCO augmente l'absorption de vitamine A de 50%. Il est prouvé que l'introduction de la PDCO parallèlement à l'éducation nutritionnelle au niveau communautaire améliore considérablement l'absorption et l' état en vitamine A chez les jeunes enfants 1 . La patate douce est une culture importante pour la sécurité alimentaire en ASS. La patate douce est connue comme la culture qui est là quand le maïs échoue. C'est un aliment de base fournissant les calories nécessaires au régime. Lorsqu'un aliment de base contient une grande quantité d'un micronutriment essentiel comme la vitamine A, nous l'appelons biofortifié. Les PDCO sont sélectionnées de manière conventionnelle. En surface, la partie aérienne de patate douce est composée de feuilles et de tiges. Les plus jeunes feuilles de patate douce peuvent être consommées comme légume-feuilles. Les longues tiges sont coupées en «boutures» de 20-30 cm et plantées pour la prochaine récolte de patate douce."},{"index":3,"size":37,"text":"Les tiges de patate douce constituent également un excellent complément alimentaire pour les animaux laitiers et les porcs. Les vaches laitières produisent du lait qui peut être converti en beurre, une autre source riche en vitamine A."},{"index":4,"size":119,"text":"Les tiges et les racines hachées de patate douce peuvent être combinées avec de la mélasse ou d'autres résidus de récolte et fermentées pour en faire de l'ensilage. L'ensilage peut être stocké pendant des mois, fournissant des aliments pour le bétail pendant la saison sèche. Une brochure sur la fabrication de l'ensilage est disponible à l'adresse suivante: www.sweetpotatoknowledge.org.   Des systèmes de semences véritablement durables doivent fournir de boutures ou de «semences» de qualité en quantités adéquates au moment où les agriculteurs sont prêts à planter. De nombreuses démonstrations sont en cours afin que les agriculteurs puissent voir l'avantage de l'utilisation de semences «saines». Dans plusieurs pays, les agriculteurs sont maintenant prêts à payer pour des boutures initiales de qualité."}]},{"head":"Une autre clé du succès consiste à utiliser des semences de qualité","index":2,"paragraphs":[{"index":1,"size":32,"text":"Au cours de la dernière décennie, les technologies de tunnel et de mini-serre ont été développées pour aider les multiplicateurs de semences de base formés à maintenir leurs propres stocks de boutures."},{"index":2,"size":45,"text":"Les sélectionneurs des programmes nationaux peuvent vous mettre en contact avec les producteurs de boutures de qualité des variétés qu'ils recommandent. En outre, le portail de connaissances sur la patate douce (www.sweetpotatoknowledge.org/ sphi-dashboard) contient des listes de multiplicateurs formés et décentralisés dans des pays sélectionnés."},{"index":3,"size":155,"text":"Dans les zones où la saison sèche dure plus de 4 mois, il est recommandé d'utiliser la méthode Triple S, à savoir stockage des racines dans le sable, puis germination, afin d'assurer des quantités suffisantes de boutures de qualité adéquate au début des pluies. Des outils détaillés pour utiliser cette approche sont disponibles sur le portail de connaissances sur la patate douce. Quand vous cuisez la PDCO à la vapeur avec la peau et puis et puis on fait de la purée, vous créez la purée de PDCO. Les PDCO peuvent remplacer 20 à 60% de la farine de blé dans les produits de boulangerie courants en leur donnant une couleur dorée. Cela peut être fait à la maison, mais pour une entreprise, on utilise généralement une machine à râper / réduire en purée pour assurer une purée sans grumeaux. Si la peau reste en place, vous obtenez une purée à haute teneur en fibres."},{"index":4,"size":94,"text":"La purée de PDCO est beaucoup plus moins chère à fabriquer que sa farine et contrairement à la farine de PDCO, elle est généralement plus moins chère que la farine de blé. Pour faire que la purée de PDCO soit aussi facile à utiliser comme la farine, CIP a mis au point une purée de PDCO emballée sous vide qui utilise des conservateurs aux prix abordables et disponibles localement pour permettre un stockage à une température égale ou inférieure à 25ºC pendant 3 mois. Cela aidera les boulangers à s'approvisionner toute l'année en PDCO."},{"index":5,"size":133,"text":"Antonio Magnaghi, technologue en alimentation chez Euro-Ingredients, a travaillé en étroite collaboration avec au le CIP pour adapter les recettes existantes du pain, des biscuits, du chapattis (pain plat) et Au Rwanda, les femmes représentent 75% des agriculteurs liés à Urwibutso Enterprises, qui produit des biscuits dorés, basés sur les PDCO. Les agricultrices disposant de moins de ressources ont été organisées en groupes afin de garantir un approvisionnement constant en racines pour la transformation. Elles ont reçu une formation supplémentaire pour augmenter le rendement de racines de PDCO. Sur leurs petites parcelles de terre, les femmes généraient 277 USD par an et par ménage provenant de la vente de racines de patate douce en 2014. L'introduction de boutures (semences) de qualité de variétés performantes a été essentielle pour générer un surplus à vendre."}]},{"head":"La purée de PDCO est un excellent moyen d'augmenter la teneur en vitamine A des produits de boulangerie","index":3,"paragraphs":[{"index":1,"size":30,"text":"En outre, de nombreuses femmes fabriquent des produits transformés de la PDCO pour les vendre sur les marchés locaux et dominent les ventes au détail de racines de patate douce."},{"index":2,"size":140,"text":"Pour faire la différence en matière de santé et de richesse, des agents de changement qualifiés sont nécessaires dans chaque pays pour collaborer avec les agriculteurs, les commerçants, les transformateurs et influencer les consommateurs. Pour vulgariser les dernières connaissances issues de la recherche, un cours de dix jours pour la formation des formateurs sur «Tout ce que Vous Avez Toujours Voulu Savoir à Propos de la Patate douce » a été mis au point et une institution locale a été identifiée en Tanzanie, au Mozambique, au Nigéria, au Burkina Faso et en Éthiopie comme organisatrice officielle du cours de formation. Les dates du cours sont annoncées sur le portail web de connaissances sur la patate douce. Les manuels couvrent 13 sujets et proposent des exercices pratiques. Les formats numériques sont disponibles en anglais, Français, portugais, kiswahili et amharique sur www.sweetpotatoknowledge.org."},{"index":3,"size":39,"text":"En outre, nous avons élaboré un guide d'investissement afin de fournir des informations détaillées sur le coût d'une intervention intégrée axée sur les PDCO dans les domaines de l'alimentation et de la nutrition. À cela s'ajoute un guide de"}]},{"head":"Apprendre «Tout ce que vous avez toujours voulu savoir sur la patate douce» en 5 langues","index":4,"paragraphs":[{"index":1,"size":123,"text":"mise en oeuvre permettant de concrétiser l'intervention proposée. Il existe également une trousse d'apprentissage en cinq volumes intitulée « Planification, mise en oeuvre, suivi et évaluation d'un projet (sensible aux deux sexes) de patate douce à chair orange », qui couvre tous les aspects de l'élaboration de la proposition et de la mise en oeuvre du projet. Un manuel contenant neuf outils de suivi clés spécifiques aux projets de diffusion de la patate douce est également disponible. L'apprentissage est un processus continu et nous encourageons les organisations à parrainer leur personnel technique afin qu'il rejoigne les groupes de travail techniques de la communauté de pratique (CdP) de leur intérêt. Chaque CdP se réunit une fois par an. Les groupes de la CdP sont:  "}]}],"figures":[{"text":" En plus, tous les types de patate douce sont également une bonne source de vitamines C et E, de plusieurs vitamines B La PDCO contient beaucoup d'autres vitamines et minéraux. C'est un Super aliment! et de minéraux magnésium et potassium. Par conséquent, la PDCO est un Super aliment. Les super aliments sont des aliments riches en nutriments considérés comme particulièrement bénéfiques pour la santé et le bien-être. Le Centre International de la Pomme de Terre (CIP) s'appuie actuellement sur la diversité naturelle des caractères génétiques de la patate douce pour augmenter la teneur en fer (Fe) et en zinc (Zn) des variétés de PDCO. Le Fe et le Zn sont deux autres micronutriments majeurs essentiels pour la santé. Valeurs de PDCO: Release 28 of the USDA National Nutrient Database for Standard Reference Reference Intakes: Institute of Medicine, Washington DC 2011. * La biodisponibilité n'est pas considérée dans ces données Daniel Mbogo, Technicien du CIP, préparant des échantillons pour l'analyse de la bêta-carotène par la méthode HPLC (crédit S. Quinn) Pourcentage de Contribution Nutritionnelle de la Racine de PDCO Bouillie au Besoin Quotidien d'un Jeune EnfantLa patate douce (Ipomoea batatas) fait partie de la famille des Convolvulacées (gloire de matin). Sous terre, elle produit des racines de réserve et non des tubercules comme la pomme de terre. La plupart des racines en Afrique subsaharienne sont consommées bouillies, cuites à la vapeur ou frites. Mais elles peuvent être transformées en nombreux produits différents, notamment en pain, biscuits et en jus. "},{"text":" urbains s'inquiètent du risque de diabète et cherchent à contrôler leur consommation en sucres. L'indice glycémique (IG) classe les aliments en fonction de leur effet immédiat sur la glycémie, avec 100 correspondant au maximum, représentant le glucose pur, l'IG pour la cuisson à la vapeur et au four des 1 Tumuhimbise, G. A., Namutebi, A.&., Muyonga, J. H. 2009. Microstructure and In Vitro Beta Carotene Bioaccessibility of Heat Processed Orange Fleshed Sweet Potato. Plant Foods Hum Nutr 64, 312-318. 2 Allen, J.C., Corbitt, A.D, Maloney, K.P., Butt, M.S., Truong, V-D. 2012. Glycemic Index of Sweet Potato as Affected by Cooking Methods, The Open Nutrition Journal, 6, 1-114.patates douces sont dans la fourchette 63-66 2 , ce qui indique un aliment à IG modéré. Les racines crues et les peaux cuites au four ou cuites à la vapeur ont des valeurs comprises dans la catégorie d'indice glycémique basses (30 à 34). Les consommateurs devraient également être encouragés à manger la peau de patate douce bouillie, cuite à la vapeur ou rôtie. Bien entendu, les frites de PDCO sont riches en calories, comme tout aliment frit. Sentez-vous un peu mieux que tout ce gras a rendu la vitamine A plus bioaccessible. Alternativement, les frites peuvent être cuites au four, avec une touche d'huile ajoutée. La diversité naturelle de la patate douce est extraordinaire. La banque de gènes du CIP comprend plus de 3.000 types différents. Les couleurs de chair comprennent la blanche, crème, jaune, orange et violette. Les couleurs de la peau sont également diversifiées. La plante peut pousser érigée ou rampante. Les plantes rampantes fournissent une bonne couverture du sol une fois établies. Une myriade de formes de feuilles existe. La patate douce aime les climats chauds mais pas trop chauds. Elle se comporte mieux à 25-29ºC avec 750-1000 mm de précipitations annuelles sur les bons sols avec un pH de 5,6-6,6. Mais on peut trouver des variétés qui produisent à basse altitude avec des précipitations annuelles de 400 mm sur des sols sableux. D'autres sont plus tolérants au froid, mais les périodes de maturité s'allongent dans des climats plus froids et le gel peut tuer la plante. De nombreuses variétés de patate douce résistent à la sécheresse une fois qu'elles La patate douce adaptable et climat-intelligente peut se cultiver du niveau de la mer à 2400 m d'altitude en Afrique subsaharienne sont établies. En Afrique orientale et australe, elle est connue comme culture qui réussit quand la culture de maïs échoue. Les variétés à maturité précoce (3-4 mois) sont très demandées par les agriculteurs ayant besoin de maximiser l'utilisation de leurs terres. La patate douce a un rendement énergétique beaucoup plus élevé par unité de temps par hectare que les cultures céréalières. Les rendements actuels en conditions pluviales varient entre 5 et 30 tonnes par hectare. Les agriculteurs pauvres apprécient le fait qu'ils peuvent souvent obtenir des rendements raisonnables de la patate douce sans avoir à utiliser des engrais inorganiques. Cependant, les agriculteurs commerciaux d'Afrique du Sud utilisant des semences de qualité de variétés améliorées, l'irrigation et les engrais, associés à une bonne gestion agronomique, atteignent 50-70 tonnes par hectare. De toute évidence, le potentiel de cette culture en Afrique subsaharienne est encore sous-exploité. Culture de patate douce dans un climat favorable (crédit F. Asfaw) La PDCO cultivée dans une zone de sécheresse (crédit V. Atakos) "},{"text":" La production in-vitro de plantules de haute qualité au Rwanda comme point de départ (crédit J. Low) Les tunnels en Éthiopie préviennent les insectes vecteurs de virus d'infecter les plants produits en serre à la station de recherché (crédit R. Brouwer) L'un des plus grands défis rencontrés tout au long de la chaîne de valeur de la patate douce est la durée de conservation une fois récoltée. L'utilisation sans attention de houes ou d'autres équipements qui coupent la racine lors de la récolte, introduit des points d'entrée pour les organismes causant la pourriture.Les petits exploitants ne récoltent souvent qu'une petite quantité de racines pour un ou deux repas et stockent le reste dans le sol jusqu'à quand ils en ont besoin. Ceci est connu comme une récolte échelonnée de petites quantités. Si de plus grandes quantités de racines sont récoltées, à moins qu'elles ne soient subérisées (cicatrisation des blessures), la durée de conservation est limitée, généralement de plusieurs jours à deux semaines. La cicatrisation consiste à exposer les racines de la récolte à une humidité élevée (90-95%) à 25-30ºC pendant 3 à 5 jours. Cela durcit la peau des racines, ce qui aide à protéger la racine des dommages et à guérir les plaies existantes, réduisant le Une manipulation améliorée pendant la récolte et le transport peut augmenter considérablement la durée de conservation risque d'infection par de maladie après la récolte. Une approche différente, appelée ressuyage dans le sol en pré-récolte, consiste à enlever le feuillage 2 à 4 jours avant la récolte afin de réduire les pertes après récolte.Pour minimiser les dommages, il est préférable de récolter la patate douce avec des outils à dents ou un équipement minimisant les dommages à la racine.Ensuite, les racines non lavées sont emballées dans des sacs ou des caisses de taille moyenne (environ 60 kg de racines), si ces récipients ont des prix abordables. Évitez d'utiliser des sacs de grande capacité nécessitant plusieurs personnes pour charger et décharger. Les gros sacs ont tendance à tomber quand on les décharge, endommageant les racines.De nombreux agriculteurs et commerçants abusent sans le savoir de leurs racines de patate douce. Cela conduit à des niveaux de pertes après récolte plus élevés.Le conditionnement serré des racines dans de gros sacs difficiles à manipuler entraîne des dommages considérables des racines et une durée de conservation réduite (crédit T. Stathers) Récolter avec soin en évitant de couper la racine est essentiel pour prolonger la durée de conservation (Crédit T. Stathers). Les agriculteurs peuvent étaler la plantation de leurs boutures de patate douce sur plusieurs semaines afin d'allonger la période de disponibilité des racines (c'est-à-dire une plantation échelonnée). Le défi survient lorsque la saison sèche commence et que des fissures apparaissent dans le sol, permettant aux charançons de la patate douce d'accéder aux racines et de les endommager. Fermer les fissures du sol, vous évitez les attaques de charançons, il en est de même quand l'irrigation garde le sol humide. Tout ceci pour éviter les fissures du sol ou d'exposer les racines étant donné que, les charançons ne peuvent pas creuser! Après la récolte, l'utilisation d'un bac à sable (méthode Double S) ou d'un magasin à fosses étagées peut également prolonger la disponibilité des racines pour la consommation domestique jusqu'à La disponibilité hors saison peut être prolongée par une récolte échelonnée et un stockage quatre mois. Fondamentalement, les racines non coupées et sans charançon sont recouvertes de sable froid, assurant ainsi que les racines ne se touchent pas. Les instructions sont disponibles sur www.sweetpotatoknowledge.org. Les grandes entreprises commerciales stockent les racines de la patate douce pendant plusieurs mois. Après le traitement de cicatrisation, les racines sont conservées dans des caisses à 13-15ºC. Les températures fraîches suppriment les charançons et la germination. Cependant, ces systèmes fonctionnent généralement à l'électricité. Le coût de tels systèmes est souvent prohibitif en Afrique subsaharienne et l'utilisation de chambres froides fonctionnant à l'énergie solaire est à l'étude. Les charançons pondent leurs oeufs dans les racines et les tiges, causant des dommages permanents (trous) à la sortie des larves (crédit M. Ghislain) Lors de la conservation pour la consommation domestique, des couches alternées de racines sans charançon et de sable sont faites de telle sorte que les racines ne se touchent pas (crédit E. Abidin) Plus de 90% de la patate douce en Afrique subsaharienne est consommée après cuisson à la vapeur ou bouillie, ce qui limite son utilisation. Des scientifiques ont travaillé avec des femmes locales en Ouganda, en Éthiopie, au Mozambique, au Malawi et au Ghana pour voir comment ajouter de la PDCO à des plats locaux pour améliorer leur contenu et leur saveur nutritionnels. Des livres de recettes pour chaque pays sont disponibles sur www.sweetpotatoknowledge.org/topics/ recettes de patate douce. Au Kenya, le CIP a collaboré avec le Chef Arnold Mawala pour élaborer des recettes incluant de la PDCO dans des plats attrayants pour les consommateurs urbains, tels que la confiture de PDCO, la salade de PDCO à l'avocat et la soupe de PDCO à la tomate et aux pommes. Découvrez les recettes sur https: // www. flickr.com/photos/106872707@N03/ albums / 72157682938229512. Pour les jeunes enfants, nous encourageons l'utilisation de la bouillie améliorée de la PDCO, par exemple les feuilles de PDCO avec des graines d'egusi (pistache) en Afrique de l'Ouest, purée de patate douce mélangée à une source de protéines (comme des arachides ou du poisson), un peu de gras (comme de l'huile végétale) et des légumes verts. Ces bouillies sont également utilisées dans les programmes d'alimentation scolaire.L'utilisation de la PDCO en Afrique subsaharienne se développe à travers l'incorporation dans les plats traditionnels et la cuisine moderne Pain plat traditionnel à base de purée de PDCO au Tigray, Éthiopie Feuilles de PDCO avec des graines d'egusi (pistache) en Afrique de l'Ouest Enfants mangeant de la bouillie de PDCO dans le cadre du programme d'alimentation scolaire de l'État d'Osun au Nigeria (crédit O. Phorbee) Emballage \"Tortilla\" à base de la PDCO à Nairobi, Kenya "},{"text":" Production de purée de PDCO à partir de racines passées à la vapeur et peléesAu Rwanda, le biscuit doré à 43% de la farine de blé remplacée par de la purée de PDCO La purée de PDCO remplace 35% de la farine de blé dans ce pain Tuskys en vente à Nairobi, au Kenya Purée de PDCO à haute teneur en fibre, avec peau, emballée sous vide Pour toute assistance sur la purée de PDCO contacter: Tawanda Muzinghi ([email protected]) ou Antonio Magnaghi ([email protected]) des muffins pour développer des produits de boulangerie de qualité et compétitifs à base de purée de PDCO.Lors du développement de tout nouveau produit transformé à base de PDCO, il est essentiel de respecter les normes de sécurité alimentaire et que la quantité de bêta-carotène soit connu pour qu'un étiquetage précis puisse être effectué.Le personnel de FANEL fourni conjointement par le CIP et Institut International de Recherche sur le Bétail (ILRI) au laboratoires de Biosciences pour l'Afrique orientale et centrale (BecA) à Nairobi, au Kenya. FANEL peut fournir des services aux clients du secteurs public et privé en matière d'analyse du bêta-carotène et de la vitamine C, analyse immédiate et analyse microbienne. FANEL accueille volontiers des étudiants en sciences de l'alimentation. Nous considérons qu'un produit de PDCO constitue une excellente source de vitamine A si une portion standard contribue 20% des besoins quotidiens du groupe cible et une bonne source si elle'il en contribue 10%. Laboratoire d'Analyse des Aliments et d'Evaluation de la Nutrition (FANEL) peut évaluer le contenu en bêtacarotène de tout produit Dans de nombreux pays d'ASS, la patate douce est traditionnellement cultivée, vendue et transformée en petites quantités par les femmes. L'introduction de variétés de PDCO à haut rendement pour la production dans les parcelles agricoles ou familiales, ainsi que la fourniture de conseils sur les pratiques de production améliorées et l'amélioration de l'accès aux intrants offrent la possibilité d'accroître la productivité chez les femmes. Cette augmentation peut entraîner une réduction de la carence en vitamine A et permettre d'améliorer la sécurité alimentaire. Les femmes sont plus disposées que les hommes à utiliser la PDCD pour l'alimentation des enfants et la consommation domestique. Bien que la productivité élevée de nombreuses variétés PDCO permettent aux femmes de vendre des racines et des produits transformés excédentaires, il est nécessaire de concevoir des interventions commerciales équitables pour les deux sexes qui garantissent que les femmes ne soient pas reléguées aux niveaux inférieurs des chaînes de valeur de la commercialisation et de transformation des PDCO, mais qu'elles aient également Les femmes bénéficient de la PDCO à travers les opportunités génératrices de revenus et d'une amélioration de l'alimentation familiale des opportunités au plus haut niveaux. Faire en sorte que les femmes aient les mêmes chances sur toute la chaîne de valeur pour les produits de PDCO, la formation à la création d'entreprise, les services financiers et d'autres ressources doivent leur être «favorables». "},{"text":"1) Amélioration génétique et génomique 2) Systèmes de semences et gestion des cultures 3) Marketing, transformation et utilisation 4) Surveillance, apprentissage et évaluation Contactez: Jan Low ([email protected]) pour plus de détails En octobre 2009, le Centre international de la pomme de terre (CIP) et 26 organisations partenaires ont lancé l'Initiative Patate Douce pour le Profit et pour la Santé, ou SPHI. Son objectif est d'améliorer la vie de 10 millions de ménages africains d'ici 2020 grâce à l'accès à des variétés améliorées de patate douce et à leur utilisation diversifiée. Il s'agit d'un effort impliquant plusieurs partenaires et plusieurs donateurs. Le SPHI cherche à utiliser le potentiel de la patate douce pour lutter contre la malnutrition et la pauvreté en ASS. Depuis 2014, le SPHI est co-dirigé par le CIP et le Forum pour la Recherche Africaine en Afrique (FARA). Cinq donateurs soutiennent la recherche pour lever les goulots d'étranglement pour une pleine exploitation de la culture et / ou pour un soutien aux efforts déployés à grande échelle pour fournir des variétés améliorées de patate douce aux agriculteurs et aux consommateurs afin que leur régime alimentaire et leurs revenus soient améliorés. Ce sont: la Fondation Bill & Melinda Gates, UKAid, l'USAID, Irish Aid, et L'Alliance pour une Révolution Verte en Afrique, leur soutien est vivement apprécié Le SPHI cherche à améliorer les conditions de vie de 10 millions de ménages dans 17 pays d'Afrique subsaharienne d'ici 2020 et nous encourageons d'autres à les rejoindre pour l'atteinte des objectifs fixés. Pour la dernière mise à jour sur le nombre de ménages atteints, consultez le tableau de bord SPHI. (www.sweetpotatoknowledge. org/sphidashboard). "},{"text":"Contactez: Jan Low ([email protected]) pour tout détail La communauté de pratique SPHI se réunit chaque année pour partager les progrès et les nouvelles découvertes qui renforcent notre capacité collective à améliorer nos vies.Visitez les sites Web ou contacter les membres du comité exécutif du SPHI par courrier électronique pour comprendre comment ces différentes organisations utilisent la patate douce. Toutes ces organisations se sont engagées à faire la différence en intégrant la PDCO dans leurs programmes. Nous sommes honorés de constater que l'évidence que la biofortification peut faire la différence été reconnu par la Fondation du Prix Mondial pour l'Alimentation en 2016. La PDCO est la principale culture biofortifiée en Afrique subsaharienne. De gauche à droite: ancien President du Malawi, Joyce Banda, Co-lauréate Jan Low (CIP), Co-lauréate Robert Mwanga (CIP), Président de Maurice, Ameenah Gurib, Co-lauréate Maria Andrade (CIP), Co-lauréate Howarth Bouis (HarvestPlus) Ceci est la force de l'agriculture travaillant pour la nutrition "},{"text":"  "},{"text":"  "},{"text":"Toutes les parties de la plante de patate douce peuvent être utilisées  1)Avec la sauce d'arachide et les racines 1)Avec la sauce d'arachide et les racines de PDCO de PDCO 2)Sauté 2)Sauté  "},{"text":"avec tomates, oignons et les petits poissons Les feuilles de patate douce sont une excellente source de lutéine Composition en nutriments de 100 g 1 de feuilles bouillies Nutriments Feuilles de niébé Chou Feuilles de patate douce  Énergie (kcal) 22 22 34 Énergie (kcal)222234 Protéine (g) 4.7 1.0 2.3 Protéine (g)4.71.02.3 Fibre (g) N.A. 1.9 1.9 Fibre (g)N.A.1.91.9 Bêta-carotène (µg) 348 74 550 Bêta-carotène (µg)34874550 Vitamine A (µg EAR) 29 7 46 Vitamine A (µg EAR)29746 Vitamine C (mg) 18 20 1.5 Vitamine C (mg)18201.5 Vitamine B1: Thiamine (mg) 0.26 0.06 0.11 Vitamine B1: Thiamine (mg)0.260.060.11 Vitamine B2: Riboflavine 0.14 0.06 0.27 Vitamine B2: Riboflavine0.140.060.27 Vitamine B3: Niacine (mg) 1.01 0.28 1.00 Vitamine B3: Niacine (mg)1.010.281.00 Vitamine B6 (mg) 0.14 0.11 0.16 Vitamine B6 (mg)0.140.110.16 Fer (mg) 1.1 0.17 0.6 Fer (mg)1.10.170.6 Calcium (mg) 69 31 24 Calcium (mg)693124 Phosphore (mg) 42 15 60 Phosphore (mg)421560  "},{"text":"Lutéine + zeaxanthine (g) N.A. 253 2,633 1 Source: U .S. Department of Agriculture (USDA) National Nutrient Database for Standard Reference, Release 28. La manière dont nous préparons les aliments affecte les quantités de nutriments disponibles pour notre corps. Deux excellentes manières de préparer les feuilles de patate douce sont: La manière dont nous préparons les aliments affecte les quantités de nutriments disponibles pour notre corps.Deux excellentes manières de préparer les feuilles de patate douce sont: La libération des nutriments de la matrice  La libération des nutriments de la matrice alimentaire lors de la digestion les rend  alimentaire lors de la digestion les rend bioaccessibles. Ensuite, notre propre état  bioaccessibles. Ensuite, notre propre état de santé et la présence de substances  de santé et la présence de substances telles que les graisses influencent les  telles que les graisses influencent les quantités absorbées par nos intestins,  quantités absorbées par nos intestins, reflétant ainsi leur biodisponibilité.  reflétant ainsi leur biodisponibilité. Quand une patate douce à chair orange  Quand une patate douce à chair orange crue est cuite, environ 20% du bêta-  crue est cuite, environ 20% du bêta- carotène est perdue. Pour maximiser  carotène est perdue. Pour maximiser la conservation des nutriments, il est  la conservation des nutriments, il est préférable de ne pas retirer la peau  préférable de ne pas retirer la peau de la patate douce avant la cuisson et  de la patate douce avant la cuisson et si en ébullition, de garder le couvercle  si en ébullition, de garder le couvercle sur la casserole. Le bêta-carotène est  sur la casserole. Le bêta-carotène est un caroténoïde, et les caroténoïdes  un caroténoïde, et les caroténoïdes sont mieux absorbés quand on y ajoute  sont mieux absorbés quand on y ajoute au moins une cuillérée à café d'huile  au moins une cuillérée à café d'huile dans le repas. Les sources de graisse  dans le repas. Les sources de graisse comprennent l'avocat, l'arachide, la noix  comprennent l'avocat, l'arachide, la noix de coco et les huiles végétales.  de coco et les huiles végétales. La bioaccessibilité in-vitro des variétés  La bioaccessibilité in-vitro des variétés PDCO a été étudiée en Ouganda 1 . Fait  PDCO a été étudiée en Ouganda 1 . Fait  "},{"text":"La manière dont l'aliment est préparé affecte la teneur en nutriments  intéressant, bien que l'exposition à la intéressant, bien que l'exposition à la chaleur réduit la rétention de la bêta- chaleur réduit la rétention de la bêta- carotène; ceci est compensé par la chaleur carotène; ceci est compensé par la chaleur qui augmente la bioaccessibilité de la qui augmente la bioaccessibilité de la bêta-carotène, car elle brise les complexes bêta-carotène, car elle brise les complexes protéiques dans lesquels la bêta-carotène protéiques dans lesquels la bêta-carotène est inclue. En classant la patate douce en est inclue. En classant la patate douce en fonction de la bioaccessibilité de la plus petit fonction de la bioaccessibilité de la plus petit valeur à la plus grande, il a été constaté que: valeur à la plus grande, il a été constaté que:  "},{"text":"racine crue<au four<cuite à la vapeur/bouillie <friture  La quantité de vitamine A bioaccessible La quantité de vitamine A bioaccessible (exprimée en unités équivalent d'activité (exprimée en unités équivalent d'activité de rétinol pour 100 g) pour la variété PDCO de rétinol pour 100 g) pour la variété PDCO Kabode s'est révélée être : Kabode s'est révélée être :  "},{"text":"amélioration génétique en Afrique pour l'Afrique a été essentielle pour faire accepter les variétés de PDCO en Afrique subsaharienne pressions exercées par les maladies et les ravageurs en ASS. Beaucoup de gens pensent que la patate  Beaucoup de gens pensent que la patate douce est originaire d'Afrique, mais elle  douce est originaire d'Afrique, mais elle vient d'Amérique centrale ou d'Amérique du Sud. Les commerçants portugais ont importé la patate douce en Afrique au 16ème siècle. Pour une raison quelconque, les variétés dominantes en ASS sont à chair blanche, n'ayant pas de bêta-carotène, ou chair jaune, avec des quantités limitées de bêta-carotène ou pas du tout. Lorsque nous parlons d'amélioration variétale, cela signifie qu'un bloc de croisement a été établi et que différentes variétés sont sélectionnées pour être parents mâles ou parents femelles. Lorsque le parent femelle fleurit, un technicien peut introduire le pollen du mâle et faire un «croisement contrôlé». L'alternative est de laisser les abeilles vient d'Amérique centrale ou d'Amérique du Sud. Les commerçants portugais ont importé la patate douce en Afrique au 16ème siècle. Pour une raison quelconque, les variétés dominantes en ASS sont à chair blanche, n'ayant pas de bêta-carotène, ou chair jaune, avec des quantités limitées de bêta-carotène ou pas du tout.Lorsque nous parlons d'amélioration variétale, cela signifie qu'un bloc de croisement a été établi et que différentes variétés sont sélectionnées pour être parents mâles ou parents femelles. Lorsque le parent femelle fleurit, un technicien peut introduire le pollen du mâle et faire un «croisement contrôlé». L'alternative est de laisser les abeilles Les consommateurs adultes d'Afrique de faire la pollinisation -un polycross. Ces Les consommateurs adultes d'Afrique defaire la pollinisation -un polycross. Ces l'Est aiment les variétés à la texture très croisements génèrent des semences l'Est aiment les variétés à la texture trèscroisements génèrent des semences farineuse, avec une teneur en matière botaniques. Chaque semence qui germe a farineuse, avec une teneur en matièrebotaniques. Chaque semence qui germe a sèche supérieure à 30%. Ceux d'Afrique le potentiel d'être une nouvelle variété de sèche supérieure à 30%. Ceux d'Afriquele potentiel d'être une nouvelle variété de australe préfèrent les variétés à 27-30% patate douce. australe préfèrent les variétés à 27-30%patate douce. de matière sèche. Aux États-Unis, en  de matière sèche. Aux États-Unis, en revanche, les patates douces à chair  revanche, les patates douces à chair orange dominent. Les types américains  orange dominent. Les types américains sont faciles à écraser, avec des teneurs  sont faciles à écraser, avec des teneurs en matière sèche de 18 à 22%. Quand ces  en matière sèche de 18 à 22%. Quand ces types de variétés de PDCO ont été testés  types de variétés de PDCO ont été testés en ASS, les jeunes enfants les aimaient  en ASS, les jeunes enfants les aimaient parce qu'ils étaient sucrés et faciles à  parce qu'ils étaient sucrés et faciles à avaler, mais les adultes les trouvaient  avaler, mais les adultes les trouvaient trop molles. En outre, les variétés  trop molles. En outre, les variétés introduites succombent souvent après  introduites succombent souvent après quelques saisons aux différentes  quelques saisons aux différentes  "},{"text":"Les sélectionneurs de 15 pays africains ont homologué 81 variétés de PDCO adaptées depuis 2009 De nombreux sélectionneurs de patates douces ont adopté l'approche de sélection accélérée développé par le CIP qui a permis de réduire le temps du croisement à l'homologation des variétés de 8 à 4-5 ans. Pays Nom du sélectionneur Contact Email PaysNom du sélectionneurContact Email Burkina Faso Koussao Some [email protected] Burkina FasoKoussao [email protected] Burundi Gaspard Nihorimbere [email protected] BurundiGaspard [email protected] Éthiopie Fekadu Gurmu Balcha [email protected] ÉthiopieFekadu Gurmu [email protected] Ghana Kwadwo Adofo [email protected] GhanaKwadwo [email protected] Côte d'Ivoire Konan Evrard Brice Dibi [email protected] Côte d'IvoireKonan Evrard Brice [email protected] Kenya Benjamin Kivuva [email protected] KenyaBenjamin [email protected] Madagascar Michelin Bruno Rasoloniaina [email protected] MadagascarMichelin Bruno Rasoloniaina [email protected] Malawi Obed John Mwenye [email protected] MalawiObed John [email protected] Mozambique Jose Ricardo [email protected] MozambiqueJose [email protected] Nigeria Solomon Olufemi Afuape [email protected] NigeriaSolomon Olufemi [email protected] Rwanda Jean Ndirigwe [email protected] RwandaJean [email protected] Afrique du Sud Sunette Laurie [email protected] Afrique du SudSunette [email protected] Tanzanie Everina Lukonge [email protected] TanzanieEverina [email protected] Ouganda Benard Yada [email protected] OugandaBenard [email protected] Zambie Martin Chiona [email protected] ZambieMartin [email protected]  "}],"sieverID":"b80a7682-c991-441f-8f6e-b33c487c384b","abstract":"Cette publication est enregistrée par le International Potato Center (CIP). Il est autorisé à utiliser sous la licence internationale Creative Commons Attribution 4.0 Le Centre international de la pomme de terre (CIP) voudrait remercier tous les bailleurs de fonds et organisations qui lui apportent un appui global à travers leurs contributions au CGIAR Trust Fund: www.cgiar.org/funders …à la première bouchée NATURELLEMENT RICHE EN VITAMINE A 4ème Edition: Octobre 2018 Ecrite par Jan W. Low Conception graphique par CIP-CPAD Imprimée avec le soutien financier du projet SASHA Traduite en français par Koussao Some et Paul Demo www.sweetpotatoknowledge.org www.cipotato.org"}

data/part_2/0b341a1321f0f301bf2cd22caa7a9c8a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b341a1321f0f301bf2cd22caa7a9c8a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5e2d2e3d-5512-425f-ba16-a0e750c158cc/retrieve"},"pageCount":12,"title":"","keywords":[],"chapters":[{"head":"La productíon de haricots en Afrigue","index":1,"paragraphs":[{"index":1,"size":79,"text":"On estime que la production de Phaseolus vulgaris L. en Afrique de l'Est, en i\\frique centrale et en Afrique australe atteint entre 2 et 2,5 millions de tonnes par ano Cette production est généralement concentrée dans les régions de hrlllts plnteflux plus fraiehes d'Afrique de l'Est et d'Afrique eentrale, particulierernent nu Burundi, au Kenya, au Rwanda, en Tanzanie, en Ouganda et au Zarre, bien que cette culture soit également importante dans d'autres pays et dan s des environnernents semi-arides."},{"index":2,"size":103,"text":"Le harieot joue un role crucial dans I'alimentation hurnaine dans la région. Au Burundi et au Rwanda, approxirnativement 45 pour eent des protéines alirnentaires totales proviennent de la consornmation de haricots Omportance plus grande que dans tout pays d'Amérique Latine, le centre de diversité de cctte culture). La complémentarité du haricot avec les cultures amylacées de base dan s le régime alimentaire est d'importance dan s les systemes de culture du mars/haricot et du sorgho/haricot et elle est vitale la ou les régimes basés sur le rnnnioc ou la banane ont été associés avec de graves symptomes de carence protéique, comme en Ouganda."},{"index":3,"size":106,"text":"Les petits exploitants sont les principaux producteurs de haricots, dont la majeure partie provient de la culture intercalaire avec le mars, le sorgho ou la banane. La plupart de la produetion est destinée a la consommation de sUbsistance, a laqueIle s'ajoute une certaine production destinée a la vente aux populations urbaines pour lesquelles le haricot constitue normalement une SOllrce de protéines bon marché. Les engrais et les pesticides sont rarement utilisés pour la production du haricot dans cette région, les rendements sont infériellrs ñ une tonne par hectnre et les accroissements de la production sont principalement obtellus gréice a l'expansion de la superficie cultivée (CIAT, 1981)."},{"index":4,"size":74,"text":"On peut toutefois trouver de grandes différences au niveau des pratiques culturales a peu de distance. En Ethiopie, par exemple, des haricots blancs ii petites graines sont cultivés comme culture de rapport principale dans la Vallée du Hift, avec un régime de précipitations de 600 a 800 mm, dans un systeme de lTlonoculture a utilisation minimale d'intrants: un seul labour pour incorporer les graines semées a la volée et aueun désherbage par la suite."},{"index":5,"size":118,"text":"Dans un endroit a pluviométrie plus élevée de la région VOISlIlC <le Sidarno des haricots rouges a grosses graines sont au contraire cultivés deux fois par an pour des raisons de subsistance. Les haricots sont souvent intcrcl1lés nvec des IIHÚS, semés en rangées apres le labour, avee desherbnge manuel ullél'ieur. ))ans eet exemple, des recommandations visant a accroitre les rendelllents du systeme de monoculture a utilisation minimale d'intrants ont été mises 1111 point rnais, a l'exception d'un changement de variété, la plupart de celle-ei sernblcnt inacceptables pour les paysans car leur mise en oeuvre illlpliqUN/lit que I'on détourne la main d'oeuvre d'autres cultures ou activités lors des périodes les plus chargées de la campagne agricole (Tilahun Mulatu, 1986)."},{"index":6,"size":173,"text":"Les maladies et les insectes, la faible fertilité du sol et, dans CNto ines régions, des déficits d'humidité du sol sont les principales lirnitations naturellcs assoriées aux faibles rendements. L'anthracnose (Colletotrichum lindernuthianum), le flétrissement bactérien (Xanthomonas phaseoJi), la tache follnire nnglllnire (lsariopsis griseola), le virus de la rnosarque sont les maladics les plus importantes dans tous les pays. La mouche du haricot (Ophiomyia spp.) est l'insecte qui cause les principaux probl(unes. Bien que des sources de résistlltlce (lUX rroblemc~ rnentionnés ci-dessus aient été identifiées, elles se trouvent sauvent dllns des haricots dont les graines ne sont pas acceptées par les eonsornmateurs ou dont l'adaptation est rnédiocre et elles ne conviennent done pas aux paysans. Par exernple, le cultivar le plus Important en Ethiopie, Mexlcnn-142, est sensible a la plupart des pathog?mes cités plus haut. Afin de réduire la pression exercée par les rnaladles, dans de nornbreux pays, les paysans plantent a des densités tres faíbles et acceptent un rendernent potentiellernent plus faible en plantant des harieots dangereusement pres de la salson seche sulvante."},{"index":7,"size":191,"text":"En Afrique, les haricots sont principalement consornmés saus forme d'haricots arrivés a maturité, solt secs ou avant le début du processus de déshyrlratBtion. Les gousses vertes revetent également une certaine lmportallce et les jCllnes (euilles tendres sont parfois consommées comme légume. Les types il grandes grllines rouges, rouge et brunes, tllchetées ou mouchetées, ont la préférence dans de nombreuses régions mais les préférences lié es a la couleur des graines semblent moins strictes qu'en Amérique Latine. Un temps de cuisson réduit est tres important la Ol! le probleme de bois de feu est critique, comme !lU RW!lllda. Le haricot, dont le temps de cuisson est plus long que la plupart des autres aliments communs du régime alirnentaire déterrnine en grande partie la quantité de bois de feu utilisée (CIAT,198Gb). La saveur est aussi un élément important pour déterminer l'acceptation d'une nouvelle variété bien que, de nouvenu, il soH difficile de généraliser: une variété apetites graines, ne retenant pas la préférence du point de vue commercial, était populalre dllns le secteur le plus pauvre de la population rurale de Kirinyaga au Kenya car les semences étaient moins cheres au marché (Frllnzel, 1982)."},{"index":8,"size":126,"text":"Organisation du programme du CIAT sur le haricot en Afrigue Plusieurs prograrnmes nationaux de recherche sur le haricot existent depuis longtemps et certains d'entre eux sont en mesure de démontrer que les exploitants ont adopté les résultats de leurs reeherches sur une grande échelle; d'autres pays n'ont pas cette chanceo Lors d'une premiere réunion des chercheurs sur le haricot au niveau national organisée au Malawi en 1980(CIAT. 1981), des priorités ont été établies. Elles ont été adoptées sous la forme des objectifs du Programme du CIAT sur le hericot en Afrique. Ces objectifs sont menés a bien en soutennnt les efforts natlonaux particUllerement dans le domaine de l'améliomtion génétiqup, la mise au point de systemes cUlturaux plus productifs et plus stables et In formation du personnel."},{"index":9,"size":158,"text":"A partir de travaux eommencés en 1983 dans les pays francophones de la reglOn des Grands Lacs, trois programmes nationaux de recherche sur le Imrícot, finmlcés séparément, ont été mis sur pied. Leur organisation el leufs erfectifs sont r6surnés au tableau l. Dans chaque cas, des membres du personnel du CIA T sont affectés. apres accord, pour colJaborer avec le programme nationel hote, tout en conservant des responsabilités régionale qui, dans certains cas, vont au-f!(>lil des sOl!s-rpgiolls. Des avantages de la décenlralisation (contact quotidien avcc UlI grnnd l1omhr(> de programmes nationaux el de zones agroécologiques; grollpes plus rC'streints d'expatriés moins suceptibles d'imposer des décisions au progrnrnme nationnl) et ceux de la centralisation (travail d'équipe interdisciplinaire plus aisé et masse critique). Le modele de décentralisation est considéré comme pnrticulierement approprié pour l'Afrique de l'Est, oU les programmes nationaux 1'onl en général plus développés que dans les deux autres régions. Agronome spécia 1 istc des systeme culturaux, '\" Phytogénéticien, Agronome."},{"index":10,"size":63,"text":"Pathologíste Quatre stages ont été organisés 1 'année dernlE~re et un total d(' 80 personnes, provenant de 13 programmes nationaux, a re~u ce type de formntion a court terme. La collaboration avec l' lITA pour deux de ces stages a permis de répondre aux besoins plus larges des programmes nationnux responsables pour la culture de haricot, de niébé et d'autres légumineuses a graines."},{"index":11,"size":255,"text":"(ji) Méthodes de recherche sur 1 es systemes de production Le programme des Grands !,acs, fortement engngé depuis 1983 flnns tn r('chPI'Chc biologique et socio-économíque dans les exploitatlons afin de diagnnsliqner les besoins et d'évaluer la technologie prometteuse a collaboré avec le CI~!MYT pour organiser des séminaires de formatlon portant sur les méthodes de recherche sur les systemes de production, principalement pour le Rwanda et le Rurundi. Ces séminaires ont suivi I'approche générale mise au point précédemment par le CIMMYT, qui comprend une série échelonnée de réunions quí cOllvrent les étapes des enquetes de díagnostic, la planificaBon des essais en exploitations et la gestion aínsi que I'analyse de ces essais. Ce stage a été quelquefois proposé en anglais mais, COllll!1C 1('8 anlr'es stngcs organisés au siege, il est principalement destiné a l'Amérique Latillc. Les unités suivantes sont disponibles pllr l'intermédiaíre des rrogrll!11ll1es rpgíollfltlX pour les principales instituLions oe reeherche el de forrnation de In région: -Les especes cultivées oe Phaseolus -Morphologie de la plnnte de haricot commun -Etapes du développement de la plante de haricot commUIl -Morphologie et développement de la grnine -Maladies du haricot causées par des cryptogrames et mOyE'lls {)(' Inl t(' -Principoles maladíes des hnricots en Afrique -Principaux insectes ottnqnant les haricots stockés et moyens de ltlllc -Biologie el moyens de lutte contre le !lonchet rond -Graines de Imricot de bonne qualité -Eléments essentiels ponr la réussíte des progrnmme semenciel's -Príncipes de In cultur(' intercnll1ire nver. 1\" IlnrÍ<'ot -Systemes de pl'oduction de Iloricot en ¡\\frique Deux nouvelles unités sont en cours d'élaboration:"},{"index":12,"size":90,"text":"-Croisement chez le haricot -Recherche dana les exploitations pour l'amélioratioll dll hnrieot Ces lInités didllctiqlles pellvent etre utiJísées pour se former seul. Tontefoís, l'expérience de leur utilisatlon, lora de stages de formatioll OIl!lS la r~~ioll, montre qu'il vaut miellx remplacer le commentaire enregistré par un professeur, qui s'est familiarisé avec le contenu des diapositives et du manuel, et distrihllcr un exemplaire du manuel ¡¡ chaque stagíaíre. Les chefs de progrolllllle on le personnel unlversltaire peuvent également choisír des diapositíves et les combiner avec les leurs pour illustrer un sujet particulier."},{"index":13,"size":3,"text":"Recherche en collaboratlon"}]},{"head":"' .","index":2,"paragraphs":[{"index":1,"size":62,"text":"Afin d'encourager le renforcement des programmes nationaux les plus susceptibles de rester efficaces apres le retraJt de l'appui extérieur, les progrommes r~gionnllx du CIAT ne mettent pas sur pied des essals séparés sur le terrain. CIHlque e(fort est fait, au contralre, pour aíder les équipes nationeles lors de la conception, de la planification et de l'application de la recherche sur le terrain."},{"index":2,"size":93,"text":"Comme les pays voisins ont souvent en commun des zones agroécologiqlles et des contraintes similaires au niveau des exploitations, un programme régionol peut encourager une collaboration utHe entre les programmes nntiOl1lHlX pOllr résoudre des problemes de recherche communs. Des reSSOllrce~ lilllitr{'!'l ~Ol1t utilisées plus efficacement si différents programmes natiollaux cOl1centren! leurs efforts sur des aspeets complémentaires. Les capacités de plnnification et d'analyse des chercheurs travaHIant dans les programmes nationoux ~ont stimnl~('s par des sessíons de planification en collaboration et un groupe de pnirs cxaminc les progres réalisées dans le domaine de la recherche."},{"index":3,"size":23,"text":"Les comités dlrecteurs régionaux ont identifié trois groupes de recherehe en collahoration. Les programmes régionaux leur apportent un appui teclmiqne et financier partiel:"},{"index":4,"size":59,"text":"-Evaluation interpays, ex. l'AFBY AN (Pépiniere ponr tester le rendement et l'adaptation du haricot en Afrique). Cet essai vnriétol r6giollol permet non seulement achaque programme national d'évolner des vari6tés prometteurses ou distribuées par d'autres programmes nntiol1nux milis ol!s~i d'identifier des sites ou des zones agroécologiques similaires pour un trollsfert des varlétés et une information sur la recherche dans l'avenír."},{"index":5,"size":83,"text":"-Répartition des efforts sur un domaine de recherche eOIll 111 UI1 , rnr exemple, une stratégie régionale pour la recherche sur la mouehe OU hnricot. Les capacités actuelles des programmes nationaux en ce qui eoncerne les ~trnt¡':gies de lutte intégrée comprenant la sélection pour la résistance che? la rJl.1l1tc hote, la recherche écologique menant a un degré de lutte culturnle el/oll hiolop:íqtle et l'utilisation d'lnsecticlde varient. Les programmes notionollx allt npprotlvé une certalne spéciallsation des eUorts et la mise en commun des résultnts."},{"index":6,"size":69,"text":"-Role dominan! au niveau de la régipll pOllr certoins domnines prioritaires sélectionnés, par exemple, la sélection du harieot pOllr In rrsi~I!l!l('e aux Inlllodics. Les progrnmmes natlonaux ne pCllvcnt necord\"r J'\"U{,lltiOTl ¡d¿;\"!,,s pour le criblage spécifique du matérlel génétique n'existent que dans certains sites. En Afrique de l'Est, )'Ouganda a un rOle dominant pOllr In flétri~~llr() rlue a Ascochylu phaseo!orum alors que I'Ethiopie se penche sur In rouil!e <1u Iwricot."},{"index":7,"size":68,"text":"Des techniques de recherche-cIé sont mises au poin! par le progrnlJJme dominon!, qui mime a bien le criblage initial du matériel génétique ofín d'iden!ifier des sources réelles de résistance et aide les aulres programmes en mntiere de formation. Toutefois, on encourage ou on aide les au!res progrm!llOes nntionoux íntéressés a évaluer les pertes de rendement el a utilíser les soU!'ces de résislance dans leurs propres programmes de sélection."},{"index":8,"size":112,"text":"L'introduction de ressources génétlques de haricot provemmt ¡¡ la f ois des celltres de diversité génétiques d'Amérique Latine et d'nutres régions d'Afrique, a considérablement renforcé la base de plusieurs programmes nationaux pour l'amélioration du haricot. Par exemple, en deux ans, le prognunme nntional éthiopien, bien développé, s été a meme de remplacer toute~ leR entrée~ (¡ grnines noires dans ses essais avancés de rendements par des lignées a graines ,ouges, a rendement plus élevé, provenant d' Améríque Latine, qui seront probablement mieux acceptées par les consommateurs. Au Rwanda, plusieurs eentaínes d'hectares dana de petites exploitations ont déja été plantées nvec des variétés de haricots récemment distribuées, introduites il y a quelque snnée."}]},{"head":"Recherche su niveau des exploitstíons","index":3,"paragraphs":[{"index":1,"size":109,"text":"Les trois dernieres années ont été marquées par une améliorntion considérable de la compréhension des cont,aintes ressenties par les exploitonts dalls la production de haricot et des types d'innovatíons qui semblent prometteuses nu niveau des exploita tions. Alors que les programmes régionaux sur le haricot et les chercheurs du CIAT, quelle que soit leur discipline, aient encoufngé la recherche au niveau des exploitlltions, les méthodes utilis6f's O!1t vnríe;. Les effectifs et la structu,e de l'organisation des Institutions notionnles de rcchcrche \"ainsi que l'importance et la complexité relatives de la pr0ductioll de haricot •'~s les systemes lo~sux de production ont influencé la nature de I'engagement ~~CIAT dans les differents pays."},{"index":2,"size":122,"text":"I 1 f~r exemple, la ou des équipes de recherche sur les sytemef< dE' produl'tioll (FSII) ont été mises sur pied dans des régions productrices de horicot, un flppui o été offert i\\. la fois a l'équipe et a ses Iiens avec les programmes IOCOllX de recher~he sur une culture. Les chercheurs travaillant sur une culture dnns une statioll expérimentsle ont générslement be!!oin d'une expérience personnelle de In recherche au niveau des exploitations afín d'évaluer et d'lltilíser i\\ bon escíent l'information réunie par une équipe de FSR. En I'absence d'ul! progrlllnme spécifique de recherche sur les systemes de production, les équipes trnvni!lnnt sur des cultures doivent etre a meme de diagnostiquer les besoins ressentis por les paysans et de tester leur technologie."},{"index":3,"size":28,"text":"Dans la région des Grnm!s Loes, les travaux de dingllostic Ollt Inrgf'lllf'nt !JI ilisé les essais foctoriels menés ii bien dans des exploitntions pour id('nIHk!' el \"¡\",,el' .j, "}]}],"figures":[{"text":"Tableau 1 . Organisation et elCectif des Programmes régionaux du CIAT sur le "},{"text":"( jli) Formation spécialisée spécifique 8. un pays Les priori tés de formation dirCerent dans une certaine mestlrP sclon lcs pnys et le mécanisme du comité directellr facilite un accord sur le programme régiollal de formation qui tient compte de cet aspecto L'lnstitute for Agricultural Research (lAR) éthiopien a identifié IR formntíon destinée a ses chercheurs agronomes comme une nouvelle priorité. Un stnge de deux semaines a été organisé dans le pays par I'IAR pour 45 chercheurs environ afin de couvrir les aspects de la planification, de la gestion ('t de t'fUlfltyse oes différents types d'essais agronomiques. L'JAR, le CIMMYT, le ('lAT et d'nutres organisatlons y ont contribué sous la forme de personnel teclmique et d'llppui financiero En réponse a la requete spécifique de I'Ouganda, un stage slIr les princip('s el les méthodes de gestlon des adventrices est prévu dans le pnys. Ce slnge (!evfnit également profiter 8. plusieurs programmes portant sur des cultures différenles dans ce pays.c) FOl'mation au CIAT, Colombie (j) Stages de courte duréeLe seul stage organisé au siege pour la formalion de groupes, '.\\II']lIel Ollt fJnrticip<S des ehercheurs ressortissanls de eette région, est celui intitulé \"Slllge sur' In produetion el la technologie semenciere\". "},{"text":"( ji) Formation individuelle pour des ehereheurs visitant le CIAT Plusieurs phytogénétieiens et pathologistes Iravaillant dnns ks [H'ogl'nllllllcs nationaux de reeherche dans la région onl passé de deux a qualrc lIlois ou eIAT. En travaillant direetement avee le personnel du Programme du CIAT sur le haricot. ces chercheurs mettent a jour leurs techniques, lorsque celo s'avere nécessaire, el acquierent de nouvelles techniques pour des opplicutiolls npPI'opri0E's. CE' type de formation est jugé approprié pour des phytogénéticiell~. des pflthologistes et des entomologístes expérímentés. Toutefois, i1 n'est possiblc d'nccueillir que six chercheurs par an et les programmes nationnux rloivent d¿;fin;l' un besoin particulier dans chaque caso Vu les frais occasionnés, In portée d In pertinence limitées d'une formation au siege du CIAT pour l'Afrique, nOlls n'envisageons pas d'intensifier cette activité. d) Formation au niveau des études supérieursII existe des possibilités de formation a ce niveau pour les C¡'cf('!]('urs trnvni!lnnt dans les programmes nationaux au sein de chnque progrfltntn<:' r¿;gionlll sur le haricot. Ces bourses sonl accessibles aux chercheurs dont les disciplines rí'vetent une importance pour l'amélioration de la production de hnricot, c0!lfo!'lllément aux priorités établies par chaque programme national. Comme pom les stl1gE'S de courte duré e, íl est nécessaire d'obtenir l'approbation du comité diredeur. e) Fourniture du matériel didactique Le départment de la communication du CIAT élabore dí'S 1I11i!¿;s Ilndío-visuel les comprenant des diapositives en couleur, un manuel, un commentnil'C' enregistré sur cassette et sa lranscription. "},{"text":" 1) Méthodes de travail sur le terrain pour les techniciens de recherche Le personnel régional a organlsé, avec des chercheurs expérirncnté~ IlU niveau national, une série de stages de formation sur les méthodes de travail sur le terrain destiné e a des techniciens de recherche et a de jeunes Cette série de stages est organlsée au niveau régional Ol! nationAI selon la demande et chaque stage s'adresse généralement 8. environ 20 personnes. chercheurs. Chaque stage de deux semaines couvre les sujets sui vants et chercheurs. Chaque stage de deux semaines couvre les sujets sui vants et alterne les séances en classe et les travaux sur le terrain: alterne les séances en classe et les travaux sur le terrain: -Organisatlon du programme national d'amélioration du harlcot, le systeme -Organisatlon du programme national d'amélioration du harlcot, le systeme d'amélioration du matériel génétique y compris;  d'amélioration du matériel génétique y compris; -Morphologie et croissance du haricot;  -Morphologie et croissance du haricot; Préparatlon du sol, carnet d' observations et semences pour les essai!; Préparatlon du sol, carnet d' observations et semences pour les essai!; -Agronomie et protection de la culture du haricot; -Recherche au niveau de l' exploitation; -Co 11 ecte des données 8. partir des essais; -Traitement et analyse des données. *, Phytogéné-ticien, Agronome, Entomo-logiste, Economiste. Agrollome/Phytogénéticien -Agronomie et protection de la culture du haricot; -Recherche au niveau de l' exploitation; -Co 11 ecte des données 8. partir des essais; -Traitement et analyse des données.*, Phytogéné-ticien, Agronome, Entomo-logiste, Economiste. Agrollome/Phytogénéticien  "},{"text":" \",IU ordre d'ímportllllce ¡es contraintes spéciflques et les ínterad ions qni f'xistent entre elles. Les maladies du haricot se sont avérées pnrticuti{>rp!I!f'nt illl[>rwtnntps et la sélection pour une résistance fait l'objet d'une nttentioll part ;cll!í{>rr> dnns les activités de recherche IIU niveau nationsl et en collaboratio!J. En cOlTlplét/lnt la recherche diagnostique initísle, des enquetes intensíves portnnt Rl!r les pI'nUques culturales des pavsc\\Ils et le choix de mélnnges vnriétnux kOIllI\"'f'!Jnnt sOllvent de 10 a 20 type de graines) ont montré que les proportions des difrérents éléments d'un mélange sont ajustées par le paysan suivant les condltíons cH mn tiques prévues pour la salson et la connaissance des dlfférences variétales. Un équílibre est normalement maintenu entre les variétés prétérées pour la COIlSOl11l11lltiOIl 00 la vente et celles qui rEÍaistent aux maladies et Ollt, par conséquent, un rendement relativement stable. Certalns paysans ajustent le méll1l1ge vnriélnl de rflc;on périodique et sement dlfférents mélanges sur différents types de sol.Le diagnostic des besoins de la recherche sur le harlcot en Ethiopie repose fortement sur les résultats d'enquetes générnles portnnt sur Jr\" systPIIlf'S \"e production dnns des régions sélectlonnées, qul son! Imméclifltement suivies pnr des essals simples de nouvelles variétés prometteuses dans des exploítations. Ce dernier type d'essai donna!t, en outre, la possíbilité de comprendre les pratiques eulturales des paysans face au probleme príoritaire, qui est la lutte contre les adventices. Alors qu'une pénurle de main d'oeuvre lors de la période d'nctivités agrícoles la plus intenslve de l'année empeche le sarcJage des légurnineuses, le semis a la volée et a densité plus élevée que celle recommandée sernble réduire les pertes dues aux adventices. Pour tenir compte de ce fait, les recornr1l!I1ldotions de plantel' en rangées destinées ame vulgarisateurs ont été modifiées et l'on étudie la possibilité de lutter contre les advertices en sélectíonnant une v/lriété ¡¡ croissanee plus vigoureuse.L'élaboration d'une technologie visant a résoudre les problemes prioritnires de la productlon de haricot démontre de plus en plus la valeur d'une recherche en collaboration et d'un échange d'informations. La mise au point de rnoyens de lutte contre la mouche du haricot, le principal insecte rnvngcur des hnrkols en Afrique, l'ilJustre bien. Un lfll'ge programme d'utilisation d'insectícide, mcné a bien en Zambie au cours de ces derniere années, a montré que le traitement des graines avec de l'endostLlfan étR!t un moyen effieace et hon mM\"h!' de ttlllc:>. Sur la base de ces résultats expérimentaux, le Rwanda est directemcn! pnssé au test de ce traitement des graines dans les exploitations. C'ehti-('j inclut tlne évaJuation des capacités des paysans et des besoins de vulgarisation lié, i\\ une application sans danger de ¡'insecticide. Le coGt du trAítp.rnen! AU tHUX recommandé de 200g d'endosulfan (35% de pOlldre mouilloblel por 1 un kg c!f' gl'llifle~ se traduit par un accroissement de 2% seulement des rendements moyens cournnts des payssns. Dans la pratique, un accroissement de 50% des rendements est courant. Afrique et d'ailleurs afin d'évaluer l'état des connaiss/l.!lces sur le principvl insecte ravageur de eette culture en Afrique et de concevoir une stratégie de recherche en collaboration pour lutter contre celuí-ei. Les participants ont été invités plus pour le expérience et leurs intérets en matiere de recherche que pour représenter un pays ou une institution particuliers. Les flctes de ee séminaires devraient servir plusieurs objectifs, dont' la forlll!ltion pour l'identifieation des especes et la stratégie de planiCicatlon de la recherche.Undeuxieme séminaire de ce type a eu lieu au Rwanda en novembre 1987, sou;; les auspices du programme des Grands Laes sur le haricot, et portait sur les maladies du haricot. Un troisieme séminaire traitant des problemes agronomiqucs est prévu pour 1988, en Afrique de l'Est. bl séminaire pluridisciplinaire régionaux Un séminaire régional destiné aux chercheUfS travaillant sur les haricots en Afrique de I'Est a été organisé en juin 1987 et aura de nouveau Iieu dans deux ans. Un séminaire franeophone similaire est organisé tous les ans dans la région des Grands l,aes. e) Visites sur terrain Trois membres du programme ougandais ont visité le progOOll1me rwundais, hote du programme régional du CIAT pour la région des Grands \"nes. L/l similarité des eonditions environnementales entre les deux pays a perrnis de ehoisir des reSSOUfces génétiques sur le terrain et Ide discuter de l'amélíoration variét/lle ainsi que des approches de la reeherche :au niveau des exploitlltions qui se sont avérées utíles au Rwanda. D'autres visites sont prévues et incluent des visitent de projets de reeherehe en collaboration, entrepris par des ch('r(\"hellrf; ,hl programme national pour la région. Elles peuvent avoir une fonetion de fornwtion officielle ou informelle pour d'autres ehereheurs dont les intériHs sont similaires. Serviees d'informution sur le harieot Le CIAT opere un Centre d'information sur le harieot a son siege grace aux fonds principaux et aux fonds destinés aux projets spéciaux provennllt du CRDI. Outre la publieation d'Abstraets on F¡eld Beans, le Centre a compilé el cjisséminé tr0is bibliographie sur la recherehe sur le harieot en Afrique (Lope:>:. ] ~R3: (\"lAT, 1 n8-l, CIAT, 1986). Le volume le plus réeent eomprend une bibliograpliie obtf'llue gl'í1('e aux visites d'un eonsultant aupres des chereheurs travaillunt sur Ic huricot dlll1S la région. Un service mel1suel gratuit [ournit des listes du contenll <1'1111(' Illr[,c r,fllll!lle de jOllrnaux agrieoles QUX ehereheurs et flUX bibliotheques. Ph[\\scolus.:.)l.!~!f':!}!1...(ll! llarieot pOllr I'Afrique orientale, compilé et publié par le pl'Or,!'fllllllle ll11li')JJHI k~nyen A Thika, f¿;ürnit un d~bouehé utile pour IR publicntioll des f0sIIltllts de la recherche sur le hll.l'icot. Cette édition en langue francnise est f1uhoréc !lvec I'aide du CIAT. La mise au point de nouveaux systeme de culture exige égl1lernf'nt des tests dllns La mise au point de nouveaux systeme de culture exige égl1lernf'nt des tests dllns les exploitations relativement tot pour minimiser le risque de rejf't pflr les paysnns a la suite d'une longue période d'élaboration. Oans Jn régioll ,1('s Grnnds Lnes, ¡'introdllctíon d'un systeme d'agroforesterie compremm! le pRssnge de In culture des haricots arbustifs a ceux a port volllbile sernble tres prometteuse. Lc>s rendements de haricots peuvent íHre doublés grace a l'odoption d'ulle vnriété a port voluble. Toutefois, cela n'est possible que si le paysnn peu fodlerncnt produire des tuteurs a partir d'un arbuste ou d'une espece nrborée nssoriés. Le les exploitations relativement tot pour minimiser le risque de rejf't pflr les paysnns a la suite d'une longue période d'élaboration. Oans Jn régioll ,1('s Grnnds Lnes, ¡'introdllctíon d'un systeme d'agroforesterie compremm! le pRssnge de In culture des haricots arbustifs a ceux a port volllbile sernble tres prometteuse. Lc>s rendements de haricots peuvent íHre doublés grace a l'odoption d'ulle vnriété a port voluble. Toutefois, cela n'est possible que si le paysnn peu fodlerncnt produire des tuteurs a partir d'un arbuste ou d'une espece nrborée nssoriés. Le probleme de l'érosion devrait etre moins grave dans ce nOllve!lU systeme tnndis que les besoins plus élevés de fertilité des harícots a por! voll1bile requierent probleme de l'érosion devrait etre moins grave dans ce nOllve!lU systeme tnndis que les besoins plus élevés de fertilité des harícots a por! voll1bile requierent un complément de recherche sur la fertilisation el l'épandange d'engr•ais. un complément de recherche sur la fertilisation el l'épandange d'engr•ais.  "}],"sieverID":"1b62b075-07c6-4ec2-8b97-b69e2d125939","abstract":"fOlECClOR ftlSTORICA -----;-o'l\"D1Tr_MI\"'II'I'T\\N ET ACTIVITES DU PROGRAMME DU CIAT SUR J,R lIAIUCOT VISANT A APPUYER LES PROORAMMES NA'('IONAUX 1m ItECIIHltCIlH EN APRIQUE Résumé v Roger A. Klrkby Agronome/Coordlnateur Programme régional de l'Afrique de rEsl sur le haricot CIAT, P.O.Box 67, Debre Zeit, Ethiopie On estime qu'en Afrlque la production de Phaseolus vulgaris L. atteint entre 2 et 2,5 mmlons de tonnes par ano Elle provlent presque excl\\l~ivem!'nl de pe tites exploltatlons. Le Centre Internatlonal d'agrlculture tropieale (CIAT) a mis sur pled trols programmes régionaux associés pour répondre aux besoins des principales régions de productlon du haricot, a savolr, l' i\\ frique centrale, l'Afrique de l'Est et l'Afrlque australe. Ces programmes décentrnlisés visent a appuyer et a encQurager les eHorts nationaux de recherche dans le domaine de l'amélioratlon génétique, de la mise au point de pratlques et de systemes culturaux plus productifs et de la formatlon du personnel. Les responsables des programmes nationaux déterminent collectívement les domaines príoritaires pour la recherche dans leur région el, par le bia¡~ du mécanísme du comité directeur, lIs aldent a concevolr le résel1u réRíolw! et approuvent l'utlllsatlon des fonds réglonaux. Récemment, les activités de formation ont inelus f¡ la roís des stages au niveau régional aillsi que dans le pays sur des technlques de recherche en station expérimentale et au niveau des exploltatlons agricoles. Les études universitaires supérieures sont égalernent encouragées. Des sémlneires et des visites de sulvi son! orgonisés o (in d'examiner les résultats et les besoins de recherche dans les dorna in es príoritaíres et pour réunir des groupes interdisciplinaires aU niveau sous-régional.l,e renforcement de la base natíonale de ressources génétiques démontre déja l'importance des ressources génétiques exotiques dans plusíeurs pays. Nous encourageons l'identification par les programmes natiol1aux des hesoíns en matiere de recherche ressentis par les petits exploitants, I'incorporatioll de ces príorités 10rs de la conception du programme et les essais des technologies prometteuses au niveau des exploitatlons. Des projets régíonotlx de recherche en collaboratlon sont en cours dans plusleurs domaínes dont l'épidémíologie, les pertes de productlon culturale, les mesures de lulte contre certl1ines IIll1lndies et Insectes, et l'évaluation des variétés dans divers pays .. Les innovations particulierement bien accueilJies par les exploitants t'omprennent l'utilisation d'un systeme bon marché d'enrobage des graines arin de lulter contre la rnouche du haricot et l'introduction d'une technologie perrnettant de produire des haricots volubiles dans les régions les plus rertiles 'luí ne produisent actuellement que des haricots nains . • ~-~ ~ ! I \",_, \" f'."}

data/part_2/0b6503f85c42d2136bf47f7156261d68.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b6503f85c42d2136bf47f7156261d68","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1a88ca38-1e89-4d58-8547-3c85cd7da2df/retrieve"},"pageCount":5,"title":"39,4 kg","keywords":[],"chapters":[{"head":"22,9% consumidores rurales","index":1,"paragraphs":[{"index":1,"size":137,"text":"Fuente: Elaborado por los autores con base en DANE (2021) y FAO (2021). Nota: (a) Tasa de crecimiento de media móvil de 10 años, para atenuar variaciones interanuales. A partir del 2019 los valores del PIB son preliminares. (b) De acuerdo con un reporte del Ministerio de Agricultura de 2020, las alteraciones de los precios se deben a escenarios de sobreoferta de la demanda de yuca dulce, la cual coincide con desabastecimiento de yuca amarga, lo que abre un escenario para la recomposición de la producción nacional. Según noticias recientes, esta situación también se ha presentado en el último año como efecto de las alteraciones de la pandemia.  1995-2004 1996-2005 1997-2006 1998-2007 1999-2008 2000-2009 2001-2010 2002-2011 2003-2012 2004-2013 2005-2014 2006-2015 2007-2016 2008-2017 2009-2018 2010-2019 Actores de la cadena productiva de la yuca (resumida) en Colombia en 2018"},{"index":2,"size":63,"text":"Fuente: Elaborado por los autores con base en UPRA y FAO (2021). Nota: (a) Esta cantidad de consumo incluye las importaciones, que corresponden al 1.39% (FAOSTAT, 2021). (b) Alimentación: hace referencia a la cantidad total del producto disponible para consumo humano durante el período de referencia. Los datos también incluyen los productos derivados. (c) Otros usos: residuos, pérdidas, alimentación animal, otros no alimentarios."}]},{"head":"ALREDEDOR DE","index":2,"paragraphs":[{"index":1,"size":21,"text":"Un valor con potencial de crecimiento debido a la creciente demanda local y global para el uso industrial de la yuca. "}]},{"head":"802","index":3,"paragraphs":[{"index":1,"size":8,"text":"$ miles de millones de pesos colombianos (COP)."}]},{"head":"Extensión agrícola en el país","index":4,"paragraphs":[{"index":1,"size":7,"text":"Fuente: Cassava Lighthouse (2021) y FAO (2021). "}]},{"head":"REGIONES","index":5,"paragraphs":[{"index":1,"size":181,"text":"Colombia es el tercer país de Latinoamérica con mayor producción de yuca. En general, predomina la producción de yuca tradicional para consumo, no obstante, la superficie sembrada de yuca industrial se ha incrementado en un 290% entre 2010 y 2020, alcanzando el 6% de la superficie total sembrada de yuca. Por su parte, la superficie sembrada de yuca tradicional incrementó en un 5% en relación con el 2007, sin embargo, ha sido fluctuante durante todo el período alcanzando sus valores más altos en 2013 y 2018. El rendimiento promedio creció en un 7,6% entre 2007 y 2020. Nota: Los quintiles y probabilidades se obtienen a partir del puntaje obtenido por los hogares encuestados en la \"Poverty Score Card\". Cada columna nos indica el rango de probabilidad de los hogares en cada quintil de tener ingresos menores a la línea de pobreza de US$2,5. Por ejemplo, en la Costa Norte 1 de cada 10 hogares tiene probabilidades entre 90,7 y 67,8 de tener ingresos menores a la línea de pobreza. Mientras en el Cauca, 3,5 de cada 10 hogares enfrenta dichas probabilidades."}]},{"head":"RENDIMIENTO","index":6,"paragraphs":[{"index":1,"size":57,"text":"Ton/ha El porcentaje de agricultores utilizando variedades mejoradas es de apenas 6% y 19% en Caribe y Cauca respectivamente, pero esos mismos agricultores representan porcentajes mayores de área sembrada y el 41% de la producción total en Cauca, lo cual resalta la importancia de diseminar variedades mejoradas con el objetivo de incrementar la productividad de los agricultores. "}]}],"figures":[{"text":" Fuente: UPRA (2021). "},{"text":"Tasa de crecimiento del valor de la producción de la yuca nacional vs. PIB agropecuario a  PRODUCCIÓN  CONSUMO a CONSUMIDORES PRODUCCIÓNCONSUMO a CONSUMIDORES 2.555.892 Ton 93,1% Yuca de mesa 6,9% Yuca industrial Mercados mayoristas regionales Finca Rallanderías Almidones de Sucre Ingredion 2.591.419 Ton 83,8% destinado a alimentación b 1,3% destinado a procesamiento 49.661.000 Pob. 77,1% consumidores urbanos 2.555.892 Ton 93,1% Yuca de mesa 6,9% Yuca industrialMercados mayoristas regionales Finca Rallanderías Almidones de Sucre Ingredion2.591.419 Ton 83,8% destinado a alimentación b 1,3% destinado a procesamiento49.661.000 Pob. 77,1% consumidores urbanos  Otras artesanales 14,9% destinado a otros usos c  Otras artesanales14,9% destinado a otros usos c Industria de alimentos para consumo humano   Industria de alimentos para consumo humano Industria de concentrados animales   Industria de concentrados animales  "},{"text":"PIB Nacional PIB Agropecuario Valor de la producción de yuca  18% 18% 16% 16% 14% 14% 12% 12% 10% 10% 8% 8% 6% 6% 4% 4% 2% 2% 0 0 -2% -2% -4% -4%  "},{"text":"2020 En   COLOMBIA COSECHÓ COLOMBIA COSECHÓ  205.118 ha 205.118 ha Que representan el Que representan el 4,08 % de la SUPERFICIE COSECHADA DE CULTIVOS del país. 4,08 % de la SUPERFICIE COSECHADA DE CULTIVOS del país.  LA CANTIDAD COSECHADA LA CANTIDAD COSECHADA  de raíces frescas fue de de raíces frescas fue de  2,4 millones de toneladas 2.413.051 2,4 millones de toneladas2.413.051 US$ 217millones a US$217millones a  "},{"text":" Nota: (a) Los municipios sin color, no fueron parte del marco muestral aleatorio.  CARACTERIZACIÓN DE HOGARES PRODUCTORES   CARACTERIZACIÓN DE HOGARES PRODUCTORES Producción (ton) -Superficie (ha) 3.000.000 2.500.000 2.000.000 1.500.000 1.000.000 500.000 0 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 12 10 8 6 4 2 0 Rendimiento (ton/ha) Superficie (ha) 250.000 200.000 150.000 100.000 50.000 0 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 Producción (ton) -Superficie (ha)3.000.000 2.500.000 2.000.000 1.500.000 1.000.000 500.000 02007200820092010201120122013201420152016201720182019202012 10 8 6 4 2 0Rendimiento (ton/ha)Superficie (ha)250.000 200.000 150.000 100.000 50.000 020072008200920102011201220132014201520162017201820192020  Producción  Área cosechada   Rendimiento    Caribe a Centro Sur b LLano c Centro Oriente d Pacífico e  Eje Cafetero -Antioquia f ProducciónÁrea cosechadaRendimientoCaribe aCentro Sur bLLano cCentro Oriente dPacífico eEje Cafetero -Antioquia f Fuente: UPRA (2021).                 Fuente: UPRA (2021).               Fuente: UPRA (2021).Fuente: UPRA (2021).                   Nota: (a) Caribe: Atlántico, Bolívar, Cesar, Córdoba, La Guajira, Magdalena, San Andrés y Providencia, Sucre. (b) Centro Nota: (a) Caribe: Atlántico, Bolívar, Cesar, Córdoba, La Guajira, Magdalena, San Andrés y Providencia, Sucre. (b) Centro                   Sur: Amazonas, Caquetá, Huila, Putumayo, Tolima. (c) Llano: Arauca, Casanare, Guainía, Guaviare, Meta, Vaupés, Vichada. Sur: Amazonas, Caquetá, Huila, Putumayo, Tolima. (c) Llano: Arauca, Casanare, Guainía, Guaviare, Meta, Vaupés, Vichada.                   (d) Centro Oriente: Boyacá, Cundinamarca, Norte de Santander, Santander. (e) Pacífico: Cauca, Chocó, Nariño, Valle del (d) Centro Oriente: Boyacá, Cundinamarca, Norte de Santander, Santander. (e) Pacífico: Cauca, Chocó, Nariño, Valle del                   Cauca. (f) Eje Cafetero-Antioquia: Antioquia, Caldas, Quindío, Risaralda.       Cauca. (f) Eje Cafetero-Antioquia: Antioquia, Caldas, Quindío, Risaralda.  Seguridad           43,6 %     Seguridad          23,3 %    Seguridad43,6 %Seguridad23,3 %  Inseguridad          56,4 %     Inseguridad          76,7 %    Inseguridad56,4 %Inseguridad76,7 %  Leve           34,2 %     Leve          62,0 %    Leve34,2 %Leve62,0 %  Moderada           12,0 %     Moderada          12,8 %    Moderada12,0 %Moderada12,8 %  Severa           10,2 %     Severa          2,0 %    Severa10,2 %Severa2,0 %  90,7 -67,8   1              90,7 -67,8   1            90,7 -67,8190,7 -67,81  56,5 -43,2   2              56,5 -43,2   2            56,5 -43,2256,5 -43,22  29,3 -17,9   3              29,3 -17,9   3            29,3 -17,9329,3 -17,93  17,9 -10,4   4              17,9 -10,4   4            17,9 -10,4417,9 -10,44  10,4 -0,0   5              10,4 -0,0   5            10,4 -0,0510,4 -0,05        FINCA               FINCA        FINCAFINCA        9,57ha             3,1ha       9,57ha3,1ha        0,7 -7,0 10,1 -12,8 12,9 -16,1 7,1 -10,0 LOTE DE YUCA 1,6ha         1,1ha LOTE DE YUCA     0,7 -7,0 10,1 -12,8 12,9 -16,1 7,1 -10,0 LOTE DE YUCA 1,6ha1,1ha LOTE DE YUCA        Nota: Valores promedio  16,2 o más         Nota: Valores promedio       Nota: Valores promedio16,2 o másNota: Valores promedio  "},{"text":"Quintil Quintil CARACTERIZACIÓN DE LA ADOPCIÓN Adopción de variedades en el 2016 Inventario de Tecnologías Participación en el total de agricultores, área y producción por tipo de variedades  COSTA CARIBE a  CAUCA a  COSTA CARIBE aCAUCA a   0,7 -7,0  0,7 -7,0   7,1 -10,0  7,1 -10,0   10,1 -12,8  10,1 -12,8   12,9 -16,1  12,9 -16,1   16,2 o más  16,2 o más SEGURIDAD ALIMENTARIA  SEGURIDAD ALIMENTARIA   POBREZA  POBREZA Probabilidad %  Probabilidad %  Probabilidad %Probabilidad % 9 %  35 % 9%35% 15 % 28 % 15%28% 21 % 20 % 21%20% 31 % 8 % 31%8% 25 % 9 % 25%9% TAMAÑO DE FINCA  TAMAÑO DE FINCA  "},{"text":"17 % 94 % 83 % 6 % COSTA CARIBE 41 % 26 % 19 % 81 % 74 % 59 % CAUCA Variedades de yuca recientemente liberadas en Colombia  Variedad ID a Uso Región Rendimiento potencial b (ton/ha) Año Fuente VariedadID aUsoRegiónRendimiento potencial b (ton/ha) AñoFuente  "}],"sieverID":"958061b3-692c-40ee-ae2e-17d04d3dc9e2","abstract":"si bien se ha mantenido la mayor parte del tiempo por encima de la tasa del PIB fue altamente volátil, alcanzando varios picos con tasas promedio de crecimiento de hasta el 16% entre 2003-2012 o cayendo a tasas de crecimiento negativas de -1% durante la última década. Esta volatilidad, refleja la inestabilidad del cultivo cuyos precios se caracterizan por presentar alteraciones abruptas b que ponen en riesgo a los agricultores al reducir sus ingresos."}